Search Results

Search found 7511 results on 301 pages for 'synchronized block'.

Page 219/301 | < Previous Page | 215 216 217 218 219 220 221 222 223 224 225 226  | Next Page >

• Can I subnet a subnet?

  - by Portman

  Apologies in advance for the botched terminology. I have read the Server Fault Subnet Wiki but this is more of an ISP question. I currently have a /27 block of public IPs. I use give my router the first address in this pool and then use 1-to-1 NAT for all the servers behind the firewall, so that they each get their own public IP. The router/firewall is currently using (actual addresses removed to protect the guilty): IP Address: XXX.XXX.XXX.164 Subnet mask: 255.255.255.224 Gateway: XXX.XXX.XXX.161 What I would like to do is break out my subnet into two separate /28 subnets. And do this in a way that is transparent to the ISP (i.e., they see me as continuing to operate a single /27). Currently, my topology looks like: ISP | [Router/Firewall] | [Managed Ethernet Switch] / \ \ [Server1] [Server2] [Server3] (etc) Instead, I would like it to look like: ISP | [Switch] / \ [Router1] [Router2] | | | | [S1] [S2] [S3] [S4] (etc) As you can see, this would partition me into two separate networks. I'm struggling with what the correct IP settings would be on Router1 and Router2. Here's what I have right now: Router1 Router2 IP Address: XXX.XXX.XXX.164 XXX.XXX.XXX.180 Subnet mask: 255.255.255.240 255.255.255.240 Gateway: XXX.XXX.XXX.161 XXX.XXX.XXX.161 Note that normally you would expect Router2 to have a gateway of .177, but I'm trying to get them both to use the gateway originally given to me by the ISP. Is subnetting like this in fact possible, or am I completely botching the most basic concepts?

  Read the article

• Sending USR2 to mongrel_rails sometimes results in an “Address already in use” on the restart

  - by Ben

  We have a rolling-restart mode for our mongrel cluster that sends a USR2 signal to each running process. This works great, most of the time. But very occasionally the mongrel process will shutdown, and then fail to restart, with the following error: /usr/local/lib/ruby/gems/1.8/gems/mongrel-1.1.5/bin/../lib/mongrel/tcphack.rb:12:in `initialize_without_backlog': Address already in use - bind(2) (Errno::EADDRINUSE) from /usr/local/lib/ruby/gems/1.8/gems/mongrel-1.1.5/bin/../lib/mongrel/tcphack.rb:12:in `initialize' from /usr/local/lib/ruby/gems/1.8/gems/mongrel-1.1.5/bin/../lib/mongrel.rb:93:in `new' from /usr/local/lib/ruby/gems/1.8/gems/mongrel-1.1.5/bin/../lib/mongrel.rb:93:in `initialize' from /usr/local/lib/ruby/gems/1.8/gems/mongrel-1.1.5/bin/../lib/mongrel/configurator.rb:139:in `new' from /usr/local/lib/ruby/gems/1.8/gems/mongrel-1.1.5/bin/../lib/mongrel/configurator.rb:139:in `listener' Looking though the mongrel source, the USR2 handler calls a synchronous stop on the running server, so it ought to block until the socket has been released. Has anyone seen this error? Does anyone have any ideas what might cause it? (I asked this question over on StackOverflow initially, but thought it might be more appropriate here)

  Read the article

• What is Apache Synapse?

  - by Aren B

  My website keeps getting hit by odd requests with the following user-agent string: Mozilla/4.0 (compatible; Synapse) Using our friendly tool Google I was able to determine this is the hallmark calling-card of our friendly neighborhood Apache Synapse. A 'Lightweight ESB (Enterprise Service Bus)'. Now, based on this information I was able to gather, I still have no clue what this tool is used for. All I can tell is that is has something to do with Web-Services, and supports a variety of protocols. The Info page only leads me to conclude it has something to do with proxies, and web-services. The problem I've run into is that while normally I wouldn't care, we're getting hit quite a bit by Russian IPs (not that russian's are bad, but our site is pretty regionally specific), and when they do they're shoving wierd (not xss/malicious at least not yet) values into our query string parameters. Things like &PageNum=-1 or &Brand=25/5/2010 9:04:52 PM. Before I go ahead and block these ips/useragent from our site, I'd like some help understanding just what is going on. Any help would be greatly appreciated :)

  Read the article

• Why are UDP messages from outside the network received but not delivered?

  - by Warren Pena

  I have an Ubuntu Server 10.04 application I've developed that receives messages over a UDP port. The ultimate purpose of this application is to receive messages sent from workers' 3G modems out in the field. If use netcat on either another ubuntu Server or my Vista laptop (both on the same LAN as my test machine) to send a message, the message arrives correctly and appears in my application. However, if I go out to my car and use its 3G modem to send a message from the same Vista laptop, it doesn't work. If I run tcpdump -A, I see the message arrive correctly, but it's never delivered to my application. Clearly, the OS is the one making the choice not to deliver the messages (else they wouldn't appear in tcpdump nor would my app receive them when coming from local machines). I have not installed any firewall software on this machine, nor am I aware of anything installed by default that would block the traffic. sudo iptables --list returns Chain INPUT (policy ACCEPT) target prot opt source destination Chain FORWARD (policy ACCEPT) target prot opt source destination Chain OUTPUT (policy ACCEPT) target prot opt source destination I'm not too familiar with iptables, but it looks to me like that's telling it to not do anything. What could be going on that's preventing my messages from being delivered?

  Read the article

• sendmail.exe: Error during delivery. Service not available, closing transmission channel

  - by user2810332

  I have a module in my system that will trigger an email and send it to user. The email will be sent to user when the product in my system is going to expired soon. I test the whole module in localhost and there is no problem with it. Then, I finally moved the module in my server but it gives this error. sendmail: Error during delivery: Service not available, closing transmission channel. It will also create a notepad in my desktop that contains information like this : command line : C:\wamp\sendmail\sendmail.exe -t -i executable : sendmail.exe exec. date/time : 2011-06-18 01:10 compiled with : Delphi 2006/07 madExcept version : 3.0l callstack crc : $fecf9b34, $5562b2fa, $5562b2fa exception number : 1 exception class : EIdSMTPReplyError exception message : Service not available, closing transmission channel. main thread ($15b0): 0045918a +003e sendmail.exe IdReplySMTP 501 +1 TIdReplySMTP.RaiseReplyError 0043ff28 +0008 sendmail.exe IdTCPConnection 576 +0 TIdTCPConnection.RaiseExceptionForLastCmdResult 004402f4 +003c sendmail.exe IdTCPConnection 751 +10 TIdTCPConnection.CheckResponse 0043feba +002a sendmail.exe IdTCPConnection 565 +2 TIdTCPConnection.GetResponse 004403fd +002d sendmail.exe IdTCPConnection 788 +4 TIdTCPConnection.GetResponse 0045ab97 +0033 sendmail.exe IdSMTP 375 +4 TIdSMTP.Connect 004b5f14 +1060 sendmail.exe sendmail 808 +326 initialization 77013675 +0010 kernel32.dll BaseThreadInitThunk thread $cf8: 77a400e6 +0e ntdll.dll NtWaitForMultipleObjects 77013675 +10 kernel32.dll BaseThreadInitThunk thread $1088: 77a41ecf +0b ntdll.dll NtWaitForWorkViaWorkerFactory 77013675 +10 kernel32.dll BaseThreadInitThunk May I know what is the problem of this error ? Is it something like firewall in the server that block my sendmail.exe or anything else ? FYI, I'm using Wamp and Sendmail to send the email. This is my first time seeing error like this. I need an explanation on this. Thank you.

