Search Results

Search found 631 results on 26 pages for 'newline'.

Page 24/26 | < Previous Page | 20 21 22 23 24 25 26  | Next Page >

  • log4net logging problem

    - by Dotnet_user
    Hello everyone, I'm not sure if this is the right forum to post this question. But I'm just hoping someone here might have used log4net in the past, so hoping to get some help. I'm using log4net to log my exceptions. The configuration settings look like this: <?xml version="1.0" encoding="utf-8" ?> <configuration> <configSections> <section name="log4net" type="log4net.Config.Log4NetConfigurationSectionHandler, log4net"/> </configSections> <log4net debug="false"> <appender name="RollingLogFileAppender" type="log4net.Appender.RollingFileAppender"> <file value="C:\Logs\sample.log" /> <appendToFile value="true"/> <rollingStyle value="Size"/> <maxSizeRollBackups value="10"/> <maximumFileSize value="10MB"/> <staticLogFileName value="true"/> <layout type="log4net.Layout.PatternLayout"> <conversionPattern value="%-5level %date %logger.%method[line %line] - %message%newline"/> </layout> </appender> <root> <level value="INFO"/> <appender-ref ref="RollingLogFileAppender"/> </root> </log4net> </configuration> I started out by adding this configuration to web.config, but I got an error (VS studio could not find a schema for log4net-"Could not find schema information for the element log4net"). So I followed this link (http://stackoverflow.com/questions/174430/log4net-could-not-find-schema-information-messages) and configured my settings in a separate xml file and added the following line of code in my AssemblyInfo.cs: [assembly: log4net.Config.XmlConfigurator(ConfigFile = "xmlfile.xml", Watch = true)] And in the actual code, I placed this line: public void CreateUser(String username, String password) { try { log.Info("Inside createuser"); //code for creating user } catch(exception e) { log.Info("something happened in create user", e); } } The problem is that the log file is not being created. I can't see anything inside C:\Logs. Can anybody tell me what I'm doing wrong here? Any suggestions/inputs will be very helpful. Thank you all in advance.

    Read the article

  • understanding logic of dijit css and styles

    - by Tom
    Hi, I am trying to use dijit.InlineEditBox. I have put the following code in my HTML, using the example in the dojo docs: <script type="text/javascript"> dojo.require("dijit.InlineEditBox"); dojo.require("dojo.parser"); dojo.require("dijit.form.TextBox"); function editableHeaderOnChange(id, arg){ alert("details changed with id " + id + " and arguments "+arg); } </script> ... <span id="myText" dojoType="dijit.InlineEditBox" onChange="editableHeaderOnChange(this.id,arguments[0])" autoSave="true" title="My Text">click to edit me</span> I am using tundra theme. It works, however it doesn't look so good. The widget has its own style, which doesn't fit my CSS. I used firebug to locate the source of the problem. The widget creates many nested div/span elements, each has it's own style (element style in firebug): <span id="dijit__InlineEditor_0" class="dijitReset dijitInline" style="margin: 0px; position: absolute; visibility: hidden; display: block; opacity: 0;" ...> <input type="text" autocomplete="off" class="dijit dijitReset dijitLeft dijitTextBox" id="dijit_form_TextBox_0" style="line-height: 20px; font-weight: 400; font-family: Trebuchet MS,Helvetica,Arial,Verdana; font-size: 14.5167px; font-style: normal; width: 100%;"> ...> </span></span> (showing only the relevant parts...) to get the visual that I want, which will not break to a newline, I need to change the width of dijit_form_TextBox_0** to 50%, and the positioning of dijit__InlineEditor_0 to display: inline**; or to change the positioning of everything (most of my layout is floated, so position: absolute doesn't fit) I cannot address those span elements in my css to change the properties, because the element.style has priority, of course. I don't understand the logic in this system... why is dijit generating the style directly inside the element? how can I change these properties? Thanks Tom

    Read the article

  • Unable to verify body hash for DKIM

    - by Joshua
    I'm writing a C# DKIM validator and have come across a problem that I cannot solve. Right now I am working on calculating the body hash, as described in Section 3.7 Computing the Message Hashes. I am working with emails that I have dumped using a modified version of EdgeTransportAsyncLogging sample in the Exchange 2010 Transport Agent SDK. Instead of converting the emails when saving, it just opens a file based on the MessageID and dumps the raw data to disk. I am able to successfully compute the body hash of the sample email provided in Section A.2 using the following code: SHA256Managed hasher = new SHA256Managed(); ASCIIEncoding asciiEncoding = new ASCIIEncoding(); string rawFullMessage = File.ReadAllText(@"C:\Repositories\Sample-A.2.txt"); string headerDelimiter = "\r\n\r\n"; int headerEnd = rawFullMessage.IndexOf(headerDelimiter); string header = rawFullMessage.Substring(0, headerEnd); string body = rawFullMessage.Substring(headerEnd + headerDelimiter.Length); byte[] bodyBytes = asciiEncoding.GetBytes(body); byte[] bodyHash = hasher.ComputeHash(bodyBytes); string bodyBase64 = Convert.ToBase64String(bodyHash); string expectedBase64 = "2jUSOH9NhtVGCQWNr9BrIAPreKQjO6Sn7XIkfJVOzv8="; Console.WriteLine("Expected hash: {1}{0}Computed hash: {2}{0}Are equal: {3}", Environment.NewLine, expectedBase64, bodyBase64, expectedBase64 == bodyBase64); The output from the above code is: Expected hash: 2jUSOH9NhtVGCQWNr9BrIAPreKQjO6Sn7XIkfJVOzv8= Computed hash: 2jUSOH9NhtVGCQWNr9BrIAPreKQjO6Sn7XIkfJVOzv8= Are equal: True Now, most emails come across with the c=relaxed/relaxed setting, which requires you to do some work on the body and header before hashing and verifying. And while I was working on it (failing to get it to work) I finally came across a message with c=simple/simple which means that you process the whole body as is minus any empty CRLF at the end of the body. (Really, the rules for Body Canonicalization are quite ... simple.) Here is the real DKIM email with a signature using the simple algorithm (with only unneeded headers cleaned up). Now, using the above code and updating the expectedBase64 hash I get the following results: Expected hash: VnGg12/s7xH3BraeN5LiiN+I2Ul/db5/jZYYgt4wEIw= Computed hash: ISNNtgnFZxmW6iuey/3Qql5u6nflKPTke4sMXWMxNUw= Are equal: False The expected hash is the value from the bh= field of the DKIM-Signature header. Now, the file used in the second test is a direct raw output from the Exchange 2010 Transport Agent. If so inclined, you can view the modified EdgeTransportLogging.txt. At this point, no matter how I modify the second email, changing the start position or number of CRLF at the end of the file I cannot get the files to match. What worries me is that I have been unable to validate any body hash so far (simple or relaxed) and that it may not be feasible to process DKIM through Exchange 2010.

