Search Results

Search found 3646 results on 146 pages for 'escape sequence'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 22/146 | < Previous Page | 18 19 20 21 22 23 24 25 26 27 28 29  | Next Page >

  • Can i execute the events in sequence in jquery

    - by Mirage
    I am using accordians. I want that if someone click on hyperlink inside the accordion , then that accordion should slide up slowly and only after that the nect accordion falls down or open $(".accord").live('click', function(){ $('#rr1').next().slideUp('slow'); $('#rr3').next().slideDown('slow'); But i have seen that the other accordion starts opening up at the same time when the other is closing. It it something related to asynchronous thing. I don't know });

    Read the article

  • Translate sequence in macro parameters to separate macros

    - by Alex Tiger
    How to acces each element in macro if the definition is like MACRO(name, seq) and the code is like: MACRO("TheName", (Elem1) (Elem2) (Elem3) ) I want to generate the next code: MACRO("TheName", ELEMMACRO(Elem1) ELEMMACRO(Elem2) ELEMMACRO(Elem3) ) Or something like that. In other words, I want to process every parameter separately (I don't care of definition, even if it will be something like MACRO("TheName", Elem1, Elem2, Elem3 ) There could be more elements, there could be less. I have tried V_ARGS (I need it only for gcc), but I can only copy all the elements by that, not to process them separately. What can I do? P.S. Because of some reasons, I can't use Boost.

    Read the article

  • jQuery sequence

    - by Happy
    $(".item").each(function(){ var item_link = $(this).find("a").attr("href"); $(this).prepend('<div class="img_url"></div>'); var img_url = $('div.img_url', this); $.get(item_link, function(data) { var src = $('.poster img', data).attr('src'); img_url.html(src); }); }); Each .get should be started after the previous is finished. Now all the .get start in one time. Any idea?

    Read the article

  • Python: Determine whether list of lists contains a defined sequence

    - by duhaime
    I have a list of sublists, and I want to see if any of the integer values from the first sublist plus one are contained in the second sublist. For all such values, I want to see if that value plus one is contained in the third sublist, and so on, proceeding in this fashion across all sublists. If there is a way of proceeding in this fashion from the first sublist to the last sublist, I wish to return True; otherwise I wish to return False. In other words, for each value in sublist one, for each "step" in a "walk" across all sublists read left to right, if that value + n (where n = number of steps taken) is contained in the current sublist, the function should return True; otherwise it should return False. (Sorry for the clumsy phrasing--I'm not sure how to clean up my language without using many more words.) Here's what I wrote. a = [ [1,3],[2,4],[3,5],[6],[7] ] def find_list_traversing_walk(l): for i in l[0]: index_position = 0 first_pass = 1 walking_current_path = 1 while walking_current_path == 1: if first_pass == 1: first_pass = 0 walking_value = i if walking_value+1 in l[index_position + 1]: index_position += 1 walking_value += 1 if index_position+1 == len(l): print "There is a walk across the sublists for initial value ", walking_value - index_position return True else: walking_current_path = 0 return False print find_list_traversing_walk(a) My question is: Have I overlooked something simple here, or will this function return True for all true positives and False for all true negatives? Are there easier ways to accomplish the intended task? I would be grateful for any feedback others can offer!

    Read the article

  • How can I Unescape and Reescape strings in .net?

    - by firoso
    So here's my situation. I am working on an editor for a communications channel that works over an RS232 serial ASCII terminal. Let's not go into detail for that ;-) To simplify, I need a textbox on a WPF control that can take in text like "Commit\r\n" (which is the .net string "Commit\r\n") and convert it back to "Commit\r\n" as a .net string. I was hoping for a string.Unescape() and string.Escape() method pair, but it doesn't seem to exist. Am I going to have to write my own? or is there a more simple way to do this?