  Read the article

• SAN with iSCSI-Target Performance Horrendous

  - by Justin

  We have a poor man's SAN setup in a 1U Ubuntu server running iSCSI-Target with two 300GB drives in RAID-0. We then are using it for block level storage for virtual machines. The hypervisor is connected to the SAN via gigabit on a dedicated VLAN and interfaces. We only have a single virtual machine setup and doing some benchmarks. If we run hdparm -t /dev/sda1 from the virtual machine, we get 'ok' performance of 75MB/s from the virtual machine to the SAN. Then we basically compile a package with ./configure and make. Things start ok, but then all the sudden the load average on the SAN grows to 7+ and things slow down to a crawl. When we SSH into the SAN and run top, sure the load is 7+, but the CPU usage is basically nothing, also the server has 1.5GB of memory available. When we kill the compile on the virtual machine, slowly the LOAD on the SAN goes back to sub 1 figures. What in the world is causing this? How can we diagnosis this further? Here are two screenshot from the SAN during high load. 1> Output of iotop on the SAN: 2> Output of top on the SAN:

  Read the article

• SAN Replication for Fault tolerance using EVA4400

  - by Sergei

  Hi Everyone, I hope that someone would point me in the correct direction - it looks like I have no enough konwledge in the subject and timeframes are too tight for me to explore different scenarios in depth.. We have two datacenters few miles away from each other connected by 100 Mbps link.Each datacenter will have 5 BL490 blades with ESX Standard hosting about 50 VMs. Eac hsite has HP eva4400 SAN with SAN replication set up.VC is going to be in the first datacenter and both datacenter are networked. SAN Replication is block level so it seems like I cannot just replicate changes but all writes would have to be replicated.This should not be a problem as link can sustain about 1.8 TB a dayand data can be buffered. I am having trouble however visioning how recovery would work in this case.We don't need instant recovery , I would say 4 hours recovery time is accepted so fancy automatic SRM like DR scenario would not be easily accepted due to the financial reasons, however any comments are welcomed. Current idea is following: replicate LUNs from primary site to the secondary.When disaster strikes, IT personnel switches on ESX hosts on the remote side and connects replicated LUNS to them, then registers VMs and changes IP address. I understand that this seems like horribly manual process and I almost sure I have missed some obvious pitfalls here. Could someone let me know what direction should I go?An articles regarding the subject? This is a brand new setup and we would rather build up basic recovery process and scale it later.I just need to have a right direction to allow for such scalability. Thank you very much in advance!

  Read the article

• authbind, privbind or iptables REDIRECT (port 80 to 8080)?

  - by chris_l

  Hi, I'd like to run Glassfish v3 as a non-privileged user on Linux (Debian), but make it available on port 80. I'm currently doing this with iptables: iptables -t nat -I PREROUTING -p tcp -d x.x.x.x --dport 80 -j REDIRECT --to-port 8080 This works, but I wonder: If this has any significant performance impact compared to binding directly to port 80 If I could make a similar setup also work for HTTPS (or if that must run on 443) If there's a way to avoid other users from binding to port 8080 (in case my server crashes) - maybe block that port permanently to other users somehow? ...or if I should use authbind/privbind instead? Problem: I couldn't make it work with authbind or privbind so far. For authbind, I edited asadmin's last line to: exec authbind --deep "$JAVA" -Djava.net.preferIPv4Stack=true -jar ... For privbind: exec privbind -u glassfish "$JAVA" -Djava.net.preferIPv4Stack=true -jar ... (Only) with these settings, I can successfully perform a create-domain --domainport 80. This proves, that authbind and privbind actually work (the authbind version of the script is called by the glassfish user; the privbind version is called by root of course). However, in both cases I get the following exception, when starting the domain (start-domain): [#|2010-03-20T13:25:21.925+0100|SEVERE|glassfishv3.0|javax.enterprise.system.core.com.sun.enterprise.v3.server|_ThreadID=11;_ThreadName=FelixStartLevel;|Shutting down v3 due to startup exception : Permission denied: 80=com.sun.enterprise.v3.services.impl.monitor.MonitorableSelectorHandler@1fc25e5|#] I haven't found a solution for that yet (after searching the web, it seems, that this isn't so easy?) But maybe, the solution with iptables is good enough - what do you think? Thanks, Chris

  Read the article

• How do I get more information on a potential network freeloader?

  - by Dov

  I have a home network set up, complete with a relatively good password. I'm in Mac OS X 10.6 (Snow Leopard) and have been noticing, on occasion, a computer showing up in my Finder's Shared section, that is not one of my own (the "pe-xpjalle" box pictured below). He has a tendency to come and go. How can I figure out his MAC address or something, so I can block him? I checked my "Logs and Statistics" in the Airport Utility, and didn't see that computer under DHCP clients. I'd rather not change my password, since I have quite a few devices I'd have to update. Is there any other reason he's show up on my network besides having guessed my password? Update: I fixed the Dropbox URL above (how embarrassing, I'm new to Dropbox. Thanks for the heads up, Doug.) Update 2: I tried clicking on "Connect as..." just for the hell of it, and got the dialog below. Now I have even less an idea what's going on than before. I don't have Parallels of VMware running, just the following: Transmission, NetNewsWire, Mail, Things, Safari, iTunes, Photoshop, Pages, Yojimbo, Preferences, AppleScript Editor, Software Update, Airport Utility, and Terminal. I don't think any of those create a virtual network machine, right? And no VMware machine of mine has ever had a name resembling "pe-xpjalle". Update 3: I just changed my passwords on both my N- and G-only networks, and I'm still seeing this, so I highly doubt that it's someone who's figured out my password (twice now). I'm really stumped.