    Read the article

  • Reading Source Code Aloud

    - by Jon Purdy
    After seeing this question, I got to thinking about the various challenges that blind programmers face, and how some of them are applicable even to sighted programmers. Particularly, the problem of reading source code aloud gives me pause. I have been programming for most of my life, and I frequently tutor fellow students in programming, most often in C++ or Java. It is uniquely aggravating to try to verbally convey the essential syntax of a C++ expression. The speaker must give either an idiomatic translation into English, or a full specification of the code in verbal longhand, using explicit yet slow terms such as "opening parenthesis", "bitwise and", et cetera. Neither of these solutions is optimal. On the one hand, an idiomatic translation is only useful to a programmer who can de-translate back into the relevant programming code—which is not usually the case when tutoring a student. In turn, education (or simply getting someone up to speed on a project) is the most common situation in which source is read aloud, and there is a very small margin for error. On the other hand, a literal specification is aggravatingly slow. It takes far far longer to say "pound, include, left angle bracket, iostream, right angle bracket, newline" than it does to simply type #include <iostream>. Indeed, most experienced C++ programmers would read this merely as "include iostream", but again, inexperienced programmers abound and literal specifications are sometimes necessary. So I've had an idea for a potential solution to this problem. In C++, there is a finite set of keywords—63—and operators—54, discounting named operators and treating compound assignment operators and prefix versus postfix auto-increment and decrement as distinct. There are just a few types of literal, a similar number of grouping symbols, and the semicolon. Unless I'm utterly mistaken, that's about it. So would it not then be feasible to simply ascribe a concise, unique pronunciation to each of these distinct concepts (including one for whitespace, where it is required) and go from there? Programming languages are far more regular than natural languages, so the pronunciation could be standardised. Speakers of any language would be able to verbally convey C++ code, and due to the regularity and fixity of the language, speech-to-text software could be optimised to accept C++ speech with a high degree of accuracy. So my question is twofold: first, is my solution feasible; and second, does anyone else have other potential solutions? I intend to take suggestions from here and use them to produce a formal paper with an example implementation of my solution.

    Read the article

  • javascript problems when generating html reports from within java

    - by posdef
    Hi, I have been working on a Java project in which the reports will be generated in HTML, so I am implementing methods for creating these reports. One important functionality is to be able to have as much info as possible in the tables, but still not clutter too much. In other words the details should be available if the user wishes to take a look at them but not necessarily visible by default. I have done some searching and testing and found an interesting template for hiding/showing content with the use of CSS and javascript, the problem is that when I try the resultant html page the scripts dont work. I am not sure if it's due a problem in Java or in the javascript itself. I have compared the html code that java produces to the source where I found the template, they seem to match pretty well. Below are bits of my java code that generates the javascript and the content, i would greatly appreciate if anyone can point out the possible reasons for this problem: //goes to head private void addShowHideScript() throws IOException{ StringBuilder sb = new StringBuilder(); sb.append("<script type=\"text/javascript\" language=\"JavaScript\">\n"); sb.append("<!--function HideContent(d) {\n"); sb.append("document.getElementById(d).style.display=\"none\";}\n"); sb.append("function ShowContent(d) {\n"); sb.append("document.getElementById(d).style.display=\"block\";}\n"); sb.append("function ReverseDisplay(d) {\n"); sb.append("if(document.getElementById(d).style.display==\"none\")\n"); sb.append("{ document.getElementById(d).style.display=\"block\"; }\n"); sb.append("else { document.getElementById(d).style.display=\"none\"; }\n}\n"); sb.append("//--></script>\n"); out.write(sb.toString()); out.newLine(); } // body private String linkShowHideContent(String pathname, String divname){ StringBuilder sb = new StringBuilder(); sb.append("<a href=\"javascript:ReverseDisplay('"); sb.append(divname); sb.append("')\">"); sb.append(pathname); sb.append("</a>"); return sb.toString(); } // content out.write(linkShowHideContent("hidden content", "ex")); out.write("<div id=\"ex\" style=\"display:block;\">"); out.write("<p>Content goes here.</p></div>");

    Read the article

  • Fread binary file dynamic size string [C]

    - by Blackbinary
    I've been working on this assignment, where I need to read in "records" and write them to a file, and then have the ability to read/find them later. On each run of the program, the user can decide to write a new record, or read an old record (either by Name or #) The file is binary, here is its definition: typedef struct{ char * name; char * address; short addressLength, nameLength; int phoneNumber; }employeeRecord; employeeRecord record; The way the program works, it will store the structure, then the name, then the address. Name and address are dynamically allocated, which is why it is necessary to read the structure first to find the size of the name and address, allocate memory for them, then read them into that memory. For debugging purposes I have two programs at the moment. I have my file writing program, and file reading. My actual problem is this, when I read a file I have written, i read in the structure, print out the phone # to make sure it works (which works fine), and then fread the name (now being able to use record.nameLength which reports the proper value too). Fread however, does not return a usable name, it returns blank. I see two problems, either I haven't written the name to the file correctly, or I haven't read it in correctly. Here is how i write to the file: where fp is the file pointer. record.name is a proper value, so is record.nameLength. Also i am writing the name including the null terminator. (e.g. 'Jack\0') fwrite(&record,sizeof record,1,fp); fwrite(record.name,sizeof(char),record.nameLength,fp); fwrite(record.address,sizeof(char),record.addressLength,fp); And i then close the file. here is how i read the file: fp = fopen("employeeRecord","r"); fread(&record,sizeof record,1,fp); printf("Number: %d\n",record.phoneNumber); char *nameString = malloc(sizeof(char)*record.nameLength); printf("\nName Length: %d",record.nameLength); fread(nameString,sizeof(char),record.nameLength,fp); printf("\nName: %s",nameString); Notice there is some debug stuff in there (name length and number, both of which are correct). So i know the file opened properly, and I can use the name length fine. Why then is my output blank, or a newline, or something like that? (The output is just Name: with nothing after it, and program finishes just fine) Thanks for the help.