    Read the article

  • Writing to a new line of a file in Objective-C

    - by Kulpreet
    For some strange reason, the \n and \r escape sequences do not seem to be working in my code. I want to write each NSString on a new line of the file, but it just appends it the last string on one line. Here's the code: for (Entry *entry in self.entries) { NSString *path = @"/Users/me/File.txt"; NSString *string = (@"%@\r\n", [entry thisEntry]); NSFileHandle *fh = [NSFileHandle fileHandleForWritingAtPath:path]; [fh seekToEndOfFile]; [fh writeData:[string dataUsingEncoding:NSUnicodeStringEncoding]]; [fh closeFile]; } Am I doing something wrong? Forgive me as I am new to Objective-C.

    Read the article

  • Ruby on Rails: How to sanitize a string for SQL when not using find?

    - by williamjones
    I'm trying to sanitize a string that involves user input without having to resort to manually crafting my own possibly buggy regex if possible, however, if that is the only way I would also appreciate if anyone can point me in the right direction to a regex that is unlikely to be missing anything. There are a number of methods in Rails that can allow you to enter in native SQL commands, how do people escape user input for those? The question I'm asking is a broad one, but in my particular case, I'm working with a column in my Postgres database that Rails does not natively understand as far as I know, the tsvector, which holds plain text search information. Rails is able to write and read from it as if it's a string, however, unlike a string, it doesn't seem to be automatically escaping it when I do things like vector= inside the model. For example, when I do model.name='::', where name is a string, it works fine. When I do model.vector='::' it errors out: ActiveRecord::StatementInvalid: PGError: ERROR: syntax error in tsvector: "::" "vectors" = E'::' WHERE "id" = 1 This seems to be a problem caused by lack of escaping of the semicolons, and I can manually set the vector='\:\:' fine. I also had the bright idea, maybe I can just call something like: ActiveRecord::Base.connection.execute "UPDATE medias SET vectors = ? WHERE id = 1", "::" However, this syntax doesn't work, because the raw SQL commands don't have access to find's method of escaping and inputting strings by using the ? mark. This strikes me as the same problem as calling connection.execute with any type of user input, as it all boils down to sanitizing the strings, but I can't seem to find any way to manually call Rails' SQL string sanitization methods. Can anyone provide any advice?

    Read the article

  • Ruby on Rails: How to sanitize a string for SQL when not using find and other built-in methods?

    - by williamjones
    I'm trying to sanitize a string that involves user input without having to resort to manually crafting my own possibly buggy regex if possible. There are a number of methods in Rails that can allow you to enter in native SQL commands, how do people escape user input for those? The question I'm asking is a broad one, but in my particular case, I'm working with a column in my Postgres database that Rails does not natively understand as far as I know, the tsvector, which holds plain text search information. Rails is able to write and read from it as if it's a string, however, unlike a string, it doesn't seem to be automatically escaping it when I do things like vector= inside the model. For example, when I do model.name='::', where name is a string, it works fine. When I do model.vector='::' it errors out: ActiveRecord::StatementInvalid: PGError: ERROR: syntax error in tsvector: "::" "vectors" = E'::' WHERE "id" = 1 This seems to be a problem caused by lack of escaping of the semicolons, and I can manually set the vector='\:\:' fine. I also had the bright idea, maybe I can just call something like: ActiveRecord::Base.connection.execute "UPDATE medias SET vectors = ? WHERE id = 1", "::" However, this syntax doesn't work, because the raw SQL commands don't have access to find's method of escaping and inputting strings by using the ? mark. This strikes me as the same problem as calling connection.execute with any type of user input, as it all boils down to sanitizing the strings, but I can't seem to find any way to manually call Rails' SQL string sanitization methods. Can anyone provide any advice?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Replacing unversioned files in WiX major upgrade.

