Search Results

Search found 8286 results on 332 pages for 'defined'.

Page 234/332 | < Previous Page | 230 231 232 233 234 235 236 237 238 239 240 241  | Next Page >

  • Probably an easy one - PHP/CodeIgniter 'Undefined Variable'

    - by Jack W-H
    Morning y'all This is probably an easy one but I barely got any sleep last night and am struggling to comprehend anything. I've got a CodeIgniter library I've made called Points.php. Here's the contents of Points: <?php if (!defined('BASEPATH')) exit('No direct script access allowed'); class Points { function __construct() { $this->ci =& get_instance(); $this->ci->load->database(); } function getpoints($params) { echo $userid; } } /* End of file Points.php */ /* Location: ./application/libraries/Points.php */ ?> As you can see, I'm building it up slowly and it's being kept simple. In one of my views, I want it to display the number of 'points' (which for the time being is simply the third segment of the URI). I call it like this: <p>Points: <?php $params['user_id']=$this->uri->segment(3,1); echo $this->points->getpoints($params); ?></p> The warning I get back in the view is this: A PHP Error was encountered Severity: Notice Message: Undefined variable: userid Filename: libraries/Points.php Yes I know it's such a simple problem but I've tried lots of things. Some variations include echoing in Points.php $params['userid']; etc. But I don't see what I'm doing wrong? This is my first CodeIgniter class and I've fallen at the first step, haha...

    Read the article

  • error in implementing static files in django

    - by POOJA GUPTA
    my settings.py file:- STATIC_ROOT = '/home/pooja/Desktop/static/' # URL prefix for static files. STATIC_URL = '/static/' # Additional locations of static files STATICFILES_DIRS = ( '/home/pooja/Desktop/mysite/search/static', ) my urls.py file:- from django.conf.urls import patterns, include, url from django.contrib.staticfiles.urls import staticfiles_urlpatterns from django.contrib import admin admin.autodiscover() urlpatterns = patterns('', url(r'^search/$','search.views.front_page'), url(r'^admin/', include(admin.site.urls)), ) urlpatterns += staticfiles_urlpatterns() I have created an app using django which seraches the keywords in 10 xml documents and then return their frequency count displayed as graphical representation and list of filenames and their respective counts.Now the list has filenames hyperlinked, I want to display them on the django server when user clicks them , for that I have used static files provision in django. Hyperlinking has been done in this manner: <ul> {% for l in list1 %} <li><a href="{{STATIC_URL}}static/{{l.file_name}}">{{l.file_name}}</a{{l.frequency_count</li> {% endfor %} </ul> Now when I run my app on the server, everything is running fine but as soon as I click on the filename, it gives me this error : Using the URLconf defined in mysite.urls, Django tried these URL patterns, in this order: ^search/$ ^admin/ ^static\/(?P<path>.*)$ The current URL, search/static/books.xml, didn't match any of these. I don't know why this error is coming, because I have followed the steps required to achieve this. I have posted my urls.py file and it is showing error in that only. I'm new to django , so Please help

    Read the article

  • Encryption in Java & Flex

    - by Jef
    I want tp encrypt and decrypt string, with defined salt. But the result must be same if the code run in java and adobe flex. The main goal is: the app in adobe flex will be generate a string that can be decrypt in server using java. I use this flex library http://crypto.hurlant.com/demo/ Try to 'Secret Key' Tab. I want to use AES Encryption, 'CBC' or 'PKCS5'. var k:String = "1234567890123456"; var kdata:ByteArray = Hex.toArray(k); var txt:String = "hello"; var data:ByteArray = Hex.toArray(Hex.fromString(txt));; var name:String = "simple-aes-cbc"; var pad:IPad =new PKCS5(); var mode:ICipher = Crypto.getCipher(name, kdata, pad); pad.setBlockSize(mode.getBlockSize()); mode.encrypt(data); encrypted.text=Hex.fromArray(data); trace(Hex.fromArray(data)); And here is the code in java String plaintext = "hello"; String key = "1234567890123456"; SecretKey keyspec = new SecretKeySpec(key.getBytes(), "AES"); Cipher cipher = Cipher.getInstance("AES/CBC/PKCS5Padding"); cipher.init(Cipher.ENCRYPT_MODE,keyspec); byte[] encrypted = cipher.doFinal(plaintext.getBytes()); BASE64Encoder base64 = new BASE64Encoder(); String encodedString = base64.encode(encrypted); System.out.println(encodedString); Why the result is not same? Can you guys provide the sample with the same result both of java and flex (encrypt and decrypt)? And if I want to change the paramater, for example, from cbc to ebc, which line that need to be changed? Thanks!