    Read the article

  • Multiline editable textarea in SVG

    - by Timo
    I'm trying to implement multiline editable textfield in SVG. I have the following code in http://jsfiddle.net/ca4d3/ : <svg width="1000" height="1000" overflow="scroll"> <g transform="rotate(5)"> <rect width="300" height="400" fill="#22DD22" fill-opacity="0.5"/> </g> <foreignObject x="10" y="10" overflow="visible" width="10000" height="10000" requiredFeatures="http://www.w3.org/TR/SVG11/feature#Extensibility"> <p style="display:table-cell;padding:10px;border:1px solid red; background-color:white;opacity:0.5;font-family:Verdana; font-size:20px;white-space: pre; word-wrap: normal; overflow: visible; overflow-y: visible; overflow-x:visible;" contentEditable="true" xmlns="http://www.w3.org/1999/xhtml"> Write here some text. Be smart and select some word. If you wanna be really COOL, paste here something cool! </p> </foreignObject> </svg> In newest Chrome, Safari and Firefox the code works in some way, but in Opera and IE 9 not. The goal is that: 0) Works in newest Chrome, Safari, Firefox, Opera and IE and if ever possible in some pads. 1) White-spaces are preserved and text wraps only on newline char (works in Chrome, Safari and Firefox, but not in Opera and IE 9 *). 2) The textfield is editable (in the same reliable and stabile way as textareas and contenteditable p elements in html) and height and width is expanded to fit text (works in Chrome, Safari and Firefox, but not in Opera and IE 9 *). 3) Texfield can be transformed (rotated, skewed, translated) while maintaining text editability (Tested rotation, but not work in any browser *). EDIT: Foreignobject rotation works on Firefox 15.0.1, but not in Safari 5.1.7 (6534.57.2), Chrome 22.0.1229.79, Opera 12.02, IE 9. Tested on Mac OS X 10.6.8. 4) Textfield can be clipped and masked while not necessarily maintaining text editability (not yet tested). *) using above code These all can be achieved using Flash, but Flash has so severe problems that it is not suitable for my purposes (after every little change in code, all have to be compiled again using Flex, which is slow, font size has limits, tracking technique is pixeloriented, not relative to em size etc.) and there still are differences across platforms. And I want to give a try to SVG! GUESTION: Can I achieve my goals 0-4 with current SVG support in browsers? Is coming SVG 2.0 for some help in this case? EDIT: Changed display:table to display:table-cell (and added new jsfiddle), because display:table made the field to loses focus when pressed arrow-up on first text row.

    Read the article

  • How to increment counters based on a printed array

    - by Sam Liew
    I managed to developed a simple board of 5x5 using random numbers and array. Big achievement for someone like me! :) Now I have to increment the counters depending on the frequency of the numbers. If the value within 0-49 is printed..then nCounter++ If the value within 50-75 is printed..then pCounter++ something like that. The problem is that I don't know how to increase the counters based on the printed board. Here is the code: #include <stdio.h> #include <stdlib.h> #include <time.h> int main() { //Initialize Variables int randomNumber; int rows; int columns; int hdCounter =0; int hCounter = 0; int cCounter = 0; int pCounter = 0; int nCounter = 0; //Declare board size int board[5][5]; //size of board is 5 x 5 //Create the random number generator seed srand(time(NULL)); //Assign the random numbers from 1 - 25 into variable randomNumber //Create the rows for the board for ( rows = 1; rows <= 5 ; rows++ ) { //Create the colimns for the board for ( columns = 1; columns <= 5 ; columns++ ) { //Assign variable randomNumber into variable board randomNumber = rand() %100 + 1; board[rows][columns] = randomNumber; //print the board printf("%d\t", board[rows][columns]); //calculate the frequency of numbers on the printed board if (randomNumber >= 85 && randomNumber <= 100 ) hdCounter++; else if ( randomNumber >= 75 ) hCounter++; else if ( randomNumber >= 65 ) cCounter++; else if ( randomNumber >= 50 ) pCounter++; else if ( randomNumber >= 1 ) nCounter++; else continue; } //Newline after the end of 5th column. printf("\n\n"); } printf( "N \t P \t C \t H \t HD\n\n" ); printf("%d \t %d \t %d \t %d \t %d \t", nCounter, pCounter, cCounter, hCounter, hdCounter); }//end main I tried replacing randomNumber in the if-statement with board[rows][columns] but I seem to get the same undesired results.

    Read the article

  • How to display specific data from a file

    - by user1067332
    My program is supposed to ask the user for firstname, lastname, and phone number till the users stops. Then when to display it asks for the first name and does a search in the text file to find all info with the same first name and display lastname and phones of the matches. import java.util.*; import java.io.*; import java.util.Scanner; public class WritePhoneList { public static void main(String[] args)throws IOException { BufferedWriter output = new BufferedWriter(new FileWriter(new File( "PhoneFile.txt"), true)); String name, lname, age; int pos,choice; try { do { Scanner input = new Scanner(System.in); System.out.print("Enter First name, last name, and phone number "); name = input.nextLine(); output.write(name); output.newLine(); System.out.print("Would you like to add another? yes(1)/no(2)"); choice = input.nextInt(); }while(choice == 1); output.close(); } catch(Exception e) { System.out.println("Message: " + e); } } } Here is the display code, when i search for a name, it finds a match but displays the last name and phone number of the same name 3 times, I want it to display all of the possible matches with the first name. import java.util.*; import java.io.*; import java.util.Scanner; public class DisplaySelectedNumbers { public static void main(String[] args)throws IOException { String name; String strLine; try { FileInputStream fstream = new FileInputStream("PhoneFile.txt"); // Get the object of DataInputStream DataInputStream in = new DataInputStream(fstream); BufferedReader br = new BufferedReader(new InputStreamReader(in)); Scanner input = new Scanner(System.in); System.out.print("Enter a first name"); name = input.nextLine(); strLine= br.readLine(); String[] line = strLine.split(" "); String part1 = line[0]; String part2 = line[1]; String part3 = line[2]; //Read File Line By Line while ((strLine= br.readLine()) != null) { if(name.equals(part1)) { // Print the content on the console System.out.print("\n" + part2 + " " + part3); } } }catch (Exception e) {//Catch exception if any System.out.println("Error: " + e.getMessage()); } } }

    Read the article

  • Unintentional concatenation in Bison/Yacc grammar.

    - by troutwine
    I am experimenting with lex and yacc and have run into a strange issue, but I think it would be best to show you my code before detailing the issue. This is my lexer: %{ #include <stdlib.h> #include <string.h> #include "y.tab.h" void yyerror(char *); %} %% [a-zA-Z]+ { yylval.strV = yytext; return ID; } [0-9]+ { yylval.intV = atoi(yytext); return INTEGER; } [\n] { return *yytext; } [ \t] ; . yyerror("invalid character"); %% int yywrap(void) { return 1; } This is my parser: %{ #include <stdio.h> int yydebug=1; void prompt(); void yyerror(char *); int yylex(void); %} %union { int intV; char *strV; } %token INTEGER ID %% program: program statement EOF { prompt(); } | program EOF { prompt(); } | { prompt(); } ; args: /* empty */ | args ID { printf(":%s ", $<strV>2); } ; statement: ID args { printf("%s", $<strV>1); } | INTEGER { printf("%d", $<intV>1); } ; EOF: '\n' %% void yyerror(char *s) { fprintf(stderr, "%s\n", s); } void prompt() { printf("> "); } int main(void) { yyparse(); return 0; } A very simple language, consisting of no more than strings and integer and a basic REPL. Now, you'll note in the parser that args are output with a leading colon, the intention being that, when combined with the first pattern of the rule of the statement the interaction with the REPL would look something like this: > aaa aa a :aa :a aaa> However, the interaction is this: > aaa aa a :aa :a aaa aa aa > Why does the token ID in the following rule statement: ID args { printf("%s", $<strV>1); } | INTEGER { printf("%d", $<intV>1); } ; have the semantic value of the total input string, newline included? How can my grammar be reworked so that the interaction I intended?