    - by Joshua
    I am still having this problem. This is the closest I have come to a solution that works, and yet it doesn't quite work. Here is (most of) the code: <Product Id='$(var.ProductCode)' UpgradeCode='$(var.UpgradeCode)' Name="Pathways" Version='$(var.ProductVersion)' Manufacturer='$(var.Manufacturer)' Language='1033'> Maximum="$(var.ProductVersion)" IncludeMaximum="no" Language="1033" Property="OLDAPPFOUND" / -- -- -- There is a later version of this program installed. The problem I am having is that I need the two files in the Database component to replace the previous copies. Since these files are unversioned, I have attempted to use the CompanionFile tag set to the PathwaysExe since that is the main executable of the application, and it IS being updated, even if the log says it isn't! The strangest thing about this is that the PathwaysLdf file IS BEING UPDATED CORRECTLY, and the PathwaysMdf file IS NOT. The log seems to indicate that the "Existing file is of an equal version (Checked using version of companion)". This is very strange because that file is being replaced just fine. The only idea I have left is that this problem has to do with the install sequence, and I'm not sure how to proceed! I have the InstallExecuteSequence set like I do because of the SettingsXml file, and my need to NOT overwrite that file, which is actually working now, so whatever solution works for the database files can't break the working settings file! ;) The full log is located at: http://pastebin.com/HFiGKuKN PLEASE AND THANK YOU!

    Read the article

  • rake test not copying development postgres db with sequences

    - by Robert Crida
    I am trying to develop a rails application on postgresql using a sequence to increment a field instead of a default ruby approach based on validates_uniqueness_of. This has proved challenging for a number of reasons: 1. This is a migration of an existing table, not a new table or column 2. Using parameter :default = "nextval('seq')" didn't work because it tries to set it in parenthesis 3. Eventually got migration working in 2 steps: change_column :work_commencement_orders, :wco_number_suffix, :integer, :null => false#, :options => "set default nextval('wco_number_suffix_seq')" execute %{ ALTER TABLE work_commencement_orders ALTER COLUMN wco_number_suffix SET DEFAULT nextval('wco_number_suffix_seq'); } Now this would appear to have done the correct thing in the development database and the schema looks like: wco_number_suffix | integer | not null default nextval('wco_number_suffix_seq'::regclass) However, the tests are failing with PGError: ERROR: null value in column "wco_number_suffix" violates not-null constraint : INSERT INTO "work_commencement_orders" ("expense_account_id", "created_at", "process_id", "vo2_issued_on", "wco_template", "updated_at", "notes", "process_type", "vo_number", "vo_issued_on", "vo2_number", "wco_type_id", "created_by", "contractor_id", "old_wco_type", "master_wco_number", "deadline", "updated_by", "detail", "elective_id", "authorization_batch_id", "delivery_lat", "delivery_long", "operational", "state", "issued_on", "delivery_detail") VALUES(226, '2010-05-31 07:02:16.764215', 728, NULL, E'Default', '2010-05-31 07:02:16.764215', NULL, E'Procurement::Process', NULL, NULL, NULL, 226, NULL, 276, NULL, E'MWCO-213', '2010-06-14 07:02:16.756952', NULL, E'Name 4597', 220, NULL, NULL, NULL, 'f', E'pending', NULL, E'728 Test Road; Test Town; 1234; Test Land') RETURNING "id" The explanation can be found when you inspect the schema of the test database: wco_number_suffix | integer | not null So what happened to the default? I tried adding task: template: smmt_ops_development to the database.yml file which has the effect of issuing create database smmt_ops_test template = "smmt_ops_development" encoding = 'utf8' I have verified that if I issue this then it does in fact copy the default nextval. So clearly rails is doing something after that to suppress it again. Any suggestions as to how to fix this? Thanks Robert

    Read the article

  • Best suited tool to document message processing done in C written program

    - by user3494614
    I am relatively new to UML and it's seems to be very vast I have a small program which basically receives messages on socket and then depending upon message ID embedded as first byte of message it processes the buffer. There are around 5 different message ID which it processes and communicates on another socket and has around 8 major functions. So program in short is like this. I am not pasting entire .c file or main function but just giving some bits and pieces of it so that to get idea of program flow. int main(int argc, char** argv) { register_shared_mem(); listen(); while(get_next_message(buffer)) { switch((msg)(buffer)->id) { case TYPE1: process1(); answer(); ..... } } } I want to document this is pictorial way like for Message type 1 it calls this function which calls another and which calls another. Please let me know any open source tool which will allow me to quickly draw such kind of UML or sequence diagram and will also allow me to write brief description of what each function does? Thanks In Advance