    Read the article

  • Looking for a .Net ORM

    - by SLaks
    I'm looking for a .Net 3.5 ORM framework with a rather unusual set of requirements: I need to create and alter tables at runtime with schemas defined by my end-users. (Obviously, that wouldn't be strongly-typed; I'm looking for something like a DataTable there) I also want regular strongly-typed partial classes for rows in non-dynamic tables, with custom validation and other logic. (Like normal ORMs) I want to load the entire database (or some entire tables) once, and keep it in memory throughout the life of the (WinForms) GUI. (I have a shared SQL Server with a relatively slow connection) I also want regular LINQ support (like LINQ-to-SQL) for ASP.Net on the shared server (which has a fast connection to SQL Server) In addition to SQL Server, I also want to be able to use a single-file database that would support XCopy deployment (without installing SQL CE on the end-user's machine). (Probably Access or SQLite) Finally, it has to be free (unless it's OpenAccess) I'll probably have to write it myself, as I don't think there is an existing ORM that meets these requirements. However, I don't want to re-invent the wheel if there is one, hence this question. I'm using VS2010, but I don't know when my webhost (LFC) will upgrade to .Net 4.0

    Read the article

  • Castle ActiveRecord / NHibernate Linq Querys with ValueTypes

    - by Thomas Schreiner
    Given the following code for our Active Record Entites and ValueTypes Linq is not working for us. [ActiveRecord("Person")] public class PersonEntity : ActiveRecordLinqBase<PersonEntity> { string _name; [Property("Name", Length = 20, ColumnType = "string", Access = PropertyAccess.FieldCamelcaseUnderscore)] public Name Name { get { return NameValue.Create(_name);} set { _name = value.DataBaseValue; } } ... } public abstract class Name : IValueType { string DataBaseValue {get;set;} ... } public class Namevalue : Name { string _name; private NameValue(string name) { _name = name; } public static NameValue Create(string name) { return new NameValue(name); } ... } We tried to use linq in the following way so far with no success: var result = from PersonEntity p in PersonEntity.Queryable where p.Name == "Thomas" select p; return result.First(); // throws exception Cannot convert string into Name We tried and implemented a TypeConverter for Name, but the converter never got called. Is there a way to have linq working with this ValueTypes? Update: Using NHibernate.UserTypes.IUserType it sortof works. I Implemented the Interface as described here: http://stackoverflow.com/questions/1565056/how-to-implement-correctly-iusertype I still had to add a ConversionOperator from string to Name and had to call it Explicitly in the linq Statement, even though it was defined as implicit. var result = from PersonEntity p in PersonEntity.Queryable where p.Name == (Name)"Thomas" select p; return result.First(); //Now works

    Read the article

  • Formula parsing / evaluation routine or library with generic DLookup functionality

    - by tbone
    I am writing a .Net application where I must support user-defined formulas that can perform basic mathematics, as well as accessing data from any arbitrary table in the database. I have the math part working, using JScript Eval(). What I haven't decided on is what a nice way is to do the generic table lookups. For example, I may have a formula something like: Column: BonusAmount Formula: {CurrentSalary} * 1.5 * {[SystemSettings][Value][SettingName=CorpBonus AND Year={Year}]} So, in this example I would replace {xxx} and {Year} with the value of Column xxx from the current table, and I would replace the second part with the value of (select Value from SystemSettings WHERE SettingName='CorpBonus' AND Year=2008) So, basically, I am looking for something very much like the MS Access DLookup function: DLookup ( expression, domain, [criteria] ) DLookup("[UnitPrice]", "Order Details", "OrderID = 10248") But, I also need to overall parsing routine that can tell whether to just look up in the current row, or to look into another table. Would also be nice to support aggregate functions (ie: DAvg, DMax, etc), as well as all the weird edge cases handled. So I wonder if anyone knows of any sort of an existing library, or has a nice routine that can handle this formula parsing and database lookup / aggregate function resolution requirements.