  Read the article

• CoreStore Encryption Error on Mac Lion

  - by Michael

  I am trying to encrypt an external drive using diskutil CoreStorage on Mac Lion 10.7.4. I thought the only requirements were that the drive have GUID partition scheme and Journaled HFS+ file system. I think my drive is configured accordingly but when I type the following command I get an error message back: Michaels-MacBook-Pro:~ Michael$ diskutil cs convert disk2 -passphrase TestPassword Error converting disk to CoreStorage: The given file system is not supported on Core Storage (-69756) Here are the details reported for the drive in question: Michaels-MacBook-Pro:~ Michael$ diskutil list disk2 /dev/disk2 #: TYPE NAME SIZE IDENTIFIER 0: GUID_partition_scheme *500.1 GB disk2 1: EFI 209.7 MB disk2s1 2: Apple_HFS Test1 499.8 GB disk2s2 Michaels-MacBook-Pro:~ Michael$ diskutil list disk2 /dev/disk2 #: TYPE NAME SIZE IDENTIFIER 0: GUID_partition_scheme *500.1 GB disk2 1: EFI 209.7 MB disk2s1 2: Apple_HFS Test1 499.8 GB disk2s2 Michaels-MacBook-Pro:~ Michael$ diskutil info disk2s2 Device Identifier: disk2s2 Device Node: /dev/disk2s2 Part of Whole: disk2 Device / Media Name: Test1 Volume Name: Test1 Escaped with Unicode: Test1 Mounted: Yes Mount Point: /Volumes/Test1 Escaped with Unicode: /Volumes/Test1 File System Personality: Journaled HFS+ Type (Bundle): hfs Name (User Visible): Mac OS Extended (Journaled) Journal: Journal size 40960 KB at offset 0xe8e000 Owners: Disabled Partition Type: Apple_HFS OS Can Be Installed: Yes Media Type: Generic Protocol: FireWire SMART Status: Not Supported Volume UUID: 1024D0B8-1C45-3057-B040-AE5C3841DABF Total Size: 499.8 GB (499763888128 Bytes) (exactly 976101344 512-Byte-Blocks) Volume Free Space: 499.3 GB (499315826688 Bytes) (exactly 975226224 512-Byte-Blocks) Device Block Size: 512 Bytes Read-Only Media: No Read-Only Volume: No Ejectable: Yes Whole: No Internal: No I'm a little concerned that the "Partition Type: Apple_HFS" entry is causing the problem, but I don't know how to change that. I only seem to be able to control the "File System Personality: Journaled HFS+" in Disk Utility. Can anyone shed some light on this for me?

  Read the article

• SAN performance issues storing SQL Server tempdb on a SAN that's being backed up

  - by user42724

  I'm afraid I don't know much about SAN's so please forgive my lack of detail or technical terms. As a developer I've just completed and put on an existing production system a new application but it would appear to have tipped the scales regarding the performance of the backups being taken from the SAN. As I understand it there's a mirror of the SAN being taken usually constantly at the block-level. However, there seem to be so many new writes to the disk that the SAN mirroring/backup process can no longer keep up. I believe I've narrowed this down to SQL Servers tempdb which exists on a drive that contributes the largest portion of the problem! In fact I think tempdb has be contributing the largest portion of the issues all along regardless of my application! My question therefore is whether the tempdb should ever be mirrored or backed on the SAN and whether anyone else has gone through this sort of pain already? I'm wondering whether it's a best practise to make sure that tempdb is never mirrored on a SAN simply because any writes to it don't need to be saved. This also raises a slightly connected question - is it better to rely on SQL Servers built-in database backups tools (DB in full-recovery mode with full/differential and transaction log backups) or, as is the case with our application, SQL server is in simple recovery mode and never backed up since the SAN is mirrored and backed up? Many thanks

  Read the article

• Finding all IP ranges blelonging to a specific ISP

  - by Jim Jim

  I'm having an issue with a certain individual who keeps scraping my site in an aggressive manner; wasting bandwidth and CPU resources. I've already implemented a system which tails my web server access logs, adds each new IP to a database, keeps track of the number of requests made from that IP, and then, if the same IP goes over a certain threshold of requests within a certain time period, it's blocked via iptables. It may sound elaborate, but as far as I know, there exists no pre-made solution designed to limit a certain IP to a certain amount of bandwidth/requests. This works fine for most crawlers, but an extremely persistent individual is getting a new IP from his/her ISP pool each time they're blocked. I would like to block the ISP entirely, but don't know how to go about it. Doing a whois on a few sample IPs, I can see that they all share the same "netname", "mnt-by", and "origin/AS". Is there a way I can query the ARIN/RIPE database for all subnets using the same mnt-by/AS/netname? If not, how else could I go about getting every IP belonging to this ISP? Thanks.

  Read the article

• "Windows detected a hard drive" issue in Windows 7 x64

  - by Jasiu

  I upgraded to the OCZ-Agility3 120GB from a 60 OCZ Vertex2 SSD. I cloned the drive from the Vertex to the new Agility. Everything seemed to have gone well and have not had any problems. Recently in the passed month I have gotten this error: I downloaded teh OCZToolboxMP and ran the SMART utility and don't see anything wrong: SMART READ DATA ModelNumber : OCZ-AGILITY3 Serial Number : OCZ-Y1945X77438P4NU6 WWN : 5-e8-3a-97 ebea5ba76 Revision: 10 Attributes List 1: SSD Raw Read Error Rate Normalized Rate: 70 total ECC and RAISE errors 5: SSD Retired Block Count Reserve blocks remaining: 100% 9: SSD Power-On Hours Total hours power on: 968 12: SSD Power Cycle Count Count of power on/off cycles: 28 171: SSD Program Fail Count Total number of Flash program operation failures: 0 172: SSD Erase Fail Count Total number of Flash erase operation failures: 0 174: SSD Unexpected power loss count Total number of unexpected power loss: 11 177: SSD Wear Range Delta Delta between most-worn and least-worn Flash blocks: 0 181: SSD Program Fail Count Total number of Flash program operation failures: 0 182: SSD Erase Fail Count Total number of Flash erase operation failures: 0 187: SSD Reported Uncorrectable Errors Uncorrectable RAISE errors reported to the host for all data access: 4145 194: SSD Temperature Monitoring Current: 30 High: 30 Low: 30 195: SSD ECC On-the-fly Count Normalized Rate: 120 196: SSD Reallocation Event Count Total number of reallocated Flash blocks: 100 201: SSD Uncorrectable Soft Read Error Rate Normalized Rate: 120 204: SSD Soft ECC Correction Rate (RAISE) Normalized Rate: 120 230: SSD Life Curve Status Current state of drive operation based upon the Life Curve: 100 231: SSD Life Left Approximate SDD life Remaining: 100% 241: SSD Lifetime writes from host lifetime writes 893 GB 242: SSD Lifetime reads from host lifetime reads 968 GB Does anyone have any ideas of what might be wrong and or how I can go about fixing this? Please let me know if there is other information I can provide. Thanks for your help Windows 7 x64 SP1 AMD Phenom II X4 940 8GB RAM