    Read the article

  • Delphi / MySql : Problems escaping strings

    - by mawg
    N00b here, having problems escaping strings. I used the QuotedStr() function - shouldn't that be enough. Unfortunately, the string that I am trying to quote is rather messy, but I will post it here in case anyone wants to paste it into WinMerge or KDiff3, etc. I am trying to store an entire Delphi form into the database, rather than into a .DFM file. It has only one field, a TEdit edit box. The debugger shows the form as text as 'object Form1: TScriptForm'#$D#$A' Left = 0'#$D#$A' Top = 0'#$D#$A' Align = alClient'#$D#$A' BorderStyle = bsNone'#$D#$A' ClientHeight = 517'#$D#$A' ClientWidth = 993'#$D#$A' Color = clBtnFace'#$D#$A' Font.Charset = DEFAULT_CHARSET'#$D#$A' Font.Color = clWindowText'#$D#$A' Font.Height = -11'#$D#$A' Font.Name = 'MS Sans Serif''#$D#$A' Font.Style = []'#$D#$A' OldCreateOrder = False'#$D#$A' SaveProps.Strings = ('#$D#$A' 'Visible=False')'#$D#$A' PixelsPerInch = 96'#$D#$A' TextHeight = 13'#$D#$A' object Edit1: TEdit'#$D#$A' Left = 192'#$D#$A' Top = 64'#$D#$A' Width = 121'#$D#$A' Height = 21'#$D#$A' TabOrder = 8'#$D#$A' end'#$D#$A'end'#$D#$A before calling QuotedStr() and ''object Form1: TScriptForm'#$D#$A' Left = 0'#$D#$A' Top = 0'#$D#$A' Align = alClient'#$D#$A' BorderStyle = bsNone'#$D#$A' ClientHeight = 517'#$D#$A' ClientWidth = 993'#$D#$A' Color = clBtnFace'#$D#$A' Font.Charset = DEFAULT_CHARSET'#$D#$A' Font.Color = clWindowText'#$D#$A' Font.Height = -11'#$D#$A' Font.Name = ''MS Sans Serif'''#$D#$A' Font.Style = []'#$D#$A' OldCreateOrder = False'#$D#$A' SaveProps.Strings = ('#$D#$A' ''Visible=False'')'#$D#$A' PixelsPerInch = 96'#$D#$A' TextHeight = 13'#$D#$A' object Edit1: TEdit'#$D#$A' Left = 192'#$D#$A' Top = 64'#$D#$A' Width = 121'#$D#$A' Height = 21'#$D#$A' TabOrder = 8'#$D#$A' end'#$D#$A'end'#$D#$A''' afterwards. The strange thing is that my complete command 'INSERT INTO designerFormDfm(designerFormDfmText) VALUES ("'object Form1: TScriptForm'#$D#$A' Left = 0'#$D#$A' Top = 0'#$D#$A' Align = alClient'#$D#$A' BorderStyle = bsNone'#$D#$A' ClientHeight = 517'#$D#$A' ClientWidth = 993'#$D#$A' Color = clBtnFace'#$D#$A' Font.Charset = DEFAULT_CHARSET'#$D#$A' Font.Color = clWindowText'#$D#$A' Font.Height = -11'#$D#$A' Font.Name = ''MS Sans Serif'''#$D#$A' Font.Style = []'#$D#$A' OldCreateOrder = False'#$D#$A' SaveProps.Strings = ('#$D#$A' ''Visible=False'')'#$D#$A' PixelsPerInch = 96'#$D#$A' TextHeight = 13'#$D#$A' object Edit1: TEdit'#$D#$A' Left = 192'#$D#$A' Top = 64'#$D#$A' Width = 121'#$D#$A' Height = 21'#$D#$A' TabOrder = 8'#$D#$A' end'#$D#$A'end'#$D#$A''");' executes in a MySql console, but not from Delphi, where I pass that command as parameter command to a function which ADOCommand.CommandText := command; ADOCommand.CommandType := cmdText; ADOCommand.Execute(); I can only assume that I am having problems escpaing sequences which contain single quotes (and QuotedStr() doesn't seem to escape backslahes(?!)) What am I doing that is obviously, glaringly wrong?