    Read the article

  • Multiplication algorithm for abritrary precision (bignum) integers.

    - by nn
    Hi, I'm writing a small bignum library for a homework project. I am to implement Karatsuba multiplication, but before that I would like to write a naive multiplication routine. I'm following a guide written by Paul Zimmerman titled "Modern Computer Arithmetic" which is freely available online. On page 4, there is a description of an algorithm titled BasecaseMultiply which performs gradeschool multiplication. I understand step 2, 3, where B^j is a digit shift of 1, j times. But I don't understand step 1 and 3, where we have A*b_j. How is this multiplication meant to be carried out if the bignum multiplication hasn't been defined yet? Would the operation "*" in this algorithm just be the repeated addition method? Here is the parts I have written thus far. I have unit tested them so they appear to be correct for the most part: The structure I use for my bignum is as follows: #define BIGNUM_DIGITS 2048 typedef uint32_t u_hw; // halfword typedef uint64_t u_w; // word typedef struct { unsigned int sign; // 0 or 1 unsigned int n_digits; u_hw digits[BIGNUM_DIGITS]; } bn; Currently available routines: bn *bn_add(bn *a, bn *b); // returns a+b as a newly allocated bn void bn_lshift(bn *b, int d); // shifts d digits to the left, retains sign int bn_cmp(bn *a, bn *b); // returns 1 if a>b, 0 if a=b, -1 if a<b

    Read the article

  • Implementation of any Hamiltonian Path Problem algorithm

    - by Julien
    Hi all ! Here is my problem : I have an array of points, the points have three properties : the "x" and "y" coordinates, and a sequence number "n". The "x" and "y" are defined for all the points, the "n" are not. You can access and write them calling points[i]-x, points[i]-y, points[i]-n. i.e. : points[i]->n = var var = points[i]->n So the title maybe ruined the surprise, but I'm looking for a possible implementation of a solution to the Hamiltonian path problem : I need to set the "n" number of each point, so that the sequence is the shortest path (not cycle, the edges have to be disjoint) that goes exactly once through each point. I looked for a solution and I found The Bellman Ford Algorithm but I think it doesn't work since the problem doesn't specify that it has to go through all of the points is it correct ? If it is, does somebody has another algorithm and the implementation ? If the Bellman Ford Algorithm works, how would I implement it ? Thanks a lot, Julien

    Read the article

  • Android : Customizing tabs on state : How do I make a selector a drawable

    - by Chrispix
    I know how to put the icon on each tab, that is no problem. I also ran across this : Stack Overflow thread on pretty much same thing I followed one of the links from that question, and found this Pretty much, it said use a selector defined in the xml, sure, did that. But there is no id associated w/ it so I am not sure how to get the selector function as a drawable so I can use it as the icon for the tabs. Maybe I am going about this the wrong way.. But this is what I have, and obviously missing something. <selector android:id="@+id/myselector" xmlns:android="http://schemas.android.com/apk/res/android"> <!-- Non focused states --> <item android:state_focused="false" android:state_selected="false" android:state_pressed="false" android:drawable="@drawable/darklogo" /> <item android:state_focused="false" android:state_selected="true" android:state_pressed="false" android:drawable="@drawable/lightlogo" /> <!-- Focused states --> <item android:state_focused="true" android:state_selected="false" android:state_pressed="false" android:drawable="@drawable/lightlogo" /> <item android:state_focused="true" android:state_selected="true" android:state_pressed="false" android:drawable="@drawable/lightlogo" /> <!-- Pressed --> <item android:state_pressed="true" android:drawable="@drawable/lightlogo" /> </selector> In my code, an example tab is generated using : host.addTab(host.newTabSpec("three") .setIndicator("map",drawables) .setContent(new Intent(this, Map.class))); Right now drawables is just a reference to an drawable image resource. How do I make the selector a drawable? * This is my question *