  Read the article

• Slow VM on esxi 4.1

  - by user57432

  We have a FreeBSD 64bit running on a esxi 4.1, the hardware platform is a DELL R710 with 2 x 56xx (intel 6core cpu) and 48 GB ram. The FreeBSD vm is very slow, when we compiles/builds something on it, it takes 5 minuts and it says "build time 18 seconds.". There's no vmtools installed on the vm. The same vm is installaed on another R710 running esxi 4.0 for dell and there's no problems with that one. Does anyone have any idea about what to look for? the VMs on the second server (ESXi 4.1) is a clone of the VMs running on the first VMserver (ESXi 4.0 Dell edition). It's not possible for me to move the VM back to the first server since the file contaning the vm is too big. We installed the new esxi with a datasore with 8mb blocks because 1mb blocks dident allow for the file size we needed. It looks like the www server on the new ESXi 4.1 works fine, but I havent really tested it. There's not installed vmtools on any of the VMs (FreeBSD). The block size on the second VM (ESXi 4.1) datastorage is 8mb and 1mb on the first (ESXi 4.0)

  Read the article

• How to diagnose frequent segfaults

  - by Andreas Gohr

  My server is logging frequent segmentation faults to /var/log/kern.log in different tools. So far I've seen them in Perl, PHP and rsync. All installed software is up-to-date Debian packages. Here's an exerpt from the log file: Mar 2 01:07:54 gaz kernel: [ 5316.246303] imapsync[4533]: segfault at 8b ip 00007fb448c98fe6 sp 00007ffff571dd68 error 4 in libperl.so.5.10.1[7fb448bd7000+164000] Mar 2 01:17:42 gaz kernel: [ 5904.354307] php5-cgi[4441]: segfault at 2bb3dc8 ip 0000000002bb3dc8 sp 00007fffbeeaae48 error 15 Mar 2 02:54:05 gaz kernel: [11687.922316] php5-cgi[4495]: segfault at 2d7acf9 ip 0000000002d7acf9 sp 00007fff60c6eb18 error 15 Mar 2 10:50:08 gaz kernel: [40250.390322] BUG: unable to handle kernel paging request at 00000000024b03f0 Mar 2 10:50:08 gaz kernel: [40250.390341] IP: [<00000000024b03f0>] 0x24b03f0 Mar 2 10:50:08 gaz kernel: [40250.390353] PGD 208c71067 PUD 21c811067 PMD 209329067 PTE 8000000211c88067 Mar 2 10:50:08 gaz kernel: [40250.390365] Oops: 0011 [#1] SMP Mar 2 10:50:08 gaz kernel: [40250.390373] last sysfs file: /sys/devices/pci0000:00/0000:00:12.0/host4/target4:0:0/4:0:0:0/block/sdb/stat Mar 2 10:50:08 gaz kernel: [40250.390386] CPU 1 Mar 2 10:50:08 gaz kernel: [40250.390392] Modules linked in: cpufreq_userspace cpufreq_stats cpufreq_powersave cpufreq_conservative xt_recent xt_tcpudp iptable_nat nf_nat nf_conntrack_ipv4 nf_defrag_ ipv4 ip6table_filter ip6_tables xt_DSCP xt_TCPMSS ipt_LOG ipt_REJECT iptable_mangle iptable_filter xt_multiport xt_state xt_limit xt_conntrack nf_conntrack_ftp nf_conntrack ip_tables x_tables loop snd _hda_codec_atihdmi snd_hda_intel snd_hda_codec snd_hwdep snd_pcm radeon snd_timer ttm snd drm_kms_helper soundcore drm snd_page_alloc i2c_algo_bit shpchp i2c_piix4 edac_core pcspkr k8temp evdev edac_m ce_amd pci_hotplug i2c_core button ext3 jbd mbcache dm_mod powernow_k8 aacraid 3w_9xxx 3w_xxxx raid10 raid456 async_raid6_recov async_pq raid6_pq async_xor xor async_memcpy async_tx raid1 raid0 md_mod sata_nv sata_sil sata_via sd_mod crc_t10dif ata_generic ahci pata_atiixp ohci_hcd libata r8169 mii thermal ehci_hcd processor thermal_sys scsi_mod usbcore nls_base [last unloaded: scsi_wait_scan] Mar 2 10:50:08 gaz kernel: [40250.390566] Pid: 11482, comm: munin-limits Not tainted 2.6.32-5-amd64 #1 MS-7368 Mar 2 10:50:08 gaz kernel: [40250.390576] RIP: 0010:[<00000000024b03f0>] [<00000000024b03f0>] 0x24b03f0 Mar 2 10:50:08 gaz kernel: [40250.390586] RSP: 0018:ffff88021cc8dec0 EFLAGS: 00010286 Mar 2 10:50:08 gaz kernel: [40250.390593] RAX: 000000001ddc1000 RBX: 0000000000000010 RCX: ffffffff810f9904 Mar 2 10:50:08 gaz kernel: [40250.390600] RDX: 0000000000000000 RSI: ffffea0007688200 RDI: 0000000000000286 Mar 2 10:50:08 gaz kernel: [40250.390608] RBP: 00000000ffffffea R08: 0000000000000025 R09: 7865542f30312e35 Mar 2 10:50:08 gaz kernel: [40250.390615] R10: 000000d01cc8ddf8 R11: 0000000000000246 R12: ffff88021cc8def8 Mar 2 10:50:08 gaz kernel: [40250.390622] R13: 0000000002295010 R14: 00000000022c9db0 R15: 0000000002488d78 Mar 2 10:50:08 gaz kernel: [40250.390630] FS: 00007f3b3c8b2700(0000) GS:ffff880008d00000(0000) knlGS:0000000000000000 Mar 2 10:50:08 gaz kernel: [40250.390641] CS: 0010 DS: 0000 ES: 0000 CR0: 0000000080050033 Mar 2 10:50:08 gaz kernel: [40250.390648] CR2: 00000000024b03f0 CR3: 000000021c5d1000 CR4: 00000000000006e0 Mar 2 10:50:08 gaz kernel: [40250.390656] DR0: 0000000000000000 DR1: 0000000000000000 DR2: 0000000000000000 Mar 2 10:50:08 gaz kernel: [40250.390663] DR3: 0000000000000000 DR6: 00000000ffff0ff0 DR7: 0000000000000400 Mar 2 10:50:08 gaz kernel: [40250.390671] Process munin-limits (pid: 11482, threadinfo ffff88021cc8c000, task ffff88021bf59530) Mar 2 10:50:08 gaz kernel: [40250.390681] Stack: Mar 2 10:50:08 gaz kernel: [40250.390687] ffffffff810f1d4a ffff880208c63228 0000000000000000 00007fffc2dcecc0 Mar 2 10:50:08 gaz kernel: [40250.390697] <0> 00000000024ba2b0 0000000002295010 ffffffff810f1e3d 0000000000000004 Mar 