    Read the article

  • Delphi / MySql : Problems escpaing strings

    - by mawg
    N00b here, having problems escaping strings. I used the QuotedStr() function - shouldn't that be enough. Unfortunately, the string that I am trying to quote is rather messy, but I will post it here in case anyone wants to paste it into WinMerge or KDiff3, etc. I am trying to store an entire Delphi form into the database, rather than into a .DFM file. It has only one field, a TEdit edit box. The debugger shows the form as text as 'object Form1: TScriptForm'#$D#$A' Left = 0'#$D#$A' Top = 0'#$D#$A' Align = alClient'#$D#$A' BorderStyle = bsNone'#$D#$A' ClientHeight = 517'#$D#$A' ClientWidth = 993'#$D#$A' Color = clBtnFace'#$D#$A' Font.Charset = DEFAULT_CHARSET'#$D#$A' Font.Color = clWindowText'#$D#$A' Font.Height = -11'#$D#$A' Font.Name = 'MS Sans Serif''#$D#$A' Font.Style = []'#$D#$A' OldCreateOrder = False'#$D#$A' SaveProps.Strings = ('#$D#$A' 'Visible=False')'#$D#$A' PixelsPerInch = 96'#$D#$A' TextHeight = 13'#$D#$A' object Edit1: TEdit'#$D#$A' Left = 192'#$D#$A' Top = 64'#$D#$A' Width = 121'#$D#$A' Height = 21'#$D#$A' TabOrder = 8'#$D#$A' end'#$D#$A'end'#$D#$A before calling QuotedStr() and ''object Form1: TScriptForm'#$D#$A' Left = 0'#$D#$A' Top = 0'#$D#$A' Align = alClient'#$D#$A' BorderStyle = bsNone'#$D#$A' ClientHeight = 517'#$D#$A' ClientWidth = 993'#$D#$A' Color = clBtnFace'#$D#$A' Font.Charset = DEFAULT_CHARSET'#$D#$A' Font.Color = clWindowText'#$D#$A' Font.Height = -11'#$D#$A' Font.Name = ''MS Sans Serif'''#$D#$A' Font.Style = []'#$D#$A' OldCreateOrder = False'#$D#$A' SaveProps.Strings = ('#$D#$A' ''Visible=False'')'#$D#$A' PixelsPerInch = 96'#$D#$A' TextHeight = 13'#$D#$A' object Edit1: TEdit'#$D#$A' Left = 192'#$D#$A' Top = 64'#$D#$A' Width = 121'#$D#$A' Height = 21'#$D#$A' TabOrder = 8'#$D#$A' end'#$D#$A'end'#$D#$A''' afterwards. The strange thing is that my complete command 'INSERT INTO designerFormDfm(designerFormDfmText) VALUES ("'object Form1: TScriptForm'#$D#$A' Left = 0'#$D#$A' Top = 0'#$D#$A' Align = alClient'#$D#$A' BorderStyle = bsNone'#$D#$A' ClientHeight = 517'#$D#$A' ClientWidth = 993'#$D#$A' Color = clBtnFace'#$D#$A' Font.Charset = DEFAULT_CHARSET'#$D#$A' Font.Color = clWindowText'#$D#$A' Font.Height = -11'#$D#$A' Font.Name = ''MS Sans Serif'''#$D#$A' Font.Style = []'#$D#$A' OldCreateOrder = False'#$D#$A' SaveProps.Strings = ('#$D#$A' ''Visible=False'')'#$D#$A' PixelsPerInch = 96'#$D#$A' TextHeight = 13'#$D#$A' object Edit1: TEdit'#$D#$A' Left = 192'#$D#$A' Top = 64'#$D#$A' Width = 121'#$D#$A' Height = 21'#$D#$A' TabOrder = 8'#$D#$A' end'#$D#$A'end'#$D#$A''");' executes in a MySql console, but not from Delphi, where I pass that command as parameter command to a function which ADOCommand.CommandText := command; ADOCommand.CommandType := cmdText; ADOCommand.Execute(); I can only assume that I am having problems escpaing sequences which contain single quotes (and QuotedStr() doesn't seem to escape backslahes(?!)) What am I doing that is obviously, glaringly wrong?