    Read the article

  • Mapping issue with multi-field primary keys using hibernate/JPA annotations

    - by Derek Clarkson
    Hi all, I'm stuck with a database which is using multi-field primary keys. I have a situation where I have a master and details table, where the details table's primary key contains fields which are also the foreign key's the the master table. Like this: Master primary key fields: master_pk_1 Details primary key fields: master_pk_1 details_pk_2 details_pk_3 In the Master class we define the hibernate/JPA annotations like this: @Id @GeneratedValue(strategy = GenerationType.SEQUENCE, generator = "idGenerator") @Column(name = "master_pk_1") private long masterPk1; @OneToMany(cascade=CascadeType.ALL) @JoinColumn(name = "master_pk_1", referencedColumnName = "master_pk_1") private List<Details> details = new ArrayList<Details>(); And in the details class I have defined the id and back reference like this: @EmbeddedId @AttributeOverrides( { @AttributeOverride( name = "masterPk1", column = @Column(name = "master_pk_1")), @AttributeOverride(name = "detailsPk2", column = @Column(name = "details_pk_2")), @AttributeOverride(name = "detailsPk2", column = @Column(name = "details_pk_2")) }) private DetailsPrimaryKey detailsPrimaryKey = new DetailsPrimaryKey(); @ManyToOne @JoinColumn(name = "master_pk_1", referencedColumnName = "master_pk_1", insertable=false) private Master master; The goal of all of this was that I could create a new master, add some details to it, and when saved, JPA/Hibernate would generate the new id for master in the masterPk1 field, and automatically pass it down to the details records, storing it in the matching masterPk1 field in the DetailsPrimaryKey class. At least that's what the documentation I've been looking at implies. What actually happens is that hibernate appears to corectly create and update the records in the database, but not pass the key to the details classes in memory. Instead I have to manually set it myself. I also found that without the insertable=true added to the back reference to master, that hibernate would create sql that had the master_pk_1 field listed twice in the insert statement, resulting in the database throwing an exception. My question is simply is this arrangement of annotations correct? or is there a better way of doing it?

    Read the article

  • Execute Ant task with Maven

    - by Gonzalo
    Hi, I'm trying to execute with Maven some test written using Ant tasks. I generated the files required to import the task into Maven, but I can't execute them. My POM is defined this way: <build> <plugins> <plugin> <artifactId>maven-ant-plugin</artifactId> <version>2.1</version> <executions> <execution> <phase>generate-sources</phase> <configuration> <tasks> <echo message="Hello, maven"/> </tasks> </configuration> <goals> <goal>run</goal> </goals> </execution> </executions> </plugin> </plugins> </build> I try to execute that message, but I get an error with run: [ERROR] BUILD ERROR [INFO] ------------------------------------------------------------------------ [INFO] 'run' was specified in an execution, but not found in the plugin But, if I run: "mvn antrun:run", I know that this can not run the task. An if I've different targets, how do I call them from Maven? I've the pom.xml, and build.xml with the ant tasks. Thanks. Gonzalo

    Read the article

  • How do I make Views fill the full width of their parent in my Android app?

    - by Omega
    I have the following layout defined for one of my Activities: <?xml version="1.0" encoding="utf-8"?> <TableLayout android:id="@+id/TableLayout01" android:layout_width="fill_parent" android:layout_height="fill_parent" xmlns:android="http://schemas.android.com/apk/res/android"> <TableRow android:id="@+id/TableRow01" android:layout_height="wrap_content" android:layout_width="fill_parent"> <EditText android:text="Resource Name" android:id="@+id/ResourceName" android:lines="1" android:isScrollContainer="false"></EditText> </TableRow> <TableRow android:id="@+id/TableRow02" android:layout_height="wrap_content" android:layout_width="fill_parent"> <Button android:id="@+id/Tile" android:text="Tile"></Button> </TableRow> </TableLayout> The layout renders almost correctly, the only problem is that my text box and my button aren't occupying the full width of their respective rows. I've tried specifying fill_parent for the layout width properties, but to no avail, they still only occupy roughly half of the screen. Documentation overall for Android so far has been great, but there are a few scenarios like this one where I hit an invisible wall! Thanks for all the help!