    Read the article

  • User created Validator wont call Client side validation Javascript on 'complex' user control.

    Hi All, I have created a user control (from System.Web.UI.UserControl), and created my own validator for the user control (from System.Web.UI.WebControls.BaseValidator). Everything works ok until I try to get the user control to do client side validation. While trying to debug this issue I have set 'Control to Validate' to a text box instead of the custom user control, and the client side script works fine! It appears to me that it has an a issue with my composite user control I have created. Has anyone encountered this issue before? Has anyone else seen client side validation fail on custom user controls? Some extra info : The composite control is a drop down list and 'loader image', as it is a ajax enabled drop down list (using ICallbackEventHandler). I know that the client side javascript is being written to the page, and have placed an alert('random message') as the first line in the validator function that only appears if it is validating a text box (i.e. not when it is validating my custom control) Language : C# (ASP.NET 2.0) and jQuery 1.2.6 in aspx file : <rms:UserDDL ID="ddlUserTypes" runat="server" PreLoad="true" /> <rms:DDLValidator ID="userTypesVal" ControlToValidate="ddlUserTypes" ErrorMessage="You have not selected a UserType" runat="server" Text="You have not selected a UserType" Display="Dynamic" EnableClientScript="true" /> in validator code behind protected string ScriptBlock { get { string nl = System.Environment.NewLine; return "<script type=\"text/javascript\">" + nl + " function " + ScriptBlockFunctionName + "(ctrl)" + nl + " {" + nl + " alert('Random message'); " + nl + " var selVal = $('#' + ctrl.controltovalidate).val(); " + nl + " alert(selVal);" + nl + " if (selVal === '-1') return false; " + nl + " return false; " + nl + " }" + nl + "</script>"; } } protected override void OnPreRender(EventArgs e) { if (this.DetermineRenderUplevel() && this.EnableClientScript) { Page.ClientScript.RegisterExpandoAttribute(this.ClientID, "evaluationfunction", this.ScriptBlockFunctionName); Page.ClientScript.RegisterClientScriptBlock(GetType(), this.ScriptBlockKey, this.ScriptBlock); } base.OnPreRender(e); } I know my ControlPropertiesValid() and EvaluateIsValid() work ok. I appreciate any help on this issue. Noel.

    Read the article

  • how get xml responce using JAX-WS SOAP handler

    - by khris
    I have implemented web service: @WebServiceClient(//parameters//) @HandlerChain(file = "handlers.xml") public class MyWebServiceImpl {...} Also I have implemented ObjectFactory with list of classes for creating my requests and responses. For Example class Test. I need to get xml of response. I try to use JAX-WS SOAP handler, so I add this @HandlerChain(file = "handlers.xml") anotation. My handlers.xml looks like: <?xml version="1.0" encoding="UTF-8"?> <handler-chains xmlns="http://java.sun.com/xml/ns/javaee"> <handler-chain> <handler> <handler-class>java.com.db.crds.ws.service.LoggingHandler</handler-class> </handler> </handler-chain> </handler-chains> My LoggingHandler class is: import java.io.PrintWriter; import java.util.Set; import javax.xml.namespace.QName; import javax.xml.soap.SOAPMessage; import javax.xml.ws.handler.MessageContext; import javax.xml.ws.handler.soap.SOAPMessageContext; public class LoggingHandler implements javax.xml.ws.handler.soap.SOAPHandler<SOAPMessageContext> { public void close(MessageContext messagecontext) { } public Set<QName> getHeaders() { return null; } public boolean handleFault(SOAPMessageContext messagecontext) { return true; } public boolean handleMessage(SOAPMessageContext smc) { Boolean outboundProperty = (Boolean) smc.get (MessageContext.MESSAGE_OUTBOUND_PROPERTY); if (outboundProperty.booleanValue()) { System.out.println("\nOutbound message:"); } else { System.out.println("\nInbound message:"); } SOAPMessage message = smc.getMessage(); try { PrintWriter writer = new PrintWriter("soap_responce" + System.currentTimeMillis(), "UTF-8"); writer.println(message); writer.close(); message.writeTo(System.out); System.out.println(""); // just to add a newline } catch (Exception e) { System.out.println("Exception in handler: " + e); } return outboundProperty; } } I have test class which creates request, here are part of code: MyWebServiceImpl impl = new MyWebServiceImpl(url, qName); ws = impl.getMyWebServicePort(); Test req = new Test(); I suppose to get xml response in file "soap_responce" + System.currentTimeMillis(). But such file isn't even created. Please suggest how to get xml response, I'm new to web services and may do something wrong. Thanks

    Read the article

  • log4net initialisation

    - by Ruben Bartelink
    I've looked hard for duplicates but have to ask the following, no matter how basic it may seem, to get it clear once and for all! In a fresh Console app using log4net version 1.2.10.0 on VS28KSP1 on 64 bit W7, I have the following code:- using log4net; using log4net.Config; namespace ConsoleApplication1 { class Program { static readonly ILog _log = LogManager.GetLogger(typeof(Program)); static void Main(string[] args) { _log.Info("Ran"); } } } In my app.config, I have: <?xml version="1.0" encoding="utf-8" ?> <configuration> <configSections> <section name="log4net" type="log4net.Config.Log4NetConfigurationSectionHandler, log4net" /> </configSections> <log4net> <appender name="RollingFileAppender" type="log4net.Appender.RollingFileAppender"> <file value="Program.log" /> <lockingModel type="log4net.Appender.FileAppender+MinimalLock" /> <appendToFile value="true" /> <rollingStyle value="Size" /> <maxSizeRollBackups value="10" /> <maximumFileSize value="1MB" /> <staticLogFileName value="true" /> <layout type="log4net.Layout.PatternLayout"> <conversionPattern value="[%username] %date [%thread] %-5level %logger [%property{NDC}] - %message%newline" /> </layout> </appender> <root> <level value="DEBUG" /> <appender-ref ref="RollingFileAppender" /> </root> </log4net> </configuration> This doesnt write anything, unless I either add an attribute: [ assembly:XmlConfigurator ] Or explicitly initialise it in Main(): _log.Info("This will not go to the log"); XmlConfigurator.Configure(); _log.Info("Ran"); This raises the following questions: I'm almost certain I've seen it working somewhere on some version of log4net without the addition of the assembly attribute or call in Main. Can someone assure me I'm not imagining that? Can someone please point me to where in the doc it explicitly states that both the config section and the initialisation hook are required - hopefully with an explanation of when this changed, if it did? I can easily imagine why this might be the policy -- having the initialisation step explicit to avoid surprises etc., it's just that I seem to recall this not always being the case... (And normally I have the config in a separate file, which generally takes configsections out of the picture)