2 10:50:08 gaz kernel: [40250.390712] <0> ffff88021bf59530 ffff88021c4edc00 ffffffff812fe0b6 ffff88021c4edc60 Mar 2 10:50:08 gaz kernel: [40250.390732] Call Trace: Mar 2 10:50:08 gaz kernel: [40250.390742] [<ffffffff810f1d4a>] ? vfs_fstatat+0x2c/0x57 Mar 2 10:50:08 gaz kernel: [40250.390750] [<ffffffff810f1e3d>] ? sys_newstat+0x11/0x30 Mar 2 10:50:08 gaz kernel: [40250.390760] [<ffffffff812fe0b6>] ? do_page_fault+0x2e0/0x2fc Mar 2 10:50:08 gaz kernel: [40250.390768] [<ffffffff812fbf55>] ? page_fault+0x25/0x30 Mar 2 10:50:08 gaz kernel: [40250.390777] [<ffffffff81010b42>] ? system_call_fastpath+0x16/0x1b Mar 2 10:50:08 gaz kernel: [40250.390783] Code: Bad RIP value. Mar 2 10:50:08 gaz kernel: [40250.390791] RIP [<00000000024b03f0>] 0x24b03f0 Mar 2 10:50:08 gaz kernel: [40250.390799] RSP <ffff88021cc8dec0> Mar 2 10:50:08 gaz kernel: [40250.390805] CR2: 00000000024b03f0 Mar 2 10:50:08 gaz kernel: [40250.391051] ---[ end trace 1cc1473b539c7f6e ]--- Mar 2 11:42:20 gaz kernel: [43382.242301] php5-cgi[10963]: segfault at d81160 ip 0000000000d81160 sp 00007fff3adcb058 error 15 Mar 2 21:51:14 gaz kernel: [79916.418302] php5-cgi[20089]: segfault at 1c59dc8 ip 0000000001c59dc8 sp 00007fff9b877fb8 error 15 Mar 3 03:45:01 gaz kernel: [101143.334305] munin-update[22519] general protection ip:7f516dce204c sp:7fff6049a978 error:0 in libperl.so.5.10.1[7f516dc7d000+164000] Mar 3 11:22:37 gaz kernel: [128599.570307] php5-cgi[22888]: segfault at 36485a8 ip 00000000036485a8 sp 00007fff2d56e1c8 error 15 Mar 4 08:32:17 gaz kernel: [204779.842304] php5-cgi[22090]: segfault at 18 ip 0000000000689e5e sp 00007fff677a6a48 error 6 in php5-cgi[400000+6f9000] Mar 4 10:01:02 gaz kernel: [210104.434706] rsync[22236] general protection ip:7f14a07137f9 sp:7fff88f940b8 error:0 in libc-2.11.2.so[7f14a069d000+158000] Mar 4 11:32:22 gaz kernel: [215584.262316] BUG: unable to handle kernel paging request at 00000000ffffff9c Mar 4 11:32:22 gaz kernel: [215584.262331] IP: [<00000000ffffff9c>] 0xffffff9c Mar 4 11:32:22 gaz kernel: [215584.262343] PGD 0 Mar 4 11:32:22 gaz kernel: [215584.262350] Oops: 0010 [#2] SMP Mar 4 11:32:22 gaz kernel: [215584.262359] last sysfs file: /sys/devices/pci0000:00/0000:00:12.0/host4/target4:0:0/4:0:0:0/block/sdb/stat Mar 4 11:32:22 gaz kernel: [215584.262371] CPU 1 Mar 4 11:32:22 gaz kernel: [215584.262378] Modules linked in: cpufreq_userspace cpufreq_stats cpufreq_powersave cpufreq_conservative xt_recent xt_tcpudp iptable_nat nf_nat nf_conntrack_ipv4 nf_defrag_ipv4 ip6table_filter ip6_tables xt_DSCP xt_TCPMSS ipt_LOG ipt_REJECT iptable_mangle iptable_filter xt_multiport xt_state xt_limit xt_conntrack nf_conntrack_ftp nf_conntrack ip_tables x_tables loop snd_hda_codec_atihdmi snd_hda_intel snd_hda_codec snd_hwdep snd_pcm radeon snd_timer ttm snd drm_kms_helper soundcore drm snd_page_alloc i2c_algo_bit shpchp i2c_piix4 edac_core pcspkr k8temp evdev edac_mce_amd pci_hotplug i2c_core button ext3 jbd mbcache dm_mod powernow_k8 aacraid 3w_9xxx 3w_xxxx raid10 raid456 async_raid6_recov async_pq raid6_pq async_xor xor async_memcpy async_tx raid1 raid0 md_mod sata_nv sata_sil sata_via sd_mod crc_t10dif ata_generic ahci pata_atiixp ohci_hcd libata r8169 mii thermal ehci_hcd processor thermal_sys scsi_mod usbcore nls_base [last unloaded: scsi_wait_scan] Mar 4 11:32:22 gaz kernel: [215584.262552] Pid: 1960, comm: proxymap Tainted: G D 2.6.32-5-amd64 #1 MS-7368 Mar 4 11:32:22 gaz kernel: [215584.262563] RIP: 0010:[<00000000ffffff9c>] [<00000000ffffff9c>] 0xffffff9c Mar 4 11:32:22 gaz kernel: [215584.262573] RSP: 0018:ffff880209257e00 EFLAGS: 00010212 Mar 4 11:32:22 gaz kernel: [215584.262580] RAX: ffff8801514eb780 RBX: ffffffff810efb2d RCX: 0000000000000000 Mar 4 11:32:22 gaz kernel: [215584.262590] RDX: 0000000000000020 RSI: 0000000000000001 RDI: ffff8801514eb780 Mar 4 11:32:22 gaz kernel: [215584.262600] RBP: 00000000ffffffe9 R08: 0000000000000000 R09: 0000000000000000 Mar 4 11:32:22 gaz kernel: [215584.262611] R10: ffff880209257e78 R11: ffffffff81152c7c R12: 0000000000000001 Mar 4 11:32:22 gaz kernel: [215584.262622] R13: 0000000000008001 R14: 0000000000000024 R15: 00000000ffffff9c Mar 4 11:32:22 gaz kernel: [215584.262633] FS: 00007fca4de35700(0000) GS:ffff880008d00000(0000) knlGS:0000000000000000 Mar 4 11:32:22 gaz kernel: [215584.262644] CS: 0010 DS: 0000 ES: 0000 CR0: 0000000080050033 Mar 4 11:32:22 gaz kernel: [215584.262650] CR2: 00000000ffffff9c CR3: 00000001c9cbb000 CR4: 00000000000006e0 Mar 4 11:32:22 gaz kernel: [215584.262661] DR0: 0000000000000000 DR1: 0000000000000000 DR2: 0000000000000000 Mar 4 11:32:22 gaz kernel: [215584.262671] DR3: 0000000000000000 DR6: 00000000ffff0ff0 DR7: 0000000000000400 Mar 4 11:32:22 gaz kernel: [215584.262682] Process proxymap (pid: 1960, threadinfo ffff880209256000, task ffff88021c4b1c40) Mar 4 11:32:22 gaz kernel: [215584.262693] Stack: Mar 4 11:32:22 gaz kernel: [215584.262698] ffffffff810f8566 ffff880209257e78 ffff88021c7bf000 ffff88021c7bf0c8 Mar 4 11:32:22 gaz kernel: [215584.262709] <0> 0000800000000000 ffff88021fc0f000 ffff880209257e78 00000000fffffffe Mar 4 11:32:22 gaz kernel: [215584.262724] <0> ffffffff810e5881 