    Read the article

  • Params order in Foo.new(params[:foo]), need one before the other (Rails)

    - by Jeena
    I have a problem which I don't know how to fix. It has to do with the unsorted params hash. I have a object Reservation which has a virtual time= attribute and a virtual eating_session= attribute when I set the time= I also want to validate it via an external server request. I do that with help of the method times() which makes a lookup on a other server and saves all possible times in the @times variable. The problem now is that the method times() needs the eating_session attribute to find out which times are valid, but rails sometimes calls the times= method first, before there is any eating_session in the Reservation object when I just do @reservation = Reservation.new(params[:reservation]) class ReservationsController < ApplicationController def new @reservation = Reservation.new(params[:reservation]) # ... end end class Reservation < ActiveRecord::Base include SoapClient attr_accessor :date, :time belongs_to :eating_session def time=(time) @time = times.find { |t| t[:time] == time } end def times return @times if defined? @times @times = [] response = call_soap :search_availability { # eating_session is sometimes nil :session_id => eating_session.code, # <- HERE IS THE PROBLEM :dining_date => date } response[:result].each do |result| @times << { :time => "#{DateTime.parse(result[:time]).strftime("%H:%M")}", :correlation_data => result[:correlation_data] } end @times end end I have no idea how to fix this, any help is apriciated.

    Read the article

  • PHP XML Strategy: Parsing DOM to fill "Bean"

    - by Mike
    I have a question concerning a good strategy on how to fill a data "bean" with data inside an xml file. The bean might look like this: class Person { var $id; var $forename = ""; var $surname = ""; var $bio = new Biography(); } class Biography { var $url = ""; var $id; } the xml subtree containing the info might look like this: <root> <!-- some more parent elements before node(s) of interest --> <person> <name pre="forename"> Foo </name> <name pre="surname"> Bar </name> <id> 1254 </id> <biography> <url> http://www.someurl.com </url> <id> 5488 </id> </biography> </person> </root> At the moment, I have one approach using DOMDocument. A method iterates over the entries and fills the bean by "remembering" the last node. I think thats not a good approach. What I have in mind is something like preconstructing some xpath expression(s) and then iterate over the subtrees/nodeLists. Return an array containing the beans as defined above eventually. However, it seems not to be possible reusing a subtree /DOMNode as DOMXPath constructor parameter. Has anyone of you encountered such a problem?

    Read the article

  • Javascript Error with DataTable jQuery plugin

    - by stevoyoung
    I am getting a JS error and what to know what it means and how to solve it. (JS noob here) Error: "tId is not defined" Line of JS with error: "if (s[i].sInstance = tId) { " More Information I am using the Data Table (http://datatables.net) jQuery plugin. I have a two tables with a class of "dataTable" loaded on a page (inside of jQuery UI tabs). The tables render as expected but I get the error above in Firebug. Attached is my Data Table config file... $(document).ready(function() { //Take from: http://datatables.net/forums/comments.php?DiscussionID=1507 // before creating a table, make sure it is not already created. // And if it is, then remove old version before new one is created var currTable = $(".dataTable"); if (currTable) { // contains the dataTables master records var s = $(document).dataTableSettings; if (s != 'undefined') { var len = s.length; for (var i=0; i < len; i++) { // if already exists, remove from the array if (s[i].sInstance = tId) { s.splice(i,1); } } } } oTable = $('.dataTable').dataTable({ "bJQueryUI": true, "sPaginationType": "full_numbers", "bFilter": false }); }); What does the error mean and how do I resolve it?

    Read the article

  • how to fix: ctags null expansion of name pattern "\1"