    Read the article

  • Reading column header and column values of a data table using LAMBDA(C#3.0)

    - by Newbie
    Consider the folowing where I am reading the data table values and writing to a text file using (StreamWriter sw = new StreamWriter(@"C:\testwrite.txt",true)) { DataPreparation().AsEnumerable().ToList().ForEach(i => { string col1 = i[0].ToString(); string col2 = i[1].ToString(); string col3 = i[2].ToString(); string col4 = i[3].ToString(); sw.WriteLine( col1 + "\t" + col2 + "\t" + col3 + "\t" + col4 + Environment.NewLine ); }); } The data preparation function is as under private static DataTable DataPreparation() { DataTable dt = new DataTable(); dt.Columns.Add("Col1", typeof(string)); dt.Columns.Add("Col2", typeof(int)); dt.Columns.Add("Col3", typeof(DateTime)); dt.Columns.Add("Col4", typeof(bool)); for (int i = 0; i < 10; i++) { dt.Rows.Add("String" + i.ToString(), i, DateTime.Now.Date, (i % 2 == 0) ? true : false); } return dt; } It is working fine. Now in the above described program, it is known to me the Number of columns and the column headers. How to achieve the same in case when the column headers and number of columns are not known at compile time using the lambda expression? I have already done that which is as under public static void WriteToTxt(string directory, string FileName, DataTable outData, string delimiter) { FileStream fs = null; StreamWriter streamWriter = null; using (fs = new FileStream(directory + "\\" + FileName + ".txt", FileMode.Append, FileAccess.Write)) { try { streamWriter = new StreamWriter(fs); streamWriter.BaseStream.Seek(0, SeekOrigin.End); streamWriter.WriteLine(); DataTableReader datatableReader = outData.CreateDataReader(); for (int header = 0; header < datatableReader.FieldCount; header++) { streamWriter.Write(outData.Columns[header].ToString() + delimiter); } streamWriter.WriteLine(); int row = 0; while (datatableReader.Read()) { for (int field = 0; field < datatableReader.FieldCount; field++) { streamWriter.Write(outData.Rows[row][field].ToString() + delimiter); } streamWriter.WriteLine(); row++; } } catch (Exception ex) { throw ex; } } } I am using C#3.0 and framework 3.5 Thanks in advance

    Read the article

  • Remove newlines and spaces

    - by Cosmin
    How can I remove newline between <table> .... </table> and add \n after each ex: <table border="0" cellspacing="0" cellpadding="0" width="450" class="descriptiontable"><tr> <td width="50%" valign="top"> <span class="displayb">Model Procesor:</span> Intel Celeron<br><span class="displayb">Frecventa procesor (MHz):</span> 2660<br><span class="displayb">Placa Video:</span> Intel Extreme Graphics 2<br><span class="displayb">Retea integrata:</span> 10/100Mbps, RJ-45<br><span class="displayb">Chipset:</span> Intel 845G<br> </td> <td width="50%" valign="top"> <span class="displayb">Capacitate RAM (MB):</span> 512<br><span class="displayb">Tip RAM:</span> DDR<br> </td> </tr></table> and become : <table border="0" cellspacing="0" cellpadding="0" width="450" class="descriptiontable"><tr><td width="50%" valign="top"><span class="displayb">Model Procesor:</span> Intel Celeron<br><span class="displayb">Frecventa procesor (MHz):</span> 2660<br><span class="displayb">Placa Video:</span> Intel Extreme Graphics 2<br><span class="displayb">Retea integrata:</span> 10/100Mbps, RJ-45<br><span class="displayb">Chipset:</span> Intel 845G<br></td><td width="50%" valign="top"><span class="displayb">Capacitate RAM (MB):</span> 512<br><span class="displayb">Tip RAM:</span> DDR<br></td></tr></table>\n s.

    Read the article

  • getline() sets failbit and skips last line

    - by Thanatos
    I'm using std::getline() to enumerate through the lines in a file, and it's mostly working. It's left me curious however - std::getline() is skipping the very last line in my file, but only if it's blank. Using this minimal example: #include <iostream> #include <string> int main() { std::string line; while(std::getline(std::cin, line)) std::cout << "Line: “" << line << "”\n"; return 0; } If I feed it this: Line A Line B Line C I get those lines back at me. But this: Line A Line B Line C [* line is present but blank, ie, the file end is: "...B\nLine C\n" *] (I unfortunately can't have a blank line in SO's little code box thing...) So, first file has three lines ( ["Line A", "Line B", "Line C"] ), second file has four ( ["Line A", "Line B", "Line C", ""] ) This to me seems wrong - I have a four line file, and enumerating it with getline() leaves me with 3. What's really got me scratching my head is that this is exactly what the standard says it should do. (21.3.7.9) Even Python has similar behaviour (but it gives me the newlines too - C++ chops them off.) Is this some weird thing where C++ is expected lines to be terminated, and not separated by '\n', and I'm feeding it differently? Edit Clearly, I need to expand a bit here. I've met up with two philosophies of determining what a "line" in a file is: Lines are terminated by newlines - Dominant in systems such as Linux, and editors like vim. Possible to have a slightly "odd" file by not having a final '\n' (a "noeol" in vim). Impossible to have a blank line at the end of a file. Lines are separated by newlines - Dominant in just about every Windows editor I've ever come across. Every file is valid, and it's possible to have the last line be blank. Of course, YMMV as to what a newline is. I've always treated these as two completely different schools of thought. One earlier point I tried to make was to ask if the C++ standard was explicitly or merely implicitly following the first. (Curiously, where is Mac? terminated or separated?)

    Read the article

  • Android - cant read TXT files from SDcard on real mashine?