ffff880209257f48 0000000000000286 ffff88021fc0f000 Mar 4 11:32:22 gaz kernel: [215584.262743] Call Trace: Mar 4 11:32:22 gaz kernel: [215584.262753] [<ffffffff810f8566>] ? do_filp_open+0xa7/0x94b Mar 4 11:32:22 gaz kernel: [215584.262763] [<ffffffff810e5881>] ? virt_to_head_page+0x9/0x2a Mar 4 11:32:22 gaz kernel: [215584.262771] [<ffffffff810f9904>] ? user_path_at+0x52/0x79 Mar 4 11:32:22 gaz kernel: [215584.262779] [<ffffffff810cfec1>] ? get_unmapped_area+0xd7/0x139 Mar 4 11:32:22 gaz kernel: [215584.262787] [<ffffffff811019d5>] ? alloc_fd+0x67/0x10c Mar 4 11:32:22 gaz kernel: [215584.262795] [<ffffffff810eceaf>] ? do_sys_open+0x55/0xfc Mar 4 11:32:22 gaz kernel: [215584.262804] [<ffffffff81010b42>] ? system_call_fastpath+0x16/0x1b Mar 4 11:32:22 gaz kernel: [215584.262811] Code: Bad RIP value. Mar 4 11:32:22 gaz kernel: [215584.262819] RIP [<00000000ffffff9c>] 0xffffff9c Mar 4 11:32:22 gaz kernel: [215584.262828] RSP <ffff880209257e00> Mar 4 11:32:22 gaz kernel: [215584.262833] CR2: 00000000ffffff9c Mar 4 11:32:22 gaz kernel: [215584.263077] ---[ end trace 1cc1473b539c7f6f ]--- As you can see there are segfaults, a general protection fault and a Kernel Oops. My first guess was that there's a Hardware problem of some sort and I asked my Hoster (it's a rented root server) to do a full hardwarecheck - they did, but couldn't find any problem. I don't know what and how they checked but their support team is usually quite good. I ran memtester and cpuburn myself and couldn't find any error either. Unfortunately I have no reliable way to reproduce these segfaults, they seem to be more or less random. On a hunch I disabled the firewall of the system and ran one of the programs that segfaulted regularily (imapsync) and it seemed to take longer to segfault than before, so the problem might be related to the network stack. Or could just be a random thing. Here are the kernel specs: # uname -a Linux gaz 2.6.32-5-amd64 #1 SMP Wed Jan 12 03:40:32 UTC 2011 x86_64 GNU/Linux # cat /etc/debian_version 6.0 # lsmod Module Size Used by cpufreq_userspace 1992 0 cpufreq_stats 2659 0 cpufreq_powersave 902 0 cpufreq_conservative 5162 0 xt_recent 5977 0 xt_tcpudp 2319 0 iptable_nat 4299 0 nf_nat 13388 1 iptable_nat nf_conntrack_ipv4 9833 3 iptable_nat,nf_nat nf_defrag_ipv4 1139 1 nf_conntrack_ipv4 ip6table_filter 2384 0 ip6_tables 15075 1 ip6table_filter xt_DSCP 1995 0 xt_TCPMSS 2919 0 ipt_LOG 4518 0 ipt_REJECT 1953 0 iptable_mangle 2817 0 iptable_filter 2258 0 xt_multiport 2267 0 xt_state 1303 0 xt_limit 1782 0 xt_conntrack 2407 0 nf_conntrack_ftp 5537 0 nf_conntrack 46535 6 iptable_nat,nf_nat,nf_conntrack_ipv4,xt_state,xt_conntrack,nf_conntrack_ftp ip_tables 13899 3 iptable_nat,iptable_mangle,iptable_filter x_tables 12845 13 xt_recent,xt_tcpudp,iptable_nat,ip6_tables,xt_DSCP,xt_TCPMSS,ipt_LOG,ipt_REJECT,xt_multiport,xt_state,xt_limit,xt_conntrack,ip_tables loop 11799 0 radeon 573996 0 ttm 39986 1 radeon drm_kms_helper 20065 1 radeon snd_hda_codec_atihdmi 2251 1 drm 142359 3 radeon,ttm,drm_kms_helper snd_hda_intel 20019 0 i2c_algo_bit 4225 1 radeon pcspkr 1699 0 i2c_piix4 8328 0 snd_hda_codec 54244 2 snd_hda_codec_atihdmi,snd_hda_intel i2c_core 15712 5 radeon,drm_kms_helper,drm,i2c_algo_bit,i2c_piix4 snd_hwdep 5380 1 snd_hda_codec snd_pcm 60503 2 snd_hda_intel,snd_hda_codec snd_timer 15582 1 snd_pcm snd 46446 5 snd_hda_intel,snd_hda_codec,snd_hwdep,snd_pcm,snd_timer soundcore 4598 1 snd evdev 7352 3 snd_page_alloc 6249 2 snd_hda_intel,snd_pcm k8temp 3283 0 edac_core 29261 0 edac_mce_amd 6433 0 shpchp 26264 0 pci_hotplug 21203 1 shpchp button 4650 0 ext3 106518 2 jbd 37085 1 ext3 mbcache 5050 1 ext3 dm_mod 53754 0 powernow_k8 10978 1 aacraid 59779 0 3w_9xxx 28684 0 3w_xxxx 20569 0 raid10 17809 0 raid456 44500 0 async_raid6_recov 5170 1 raid456 async_pq 3479 2 raid456,async_raid6_recov raid6_pq 77179 2 async_raid6_recov,async_pq async_xor 2478 3 raid456,async_raid6_recov,async_pq xor 4380 1 async_xor async_memcpy 1198 2 raid456,async_raid6_recov async_tx 1734 5 raid456,async_raid6_recov,async_pq,async_xor,async_memcpy raid1 18431 3 raid0 5517 0 md_mod 73824 7 raid10,raid456,raid1,raid0 sata_nv 19166 0 sata_sil 7412 0 sata_via 7928 0 sd_mod 29889 8 crc_t10dif 1276 1 sd_mod ata_generic 3047 0 ahci 32374 6 r8169 29229 0 mii 3210 1 r8169 thermal 11674 0 pata_atiixp 3489 0 libata 133632 6 sata_nv,sata_sil,sata_via,ata_generic,ahci,pata_atiixp ohci_hcd 19212 0 ehci_hcd 31151 0 processor 29935 1 powernow_k8 thermal_sys 11942 2 thermal,processor scsi_mod 122149 5 aacraid,3w_9xxx,3w_xxxx,sd_mod,libata usbcore 122034 3 ohci_hcd,ehci_hcd nls_base 6377 1 usbcore # free total used free shared buffers cached Mem: 8166128 1228036 6938092 0 140412 782060 -/+ buffers/cache: 305564 7860564 Swap: 2102456 0 2102456 So, basically my questions are: How can I diagnose this further? Is there any data in the log above that could help me to isolate the troublemaker? Are there any known problems with the above hardware/software I overlooked when googling for it? Is there a way to prevent the kernel from autoloading modules (I probably don't need all these modules and one of them might be the culprit)