    Read the article

  • Is there a single query that can update a "sequence number" across multiple groups?

    - by Drarok
    Given a table like below, is there a single-query way to update the table from this: | id | type_id | created_at | sequence | |----|---------|------------|----------| | 1 | 1 | 2010-04-26 | NULL | | 2 | 1 | 2010-04-27 | NULL | | 3 | 2 | 2010-04-28 | NULL | | 4 | 3 | 2010-04-28 | NULL | To this (note that created_at is used for ordering, and sequence is "grouped" by type_id): | id | type_id | created_at | sequence | |----|---------|------------|----------| | 1 | 1 | 2010-04-26 | 1 | | 2 | 1 | 2010-04-27 | 2 | | 3 | 2 | 2010-04-28 | 1 | | 4 | 3 | 2010-04-28 | 1 | I've seen some code before that used an @ variable like the following, that I thought might work: SET @seq = 0; UPDATE `log` SET `sequence` = @seq := @seq + 1 ORDER BY `created_at`; But that obviously doesn't reset the sequence to 1 for each type_id. If there's no single-query way to do this, what's the most efficient way? Data in this table may be deleted, so I'm planning to run a stored procedure after the user is done editing to re-sequence the table.

    Read the article

  • IOS not saving evaluate rule in access-list

    - by DeeJay1
    Hi. I have a basic firewall set up on an pretty od IOS in form of IPv6 access list exterior-in6 evaluate exterior-reflect sequence 1 permit ipv6 any host [my external address] sequence 10 permit tcp any host [my internal address] eq 22 sequence 11 permit icmp any any sequence 800 permit udp any any range 6881 6889 sequence 900 permit tcp any any range 6881 6889 sequence 901 deny ipv6 any any sequence 1000 IPv6 access list exterior-out6 permit ipv6 [my internal subnet] any reflect exterior-reflect sequence 10 Unfortunately the evaluate exterior-reflect sequence 1 line seems to get lost after each reboot, leaving my internal network without access. Any ideas?

    Read the article

  • LINQ: Single vs. SingleOrDefault

    - by Paulo Morgado
    Like all other LINQ API methods that extract a scalar value from a sequence, Single has a companion SingleOrDefault. The documentation of SingleOrDefault states that it returns a single, specific element of a sequence of values, or a default value if no such element is found, although, in my opinion, it should state that it returns a single, specific element of a sequence of values, or a default value if no such element is found. Nevertheless, what this method does is return the default value of the source type if the sequence is empty or, like Single, throws an exception if the sequence has more than one element. I received several comments to my last post saying that SingleOrDefault could be used to avoid an exception. Well, it only “solves” half of the “problem”. If the sequence has more than one element, an exception will be thrown anyway. In the end, it all comes down to semantics and intent. If it is expected that the sequence may have none or one element, than SingleOrDefault should be used. If it’s not expect that the sequence is empty and the sequence is empty, than it’s an exceptional situation and an exception should be thrown right there. And, in that case, why not use Single instead? In my opinion, when a failure occurs, it’s best to fail fast and early than slow and late. Other methods in the LINQ API that use the same companion pattern are: ElementAt/ElementAtOrDefault, First/FirstOrDefault and Last/LastOrDefault.

    Read the article

  • How many bits for sequence number using Go-Back-N protocol.