    - by JustMe
    Hello! When I run the code bellow in the virtual android (1.5) it works well, TextSwitcher shows first 80 chars from each txt file from /sdcard/documents/ , but when I run it on my Samsung Galaxy i7500 (1.6) there are no contents in TextSwitcher, however in LogCat there are FileNames of txt files. My Code: public void getTxtFiles(){ //Scan /sdcard/documents and put .txt files in array File TxtFiles[] String path = Environment.getExternalStorageDirectory().toString()+"/documents/"; String files; File folder = new File(path); if(folder.exists()==false){if (!folder.mkdirs()) { Log.e("TAG", "Create dir in sdcard failed"); return; }} else{ File listOfFiles[] = folder.listFiles(); for (int i = 0; i < listOfFiles.length; i++) { if (listOfFiles[i].isFile()) { files = listOfFiles[i].getName(); if (files.endsWith(".txt") || files.endsWith(".TXT")) { if((files.length()-1)>i){resizeArray(TxtFiles, files.length()+10);} TxtFiles[i]=listOfFiles[i]; System.out.println(TxtFiles[i]); } } }} } private void updateCounter(int Pozicija) { if(Pozicija<0){Toast.makeText(getApplicationContext(), R.string.LastTxt, 5).show(); mCounter++;} else if(TxtFiles[mCounter]!=null){ TextToShow = getContents(TxtFiles[mCounter]); if(TextToShow.length()>80)TextToShow=TextToShow.substring(0, 80); mSwitcher.setText(TextToShow); System.out.println(Pozicija); } else mCounter--; } static public String getContents(File aFile) { //...checks on aFile are elided StringBuilder contents = new StringBuilder(); try { //use buffering, reading one line at a time //FileReader always assumes default encoding is OK! BufferedReader input = new BufferedReader(new FileReader(aFile)); try { String line = null; //not declared within while loop /* * readLine is a bit quirky : * it returns the content of a line MINUS the newline. * it returns null only for the END of the stream. * it returns an empty String if two newlines appear in a row. */ while (( line = input.readLine()) != null){ contents.append(line); contents.append(System.getProperty("line.separator")); } } finally { input.close(); } } catch (IOException ex){ ex.printStackTrace(); } return contents.toString(); } And I am able to write contents of those files though LogCat! Any ideas?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How do I tie a cmbBox that selects all drives (local and network) into a treeNode VB

    - by jpavlov
    How do i tie in a selected item from a cmbBox with a treeView? I am looking to just obtain the value of the one selected drive Thanks. Imports System Imports System.IO Imports System.IO.File Imports System.Windows.Forms Public Class F_Treeview_Demo Private Sub F_Treeview_Demo_Load(ByVal sender As Object, ByVal e As System.EventArgs) Handles Me.Load ' Initialize the local directory treeview Dim nodeText As String = "" Dim sb As New C_StringBuilder With My.Computer.FileSystem 'Read in the number of drives For i As Integer = 0 To .Drives.Count - 1 '** Build the drive's node text sb.ClearText() sb.AppendText(.Drives(i).Name) cmbDrives.Items.Add(sb.FullText) Next End With ListRootNodes() End Sub Private Sub btnExit_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles btnExit.Click Application.Exit() End Sub Private Sub tvwLocalFolders_AfterSelect(ByVal sender As Object, ByVal e As System.Windows.Forms.TreeViewEventArgs) _ Handles tvwLocalFolders.AfterSelect ' Display the path for the selected node Dim folder As String = tvwLocalFolders.SelectedNode.Tag lblLocalPath.Text = folder ListView1.Items.Clear() Dim childNode As TreeNode = e.Node.FirstNode Dim parentPath As String = AddChar(e.Node.Tag) End Sub Private Sub AddToList(ByVal nodes As TreeNodeCollection) For Each node As TreeNode In nodes If node.Checked Then ListView1.Items.Add(node.Text) ListView1.Items.Add(Chr(13)) AddToList(node.Nodes) End If Next End Sub Private Sub tvwLocalFolders_BeforeExpand(ByVal sender As Object, ByVal e As System.Windows.Forms.TreeViewCancelEventArgs) _ Handles tvwLocalFolders.BeforeExpand ' Display the path for the selected node lblLocalPath.Text = e.Node.Tag ' Populate all child nodes below the selected node Dim parentPath As String = AddChar(e.Node.Tag) tvwLocalFolders.BeginUpdate() Dim childNode As TreeNode = e.Node.FirstNode 'this i added Dim smallNode As TreeNode = e.Node.FirstNode Do While childNode IsNot Nothing ListLocalSubFolders(childNode, parentPath & childNode.Text) childNode = childNode.NextNode ''this i added ListLocalFiles(smallNode, parentPath & smallNode.Text) Loop tvwLocalFolders.EndUpdate() tvwLocalFolders.Refresh() ' Select the node being expanded tvwLocalFolders.SelectedNode = e.Node ListView1.Items.Clear() AddToList(tvwLocalFolders.Nodes) ListView1.Items.Add(Environment.NewLine) End Sub Private Sub ListRootNodes() ' Add all local drives to the Local treeview Dim nodeText As String = "" Dim sb As New C_StringBuilder With My.Computer.FileSystem For i As Integer = 0 To .Drives.Count - 1 '** Build the drive's node text sb.ClearText() sb.AppendText(.Drives(i).Name) nodeText = sb.FullText nodeText = Me.cmbDrives.SelectedItem '** Add the drive to the treeview Dim driveNode As TreeNode driveNode = tvwLocalFolders.Nodes.Add(nodeText) 'driveNode.Tag = .Drives(i).Name '** Add the next level of subfolders 'ListLocalSubFolders(driveNode, .Drives(i).Name) ListLocalSubFolders(driveNode, nodeText) 'driveNode = Nothing Next End With End Sub Private Sub ListLocalFiles(ByVal ParentNode As TreeNode, ByVal PParentPath As String) Dim FileNode As String = "" Try For Each FileNode In Directory.GetFiles(PParentPath) Dim smallNode As TreeNode smallNode = ParentNode.Nodes.Add(FilenameFromPath(FileNode)) With smallNode .ImageIndex = 0 .SelectedImageIndex = 1 .Tag = FileNode End With smallNode = Nothing Next Catch ex As Exception End Try End Sub Private Sub ListLocalSubFolders(ByVal ParentNode As TreeNode, _ ByVal ParentPath As String) ' Add all local subfolders below the passed Local treeview node Dim FolderNode As String = "" Try For Each FolderNode In Directory.GetDirectories(ParentPath) Dim childNode As TreeNode childNode = ParentNode.Nodes.Add(FilenameFromPath(FolderNode)) With childNode .ImageIndex = 0 .SelectedImageIndex = 1 .Tag = FolderNode End With childNode = Nothing Next Catch ex As Exception End Try End Sub Private Sub ComboBox1_SelectedIndexChanged(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles cmbDrives.SelectedIndexChanged End Sub Private Sub lblLocalPath_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles lblLocalPath.Click End Sub Private Sub grpLocalFileSystem_Enter(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles grpLocalFileSystem.Enter End Sub Private Sub btn1_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles btn1.Click ' lbl1.Text = End Sub Private Sub ListView1_SelectedIndexChanged(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles ListView1.SelectedIndexChanged End Sub End Class

    Read the article

  • How can I pipe input to a Java app with Perl?