  Read the article

• I get a 502 bad gateway ONLY with a specific combination of domain/root folders - NGINX

  - by Patrick De Amorim

  I have a VPS running NGINX and virtual hosts, with a configuration such as this: Domains directing to it: lolpics.no smscloud.no idmag.no Root folders: /home/vds/www/lolpics /home/vds/www/smscloud /home/vds/www/idmag SMSCloud.no is the site that keeps getting 502 errors, but if I make the domain direct to any of the other folders, the site works, or if I make any other domain name direct to the /home/vds/www/smscloud folder, it works. Only smscloud.no with /home/vds/www/smscloud breaks I tried putting this between the http{} in my nginx.conf and no help: proxy_buffer_size 128k; proxy_buffers 4 256k; proxy_busy_buffers_size 256k; EDIT: Well, that was slightly silly, if anyone from Google stumbles on this, here's how I fixed it, I just added this to the http{}: fastcgi_buffer_size 16k; fastcgi_buffers 16 16k; So that the start of my http block is: http { include /etc/nginx/mime.types; proxy_buffer_size 128k; proxy_buffers 4 256k; proxy_busy_buffers_size 256k; fastcgi_buffer_size 16k; fastcgi_buffers 16 16k;

  Read the article

• How to get the permissions right for /dev/raw1394

  - by Mark0978

  I recently upgraded one of my ubuntu machines to Karmic and I'm having trouble getting the permissions of /dev/raw1394 set to 0666. They only thing this machine is used for is recording audio from a firepod which uses /dev/raw1394 via jackd and there are no other FireWire devices connected, so security around this device is not really an issue. If I run as root, everything works as expected, but I have some folks that run the recorder that I don't want to have root access. However, I can't figure out which lines setup the perms I've tied this: /etc/udev/permissions.d/raw1394.rules:raw1394:root:root:0666 And I have this setup (default install) /lib/udev/rules.d/75-persistent-net-generator.rules:SUBSYSTEMS=="ieee1394", ENV{COMMENT}="Firewire device $attr{host_id})" /lib/udev/rules.d/75-cd-aliases-generator.rules:# the "path" of usb/ieee1394 devices changes frequently, use "id" /lib/udev/rules.d/75-cd-aliases-generator.rules:ACTION=="add", SUBSYSTEM=="block", SUBSYSTEMS=="usb|ieee1394", ENV{ID_CDROM}=="?*", ENV{GENERATED}!="?*", \ /lib/udev/rules.d/60-persistent-storage-tape.rules:KERNEL=="st*[0-9]|nst*[0-9]", ATTRS{ieee1394_id}=="?*", ENV{ID_SERIAL}="$attr{ieee1394_id}", ENV{ID_BUS}="ieee1394" /lib/udev/rules.d/50-udev-default.rules:# FireWire (deprecated dv1394 and video1394 drivers) /lib/udev/rules.d/50-udev-default.rules:KERNEL=="dv1394-[0-9]*", NAME="dv1394/%n", GROUP="video" /lib/udev/rules.d/50-udev-default.rules:KERNEL=="video1394-[0-9]*", NAME="video1394/%n", GROUP="video" /lib/udev/rules.d/60-persistent-storage.rules:KERNEL=="sd*[!0-9]|sr*", ATTRS{ieee1394_id}=="?*", SYMLINK+="disk/by-id/ieee1394-$attr{ieee1394_id}" /lib/udev/rules.d/60-persistent-storage.rules:KERNEL=="sd*[0-9]", ATTRS{ieee1394_id}=="?*", SYMLINK+="disk/by-id/ieee1394-$attr{ieee1394_id}-part%n" And I find these lines in /var/log/syslog Apr 30 09:11:30 record kernel: [ 3.284010] ieee1394: Node added: ID:BUS[0-00:1023] GUID[000a9200c7062266] Apr 30 09:11:30 record kernel: [ 3.284195] ieee1394: Host added: ID:BUS[0-01:1023] GUID[00d0035600a97b9f] Apr 30 09:11:30 record kernel: [ 18.372791] ieee1394: raw1394: /dev/raw1394 device initialized What I can't figure out, is which line actually creates that raw1394 device in the first place. How do you get /dev/raw1394 to have permissions 0666?

  Read the article

• Solaris 10 invalid ARP requests from 0.0.0.0?

  - by JWD

  The guys at the data center where I'm hosting a server running Solaris 10 are telling me that my server is making a lot of invalid arp requests. This is an example of a portion of what was sent to me from the logs (with Mac addresses and IP addresses changed). xxxx:xxxx:xxxx/0.0.0.0/0000.0000.0000/[myipaddress]/[Datestamp]) I don't see anything in the arp tables (arp -a) or routing tables (netstat -r) and I don't see anything relating to 0.0.0.0 when snoping the arp requests. The only place I see any reference to 0.0.0.0 is if I do netstat -a for the SCTP SCTP: Local Address Remote Address Swind Send-Q Rwind Recv-Q StrsI/O State ------------------------------- ------------------------------- ------ ------ ------ ------ ------- ----------- 0.0.0.0 0.0.0.0 0 0 102400 0 32/32 CLOSED But not really sure what that means. Doesn't seem like I can disable SCTP. Does anyone have any idea what might be causing this and how to stop it? I think the switch I'm connected to doesn't like it and momentarily drops the connection. Is there anyway to at least block those requests using ipfilter or something else?

  Read the article

• When using procmail with maildir, it returns error with code I found

  - by bradlis7

  I'm not an expert at procmail, but I have this code: DROPPRIVS=yes DEFAULT=$HOME/Maildir/ :0 * ? /usr/bin/test -d $DEFAULT || /bin/mkdir $DEFAULT { } :0 E { # Bail out if directory could not be created EXITCODE=127 HOST=bail.out } MAILDIR=$HOME/Maildir/ But, when the directory already exists, sometimes it will send a return email with this error: 554 5.3.0 unknown mailer error 127. The email still gets delivered, mind you, but it sends back an error code. I fixed this temporarily by commenting out the EXITCODE and HOST lines, but I'd like to know if there is a better solution. I found this block of code in multiple places across the net, but couldn't really find why this error was coming back to me. It seems to happen when I send an email to a local user, sometimes the user has a .forward file to send it on to other users, sometimes not, but the result has been the same. I also tried removing DROPPRIVS, just in case it was messing up the forwarding, but it did not seem to affect it. Is the line starting with * ? /usr/bin/test a problem? The * signifies a regex, but the ? makes it return an integer value, correct? What is the integer being matched against? Or is it just comparing the integer return value? Thanks for the help.