    - by bua
    Hi, As the title points I have problem with ctags when trying to parse user-defined language. Basically I've followed those instructions. The quickest and easiest way to do this is by defining a new language using the program options. In order to have Swine support available every time I start ctags, I will place the following lines into the file $HOME/.ctags, which is read in every time ctags starts: --langdef=swine --langmap=swine:.swn --regex-swine=/^def[ \t]*([a-zA-Z0-9_]+)/\1/d,definition/ The first line defines the new language, the second maps a file extension to it, and the third defines a regular expression to identify a language definition and generate a tag file entry for it. I've tried different flags: b,e for regex. My definition of tag is: --regex-q=/^[ \t]*[^[:space:]]*[:space:]*:[:space:]*{/\l/f,function/b When I replace \1 with anything else (ascii caracter set ), It works. the output is: (--regex-q=/^[ \t]*[^[:space:]]*[:space:]*:[:space:]*{/my function name/f,function/b) !_TAG_FILE_FORMAT 2 /extended format; --format=1 will not append ;" to lines/ !_TAG_FILE_SORTED 1 /0=unsorted, 1=sorted, 2=foldcase/ !_TAG_PROGRAM_AUTHOR Darren Hiebert /[email protected]/ !_TAG_PROGRAM_NAME Exuberant Ctags // !_TAG_PROGRAM_URL http://ctags.sourceforge.net /official site/ !_TAG_PROGRAM_VERSION 5.8 // my function name file.q /^.ras.getLocation:{[u]$/;" f my function name file.q /^.a.getResource:{[u; pass]$/;" f my function name file.q /^.a.init:{$/;" f my function name file.q /^.a.kill:{[u; force]$/;" f my function name file.q /^.asdf.status:{[what; u]$/;" f my function name file.q /^.pc:{$/;" f Why \1 doesn't work? (I've tried all 1-9)

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Why can I run JUnit tests for my Spring project, but not a main method?

    - by FarmBoy
    I am using JDBC to connect to MySQL for a small application. In order to test without altering the real database, I'm using HSQL in memory for JUnit tests. I'm using Spring for DI and DAOs. Here is how I'm configuring my HSQL DataSource <bean id="mockDataSource" class="org.springframework.jdbc.datasource.SingleConnectionDataSource"> <property name="driverClassName" value="org.hsqldb.jdbcDriver"/> <property name="url" value="jdbc:hsqldb:mem:mockSeo"/> <property name="username" value="sa"/> </bean> This works fine for my JUnit tests which use the mock DB. But when I try to run a main method, I find the following error: Error creating bean with name 'mockDataSource' defined in class path resource [beans.xml]: Error setting property values; nested exception is org.springframework.beans.PropertyBatchUpdateException; nested PropertyAccessExceptions (1) are: PropertyAccessException 1: org.springframework.beans.MethodInvocationException: Property 'driverClassName' threw exception; nested exception is java.lang.IllegalStateException: Could not load JDBC driver class [org.hsqldb.jdbcDriver] I'm running from Eclipse, and I'm using the Maven plugin. Is there a reason why this would work as a Test, but not as a main()? I know that the main method itself is not the problem, because it works if I remove all references to the HSQL DataSource from my Spring Configuration file.

    Read the article

  • Dojo DnD: how to access newly copied node on onDndDrop event?

    - by toshinao
    Hi. I am working on code like the following. 01: var c1 = new dojo.dnd.Source('container1', {copyOnly:true}); // container1 is a div 02: var c2 = new dojo.dnd.Source('container2'); // container2 is a div 03: var list = []; 04: for (var i = 0; i < 3; i++) { list.push( dojo.create('div') ); } 05: c1.insertNodes(false, list); 06: 07: function checkDndCopy(nodes, target){ 08: dojo.forEach(nodes, function(node){ alert(node.id); } ); 09: } 10: dojo.subscribe("/dnd/drop", function(){ 11: var mgr = dojo.dnd.manager(); 12: checkDndCopy(mgr.nodes, mgr.target); 13: }); The nodes inserted to the c1 at line 05 have id of "dojoUnique1, donoUnique2, dojoUnique3". On a event of drag and drop a node from c1 to c2, a onDndDrop event is fired and the subscribe method defined in line10-13 is invoked. I expected that newly copied node appears in the nodes (for example) at line 08. But this is not true. When dojoUnique1 is target of drag and drop, nodes at line 08 contains only dojoUnique1. I want to modify some attributes of newly copied nodes on the event of onDndDrop. Please let me know how such a thing is realized.