    - by user319479
    I need to write a Perl script that pipes input into a Java program. This is related to this, but that didn't help me. My issue is that the Java app doesn't get the print statements until I close the handle. What I found online was that $| needs to be set to something greater than 0, in which case newline characters will flush the buffer. This still doesn't work. This is the script: #! /usr/bin/perl -w use strict; use File::Basename; $|=1; open(TP, "| java -jar test.jar") or die "fail"; sleep(2); print TP "this is test 1\n"; print TP "this is test 2\n"; print "tests printed, waiting 5s\n"; sleep(5); print "wait over. closing handle...\n"; close TP; print "closed.\n"; print "sleeping for 5s...\n"; sleep(5); print "script finished!\n"; exit And here is a sample Java app: import java.util.Scanner; public class test{ public static void main( String[] args ){ Scanner sc = new Scanner( System.in ); int crashcount = 0; while( true ){ try{ String input = sc.nextLine(); System.out.println( ":: INPUT: " + input ); if( "bananas".equals(input) ){ break; } } catch( Exception e ){ System.out.println( ":: EXCEPTION: " + e.toString() ); crashcount++; if( crashcount == 5 ){ System.out.println( ":: Looks like stdin is broke" ); break; } } } System.out.println( ":: IT'S OVER!" ); return; } } The Java app should respond to receiving the test prints immediately, but it doesn't until the close statement in the Perl script. What am I doing wrong? Note: the fix can only be in the Perl script. The Java app can't be changed. Also, File::Basename is there because I'm using it in the real script.

    Read the article

  • Splitting a raidctl mirror safely

    - by milkfilk
    I have a Sun T5220 server with the onboard LSI card and two disks that were in a RAID 1 mirror. The data is not important right now but we had a failed disk and are trying to understand how to do this for real if we had to recover from a failure. The initial situation looked like this: # raidctl -l c1t0d0 Volume Size Stripe Status Cache RAID Sub Size Level Disk ---------------------------------------------------------------- c1t0d0 136.6G N/A DEGRADED OFF RAID1 0.1.0 136.6G GOOD N/A 136.6G FAILED Green light on the 0.0.0 disk. Find / lights up the 0.1.0 disk. So I know I have a bad drive and which one it is. Server still boots obviously. First, we tried putting a new disk in. This disk came from an unknown source. Format would not see it, cfgadm -al would not see it so raidctl -l would not see it. I figure it's bad. We tried another disk from another spare server: # raidctl -c c1t1d0 c1t0d0 (where t1 is my good disk - 0.1.0) Disk has occupied space. Also the different syntax options don't change anything: # raidctl -C "0.1.0 0.0.0" -r 1 1 Disk has occupied space. # raidctl -C "0.1.0 0.0.0" 1 Disk has occupied space. Ok. Maybe this is because the disk from the spare server had a RAID 1 on it already. Aha, I can see another volume in raidctl: # raidctl -l Controller: 1 Volume:c1t1d0 (this is my server's root mirror) Volume:c1t132d0 (this is the foreign root mirror) Disk: 0.0.0 Disk: 0.1.0 ... No problem. I don't care about the data, I'll just delete the foreign mirror. # raidctl -d c1t132d0 (warning about data deletion but it works) At this point, /usr/bin/ binaries freak out. By that I mean, ls -l /usr/bin/which shows 1.4k but cat /usr/bin/which gives me a newline. Great, I just blew away the binaries (ie: binaries in mem still work)? I bounce the box. It all comes back fine. WTF. Anyway, back to recreating my mirror. # raidctl -l Controller: 1 Volume:c1t1d0 (this is my server's root mirror) Disk: 0.0.0 Disk: 0.1.0 ... Man says that you can delete a mirror and it will split it. Ok, I'll delete the root mirror. # raidctl -d c1t0d0 Array in use. (this might not be the exact error) I googled this and found of course you can't do this (even with -f) while booted off the mirror. Ok. I boot cdrom -s and deleted the volume. Now I have one disk that has a type of "LSI-Logical-Volume" on c1t1d0 (where my data is) and a brand new "Hitachi 146GB" on c1t0d0 (what I'm trying to mirror to): (booted off the CD) # raidctl -c c1t1d0 c1t0d0 (man says it's source destination for mirroring) Illegal Array Layout. # raidctl -C "0.1.0 0.0.0" -r 1 1 (alt syntax per man) Illegal Array Layout. # raidctl -C "0.1.0 0.0.0" 1 (assumes raid1, no help) Illegal Array Layout. Same size disks, same manufacturer but I did delete the volume instead of throwing in a blank disk and waiting for it to resync. Maybe this was a critical error. I tried selecting the type in format for my good disk to be a plain 146gb disk but it resets the partition table which I'm pretty sure would wipe the data (bad if this was production). Am I boned? Anyone have experience with breaking and resyncing a mirror? There's nothing on Google about "Illegal Array Layout" so here's my contrib to the search gods.

    Read the article

  • Issues Converting Plain Text Into Microsoft Word Bulleted Lists

    - by user787832
    I'm a programmer. I hate status reports. I found a way to live with it. While I am working in my IDE ( Visual Slickedit ) I keep a plain text file open in one of the file/buffer tabs. As I finish things I just jot down a quick note into that file. At the end of the week that becomes my weekly status report. Example entries: The Datatables.net plugin runs very slowly in IE 8 with more than 2,000 records. I changed the way I did the server side code to process the data to make less work for the plugin to get decent performance for the IE 8 users. I made a class to wrap data from the new data collection objects into the legacy data holder objects. This will let the new database code be backward compatible with the legacy code until we can replace it. I found the bug reported by Jane. The software is fine. The database we use for the test site has data that is corrupted in a way it wouldn't be for production site At the end of the month I go back to each weekly *.txt file and paste all of the entries into a MS Word file for a monthly report. I give the monthly report to a liason to the contracting company who has to compile everyone's monthly reports into a single MS Word 2007 document. His problem, soon to be my problem, comes when he highlights my paragraphs like the ones above to put bullets in front of my paragraphs. When he highlights my notes to put bullets in front of them with MS Word 2007, Word rearranges the text a bit and the new line chars/carriage returns stagger the text so the text is no longer in neat chunks. This: I found the bug reported by Jane. The software is fine. The database we use for the test site has data that is corrupted in a way it wouldn't be for production site Becomes This: I found the bug reported by Jane. The software is fine. The database we use for the test site has data that is corrupted in a way it wouldn't be for production site I tried turning word wrap on in my IDE for the text files I put my status notes in. It just puts some kind of newline character in anyway. Searching/Replacing those chars in the text files has the result of destroying the paragraphs. Once my notes are pasted into MS Word, Word automatically translates them into paragraph breaks. Searching/Replacing them there has similar results. Blank lines separating the notes disappears. One big mess. What I would like is to be able to keep adding my status notes to a text file as I am now, but do something different when I paste the notes into MS Word such that my liason can select the text, hit the bulleting command and NOT have the staggered text as shown above. Any ideas? Thanks much in advance Steve

    Read the article

  • Clarity is important, both in question and in answer.