  Read the article

• Time drift in Cloud Server - need to mainpulate GRUB config

  - by Aditya Advani

  We are hosting a VPS on a popular host and are experiencing a regular time drift of several minutes a day forward (approx 7). Linux Kernel: 2.6.18-164.11.1.el5 GNU/Linux Distro: CentOS release 5.4 (Final) We reached out to our hosting provider and their support advised us " This is a known issue with Cloud Servers. To fix this you will need to add one line to your grub config located at: /boot/grub/menu.lst The line you need to add is: noapic nolapic divider=10 nolapic_timer This should correct this issue. You will need to restart after this is added in. " Because I am wary of manipulating grub, mostly I'm terrified that our server may fail to restart - I ask you guys, the pro *nix admins - where exactly in this file does the recommended insertion below: # line from 1&1 for time syncing issue (Case 5163) noapic nolapic divider=10 nolapic_timer go? Please specify where exactly, and whether the order of commands is or is not important. Why is the block below "title CentOS ..." indented? If someone could give me an overview of how this works or point me to a resource that's easy to follow, that's what I'm looking for immediately, a light overview or basic understanding of what I;m doing. If GRUB and bootloaders are a deep dark treasure trove of kernel hacking or something, that's great well-recommended in-depth resources are also very welcome. This is my current /boot/grub/menu.lst # grub.conf generated by anaconda # # Note that you do not have to rerun grub after making changes to this file #boot=/dev/sda # serial --unit=0 --speed=57600 terminal --timeout=5 serial console timeout=5 title CentOS (2.6.18-164.11.1.el5) root (hd0,0) kernel /boot/vmlinuz-2.6.18-164.11.1.el5 ro root=/dev/hda1 console=tty0 console=tty initrd /boot/initrd-2.6.18-164.11.1.el5.img MOST IMPORTANT: I need to know where in the file above it is appropriate to paste the suggested line so I can confidently restart my VPS after manipulating GRUB config

  Read the article

• Adding Static IP's to the NIC

  - by Brett Powell

  We are currently working on migrating a lot of new machines to our network, and my job this morning was to setup all of the IP Addresses. I worked on this all morning, and when I got back tonight I was informed that they had all been setup incorrectly, and had to be removed and re-added. I am quite confused as I have been setting up IP's on machines for a long time and I am curious as to what the issue is. Just taking into account this example... 72.26.196.160/29 255.255.255.248 A /29 block is 5 usable IP's. With the script I wrote and used, the IP Addresses .162 - .166 were added to the NIC. I can't remember now what the name for .161 was, but isn't it the broadcast address or something which isn't assigned to the NIC when adding additional IP Blocks? I am curious as to where my logic is failing me. Not to mention even if .161 was to be added, there is no reason why all of the IPs would have to be removed, as .161 could just be added in addition to these.

  Read the article

• MS SQL Server slows down over time?

  - by Dave Holland

  Have any of you experienced the following, and have you found a solution: A large part of our website's back-end is MS SQL Server 2005. Every week or two weeks the site begins running slower - and I see queries taking longer and longer to complete in SQL. I have a query that I like to use: USE master select text,wait_time,blocking_session_id AS "Block", percent_complete, * from sys.dm_exec_requests CROSS APPLY sys.dm_exec_sql_text(sql_handle) AS s2 order by start_time asc Which is fairly useful... it gives a snapshot of everything that's running right at that moment against your SQL server. What's nice is that even if your CPU is pegged at 100% for some reason and Activity Monitor is refusing to load (I'm sure some of you have been there) this query still returns and you can see what query is killing your DB. When I run this, or Activity Monitor during the times that SQL has begun to slow down I don't see any specific queries causing the issue - they are ALL running slower across the board. If I restart the MS SQL Service then everything is fine, it speeds right up - for a week or two until it happens again. Nothing that I can think of has changed, but this just started a few months ago... Ideas? --Added Please note that when this database slowdown happens it doesn't matter if we are getting 100K page views an hour (busier time of day) or 10K page views an hour (slow time) the queries all take a longer time to complete than normal. The server isn't really under stress - the CPU isn't high, the disk usage doesn't seem to be out of control... it feels like index fragmentation or something of the sort but that doesn't seem to be the case. As far as pasting results of the query I pasted above I really can't do that. The Query above lists the login of the user performing the task, the entire query, etc etc.. and I'd really not like to hand out the names of my databases, tables, columns and the logins online :)... I can tell you that the queries running at that time are normal, standard queries for our site that run all the time, nothing out of the norm.

  Read the article

• iSCSI, failover and XenServer

  - by jemmille

  I have an iSCSI fail over implementation setup so if one of my storage units fails the other takes over immediately (it also runs the NFS shares). When fail over occurs, volumes are exported, the IP is switched to the other machine and the targets are reconfigured. The fail over of the storage system itself works just fine. I use NexentaStor for my filer. When I do a test (manual) fail over of my storage the following occurs: Note: I run the admin VM's on NFS and customer based VM's on iSCSI All NFS based VM's remain up and working perfectly through the failover and after All VM 's running on iSCSI eventually report the following: An error about not being able to write to a particular block An error about journaling not working Then the file system goes RO To get the VM's working again I have to do the following: Force shutdown of the "broken" VM's. Detach the iSCSI SR Re-attach the iSCSI SR Boot the VM on a different server (5 in my pool) If I don't boot on a different server I get this error "Internal error: Failure("The VDI <uuid&gt; is already attached in RW mode; it can't be attached in RO mode!")" The only way I have found to fix that error is to reboot the entire server it was running on previously which is obviously a huge pain. Currently multipathing is NOT enabled (but can be and the same thing still occurs). I have edited much of the /etc/iscsid.conf file to work with the timeout settings but to no avail. In short, my storage fails over properly but XenServer does not keep the connection alive. As a thought, the error that shows up in #4 above might be the ultimate cause and fixing that would fix everything? Any help would be appreciated more than you know.

  Read the article

• Find Search Replace from landmark to landmark - including everything in between

  - by Erick Tronboll

  Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

  Read the article

• Identifying mail account used in CRAM-MD5 transaction

  - by ManiacZX

  I suppose this is one of those where the tool for identifying the problem is also the tool used for taking advantage of it. I have a mail server that I am seeing emails that spam is being sent through it. It is not an open relay, the messages in question are being sent by someone authenticating to the smtp with CRAM-MD5. However, the logs only capture the actual data passed, which has been hashed so I cannot see what user account is being used. My suspicion is a simple username/password combo or a user account's password has otherwise been compromised, but I cannot do much about it without knowing what user it is. Of course I can block the IP that is doing it, but that doesn't fix the real problem. I have both the CRAM-MD5 Base64 challenge string and the hashed client auth string containing the username, password and challenge string. I am looking for a way to either reverse this (which I haven't been able to find any information on) or otherwise I suppose I need a dictionary attack tool designed for CRAM-MD5 to run through two lists, one for username and one for password and the constant of the challenge string until it finds a matching result of the authentication string I have logged. Any information on reversing using the data I have logged, a tool to identify it or any alternative methods you have used for this situation would be greatly appreciated.

  Read the article

< Previous Page | 215 216 217 218 219 220 221 222 223 224 225 226  | Next Page >