    - by Mike
    Hi Everyone, I'm a regular over at Stack Overflow (Software developer) that is trying to get through a networking course. I got a homework problem I'd like to have a sanity check on. Here is what I got. Q: A 3000-km-long T1 trunk is used to transmit 64-byte frames using Go-Back-N protocol. If the propagation speed is 6 microseconds/km, how many bits should the sequence numbers be? My Answer: For this questions what we need to do is lay the base knowledge. What we are trying to find is the size of the largest sequence number we should us using Go-Back-N. To figure this out we need to figure out how many packets can fit into our link at a time and then subtract one from that number. This will ensure that we never have two packets with the same sequence number at the same time in the link. Length of link: 3,000km Speed: 6 microseconds / km Frame size: 64 bytes T1 transmission speed: 1544kb/s (http://ckp.made-it.com/t1234.html) Propagation time = 6 microseconds / km * 3000 km = 18,000 microseconds (18ms). Convert 1544kb to bytes = 1544 * 1024 = 1581056 bytes Transmission time = 64 bytes / 1581056bytes / second = 0.000040479 seconds (0.4ms) So then if we take the 18ms propagation time and divide it by the 0.4ms transmission time we will see that we are going to be able to stuff ( 18 / 0.4) 45 packets into the link at a time. That means that our sequence number should be 2 ^ 45 bits long! Am I going in the right direction with this? Thanks, Mike

    Read the article

  • apostrophe in mysql/php

    - by fusion
    i'm trying to learn php/mysql. inserting data into mysql works fine but inserting those with apostrophe is generating an error. i tried using mysql_real_escape_string, yet this doesn't work. would appreciate any help. <?php include 'config.php'; echo "Connected <br />"; $auth = $_POST['author']; $quo = $_POST['quote']; $author = mysql_real_escape_string($auth); $quote = mysql_real_escape_string($quo); //************************** //inserting data $sql="INSERT INTO Quotes (vauthor, cquotes) VALUES ($author, $quote)"; if (!mysql_query($sql,$conn)) { die('Error: ' . mysql_error()); } echo "1 record added"; ... what am i doing wrong?

    Read the article

  • Sending Illegal XML Characters in Soap Request

    - by SK
    I am trying to send special (&, ' (single quote)) characters in the Soap Request. I am using axis 1.4. The webservice client is in weblogic server and the webservice server is an ibm mainframe (COBOL program). The request data from the client contains special character (& symbol) which is converted to &amp; I tried to enclose it with CDATA as <![CDATA[Some Name & Some Data ]]> which got converted to &lt;![CDATA[Some Name &amp; Some Data]]&gt; The webservice client is generated from wsdl, so I couldn't use CDATA api to construct the request. I am able to set it as string value, and it is getting converted. Any help on this would be greatly appreciated. Please let me know if you need any more information on this.

    Read the article

  • Permutation algorithm without recursion? Java

    - by Andreas Hornig
    Hi, I would like to get all combination of a number without any repetation. Like 0.1.2, 0.2.1, 1.2.0, 1.0.2, 2.0.1, 2.1.0. I tried to find an easy scheme but couldn't find so I drawed a graph/tree for it and this screams to use recursion. But I would like to do it without, if this is possible. So could anyone please help me how to do that? Thank you in advance, Andreas

    Read the article

  • Permutatation algorithm without recursion? Java

    - by Andreas Hornig
    Hi, I would like to get all combination of a number without any repetation. Like 0.1.2, 0.2.1, 1.2.0, 1.0.2, 2.0.1, 2.1.0. I tried to find an easy scheme but couldn't find so I drawed a graph/tree for it and this screams to use recursion. But I would like to do it without, if this is possible. So could anyone please help mw how to do that? Thank you in advance, Andreas

    Read the article

  • Insert unicode strings into CleverCSS

    - by Brian M. Hunt
    How can one insert a Unicode string CSS into CleverCSS? In particular, how could one produce the following CSS using CleverCSS: li:after { content: "\00BB \0020"; } I've figured out CleverCSS's parsing rules, but suffice that the permutations I've thought sensible have failed, for example: li: content: "\\00BB \\0020" // becomes content: 'BB 0' EDIT: My other examples and the rest of my post weren't saved. Suffice that I had a longer list of examples that also failed, as did my closing which was something like: I'd be grateful for any thoughts and input. Brian

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 18 19 20 21 22 23 24 25 26 27 28 29  | Next Page >