    Read the article

  • F# Active Pattern List.filter or equivalent

    - by akaphenom
    I have a records of types type tradeLeg = { id : int ; tradeId : int ; legActivity : LegActivityType ; actedOn : DateTime ; estimates : legComponents ; entryType : ShareOrDollarBased ; confirmedPrice: DollarsPerShare option; actuals : legComponents option ; type trade = { id : int ; securityId : int ; ricCode : string ; tradeActivity : TradeType ; enteredOn : DateTime ; closedOn : DateTime ; tradeLegs : tradeLeg list ; } Obviously the tradeLegs are a type off of a trade. A leg may be settled or unsettled (or unsettled but price confirmed) - thus I have defined the active pattern: let (|LegIsSettled|LegIsConfirmed|LegIsUnsettled|) (l: tradeLeg) = if Helper.exists l.actuals then LegIsSettled elif Helper.exists l.confirmedPrice then LegIsConfirmed else LegIsUnsettled and then to determine if a trade is settled (based on all legs matching LegIsSettled pattern: let (|TradeIsSettled|TradeIsUnsettled|) (t: trade) = if List.exists ( fun l -> match l with | LegIsSettled -> false | _ -> true) t.tradeLegs then TradeIsSettled else TradeIsUnsettled I can see some advantages of this use of active patterns, however i would think there is a more efficient way to see if any item of a list either matches (or doesn't) an actie pattern without having to write a lambda expression specifically for it, and using List.exist. Question is two fold: is there a more concise way to express this? is there a way to abstract the functionality / expression (fun l - match l with | LegIsSettled - false | _ - true) Such that let itemMatchesPattern pattern item = match item with | pattern -> true | _ -> false such I could write (as I am reusing this design-pattern): let curriedItemMatchesPattern = itemMatchesPattern LegIsSettled if List.exists curriedItemMatchesPattern t.tradeLegs then TradeIsSettled else TradeIsUnsettled Thoughts?

    Read the article

  • Flex - Issues retrieving an XMLList

    - by BS_C3
    Hello! I'm having a problem retrieving a XMLList and I don't understand why. I have an application that is running properly. It uses some data from two xml files called division.xml and store.xml. I noticed that I have some data in division.xml that should be in store.xml, so I did a copy/paste of the data from one file to the other. This is the data I copied: <stores> <store> <odeis>101</odeis> <name></name> <password></password> <currency></currency> <currSymbol></currSymbol> </store> <store> <odeis>102</odeis> <name></name> <password></password> <currency></currency> <currSymbol></currSymbol> </store> </stores> In the application, I list all odeis codes and I need to retrieve the block store corresponding to the selected odeis code. Before moving the data into store.xml, this is how I retrieved the block: var node:XMLList = divisionData.division.(@name==HomePageData.instance.divisionName).stores.store.(odeis == HomePageData.instance.storeCodeOdeis) This is how I retrieve it after copying the data into store.xml: var node:XMLList = storeData.stores.(@name==HomePageData.instance.divisionName).store.(odeis == HomePageData.instance.storeCodeOdeis) And I'm currently getting the following error: ReferenceError: Error #1065: The variable odeis is not defined. Could anyone enlighten me? Cause I really have no clue of why it is not working... Thanks for any tips you can give. Regards, BS_C3

    Read the article

  • refactor LINQ TO SQL custom properties that instantiate datacontext

    - by Thiago Silva
    I am working on an existing ASP.NET MVC app that started small and has grown with time to require a good re-architecture and refactoring. One thing that I am struggling with is that we've got partial classes of the L2S entities so we could add some extra properties, but these props create a new data context and query the DB for a subset of data. This would be the equivalent to doing the following in SQL, which is not a very good way to write this query as oppsed to joins: SELECT tbl1.stuff, (SELECT nestedValue FROM tbl2 WHERE tbl2.Foo = tbl1.Bar), tbl1.moreStuff FROM tbl1 so in short here's what we've got in some of our partial entity classes: public partial class Ticket { public StatusUpdate LastStatusUpdate { get { //this static method call returns a new DataContext but needs to be refactored var ctx = OurDataContext.GetContext(); var su = Compiled_Query_GetLastUpdate(ctx, this.TicketId); return su; } } } We've got some functions that create a compiled query, but the issue is that we also have some DataLoadOptions defined in the DataContext, and because we instantiate a new datacontext for getting these nested property, we get an exception "Compiled Queries across DataContexts with different LoadOptions not supported" . The first DataContext is coming from a DataContextFactory that we implemented with the refactorings, but this second one is just hanging off the entity property getter. We're implementing the Repository pattern in the refactoring process, so we must stop doing stuff like the above. Does anyone know of a good way to address this issue?

    Read the article

  • Graph limitations - Should I use Decorator?

    - by Nick Wiggill
    I have a functional AdjacencyListGraph class that adheres to a defined interface GraphStructure. In order to layer limitations on this (eg. acyclic, non-null, unique vertex data etc.), I can see two possible routes, each making use of the GraphStructure interface: Create a single class ("ControlledGraph") that has a set of bitflags specifying various possible limitations. Handle all limitations in this class. Update the class if new limitation requirements become apparent. Use the decorator pattern (DI, essentially) to create a separate class implementation for each individual limitation that a client class may wish to use. The benefit here is that we are adhering to the Single Responsibility Principle. I would lean toward the latter, but by Jove!, I hate the decorator Pattern. It is the epitome of clutter, IMO. Truthfully it all depends on how many decorators might be applied in the worst case -- in mine so far, the count is seven (the number of discrete limitations I've recognised at this stage). The other problem with decorator is that I'm going to have to do interface method wrapping in every... single... decorator class. Bah. Which would you go for, if either? Or, if you can suggest some more elegant solution, that would be welcome. EDIT: It occurs to me that using the proposed ControlledGraph class with the strategy pattern may help here... some sort of template method / functors setup, with individual bits applying separate controls in the various graph-canonical interface methods. Or am I losing the plot?

    Read the article

  • NSBorderlessWindow not responding to CMD-W/CMD-M

    - by Sean
    I have an NSBorderlessWindow subclass of NSWindow with a transparent and non-opaque background (so it's non-rectangular in appearance). I've added my own buttons to function as the close and minimize buttons when I click them, but for some reason the window will not respond to CMD-W or CMD-M like a normal one does. I have my NSWindow subclass set to return YES to canBecomeKeyWindow and canBecomeMainWindow. My NIB still has all the standard menu items in it that are there when you create a new project - including the "Minimize" item in the Window menu with the default shortcut CMD-M defined. It's hooked up to send performMiniaturize: to the first responder. However it is not enabled when the app is run, so it seems like it must be asking the window if it can minimize and the window says no or something. (I'm still very new to OSX/Cocoa.) What am I missing? Also, and maybe this is related, my borderless window has a shadow enabled - but unlike a normal titled window, when I make my window the active/front window by clicking on it, the shadow doesn't change. Normally an OSX focused window has a slightly larger/darker shadow to make it stand out more but mine never changes the shadow. It's like I'm missing something to make the OS treat this window as a real/normal/main window or something and as a result I lose the shadow change and functioning CMD-W/CMD-M.

    Read the article

  • F# Class with Generics : 'constructor deprecated' error

    - by akaphenom
    I am trying to create a a class that will store a time series of data - organized by groups, but I had some compile errors so I stripped down to the basics (just a simple instantiation) and still can't overcome the compile error. I was hoping some one may have seen this issue before. Clas is defined as: type TimeSeriesQueue<'V, 'K when 'K: comparison> = class val private m_daysInCache: int val private m_cache: Map<'K, 'V list ref > ref; val private m_getKey: ('V -> 'K) ; private new(getKey) = { m_cache = ref Map.empty m_daysInCache = 7 ; m_getKey = getKey ; } end So that looks OK to me (it may not be, but doesnt have any errors or warnings) - the instantiation gets the error: type tempRec = { someKey: string ; someVal1: int ; someVal2: int ; } let keyFunc r:tempRec = r.someKey // error occurs on the following line let q = new TimeSeriesQueue<tempRec, string> keyFunc This construct is deprecated: The use of the type syntax 'int C' and 'C ' is not permitted here. Consider adjusting this type to be written in the form 'C' NOTE This may be simple stupidity - I am just getting back from holiday and my brain is still on time zone lag...

    Read the article

< Previous Page | 230 231 232 233 234 235 236 237 238 239 240 241  | Next Page >