    - by gerrylowry
    clarity is important ... i'm often reminded of the Clouseau movie in which Peter Sellers as Chief Inspector Clouseau asks a hotel clerk "Does your dog bite?" ... the clerk answers "no" ... after Clouseau has been bitten by the dog, he looks at the hotel clerk who says "That's not my dog".  Clarity is important, both in question and in answer. i've been a member of forums.asp.net since 2008 ... like many of my peers at forums.asp.net, i've answered my fair share of questions. FWIW, the purpose of this, my first web log post to http://weblogs.asp.net/gerrylowry is to help new members ask better questions and in turn get better answers. TIMTOWTDI  =.  there is more than one way to do it imho, the best way to ask a question in any forum, or even person to person, is to first formulate your question and then ask yourself to answer your own question. Things to consider when asking (the more complete your question, the more likely you'll get the answer you require): -- have you searched Google and/or your favourite search engine(s) before posting your question to forums.asp.net; examples: site:msdn.microsoft.com entity framework 5.0 c#http://lmgtfy.com/?q=site%3Amsdn.microsoft.com+entity+framework+5.0+c%23 site:forums.asp.net MVC tutorial c#http://lmgtfy.com/?q=site%3Aforums.asp.net+MVC+tutorial+c%23 -- are you asking your question in the correct forum?  look at the forums' descriptions at http://forums.asp.net/; examples: Getting Started If you have a general ASP.NET question on a topic that's not covered by one of the other more specific forums - ask it here. MVC Discussions regarding ASP.NET Model-View-Controller (MVC) C# Questions about using C# for ASP.NET development Note:  if your question pertains more to c# than to MVC, choosing the C# forum is likely to be more appropriate. -- is your post subject clear and concise, yet not too vague? compare these three subjects (all three had something to do with GridView):     (1)    please help     (2)    gridview      (3)    How to show newline in GridView  -- have you clearly explained your scenario? compare:  my leg hurts   with   when i walk too much, my right knee hurts in the knee joint  compare:  my code does not work    with    when i enter a date as 2012-11-8, i get a FormatException -- have you checked your spelling, your grammar, and your English? for better or worse, English is the language of forums.asp.net ... many of the currently 170000++ forums.asp.net are not native speakers of English; that's okay ... however, there are times when choosing the more appropriate words will likely get one a better answer; fortunately, there are web tools to help you formulate your question, for example, http://translate.google.com/.  -- have you provided relevant information about your environment? here are a few examples ... feel free to include other items to your question ... rule of thumb:  if you think a given detail is relevant, it likely is -- what technology are you using?    ASP.NET MVC 4, ASP.NET MVC 3, WebForms, ...  -- what version of Visual Studio are you using?  vs2012 (ultimate, professional, express), vs2010, vs2008 ... -- are you hosting your own website?  are you using a shared hosting service? -- are you experience difficulties in just one browser? more than one browser? -- what browser version(s) are you using?   ie8? ie9? ... -- what is your operating system?     win8, win7, vista, XP, server 2008 R2 ... -- what is your database?   SQL Server 2008 R2, ss2005, MySQL, Oracle, ... -- what is your web server?  iis 7.5, iis 6, .... -- have you provided enough information for someone to be able to answer your question? Here's an actual example from an O.P. that i hope is self-explanatory: I'm trying to make a simple calculator when i write the code in windows application it worked when i tried it in web application it doesn't work and there are no errors what should i do ??!! -- have you included unnecessary information? more than once, i've seen the O.P. (original post, original poster) include many extra lines of code that were not relevant to the actual question; the more unnecessary code that you include, the less likely your volunteer peers will be motivated to donate their time to help you. -- have you asked the question that you want answered? "Does this dog bite?" -- are your expectations reasonable? -- generally, persons who are going to answer your questions are your peers ... they are unpaid volunteers ... -- are you looking for help with your homework, work assignment, or hobby? or, are you expecting someone else to do your work for you?  -- do you expect a complete solution or are you simply looking for guidance and direction? -- you are likely to get more help by first making a reasonable effort to help yourself first Clarity is important, both in question and in answer. if you are answering someone else's question, please remember that clear answers are just as important as clear questions; would you understand your own answer? Things to consider when answering: -- have you tested your code example?  if you have, say so; if you've not tested your code example, also say so -- imho, it's okay to guess as long as you clearly state that you're guessing ... sometimes a wrong guess can still help the O.P. find her/his way to the right answer -- meanness does not contribute to being helpful; sometimes one may become frustrated with the O.P. and/or others participating in a thread, if that happens to you, be kind regardless; speaking from my own experience, at least once i've allowed myself to be frustrated into writing something inappropriate that i've regretted later ... being a meany does not feel good ... being kind and helpful feels fantastic! Tip:  before asking your question, read more than a few existing questions and answers to get a sense of how your peers ask and answer questions. Gerry P.S.:  try to avoid necroposting and piggy backing. necroposting is adding to an old post, especially one that was resolved months ago. piggy backing is adding your own question to someone else's thread.

    Read the article

  • Poner aplicaci&oacute;n Asp.Net en modo OFFLINE

    - by Jason Ulloa
    Una de las opciones que todo aplicación debería tener es el poder ponerse en modo OFFLINE para evitar el acceso de usuarios. Esto es completamente necesario cuando queremos realizar cambios a nuestra aplicación (cambiar algo, poner una actualización, etc) o a nuestra base de datos y evitarnos problemas con los usuarios que se encuentren logueados dentro de la aplicación en ese momento. Muchos ejemplos a través de la Web exponen la forma de realizar esta tarea utilizando dos técnicas: 1. La primera de ellas es utilizar el archivo App_Offline.htm sin embargo, esta técnica tiene un inconveniente. Y es que, una vez que hemos subido el archivo a nuestra aplicación esta se bloquea completamente y no tenemos forma de volver a ponerla ONLINE a menos que eliminemos el archivo. Es decir no podemos controlarla. 2. La segunda de ellas es el utilizar la etiqueta httpRuntime, pero nuevamente tenemos el mismo problema. Al habilitar el modo OFFLINE mediante esta etiqueta, tampoco podremos acceder a un modo de administración para cambiarla. Un ejemplo de la etiqueta httpRuntime <configuration> <system.web> <httpRuntime enable="false" /> </system.web> </configuration>   Tomando en cuenta lo anterior, lo mas optimo seria que podamos por medio de alguna pagina de administración colocar nuestro sitio en modo OFFLINE, pero manteniendo el acceso a la pagina de administración para poder volver a cambiar el valor que pondrá nuestra aplicación nuevamente en modo ONLINE. Para ello, utilizaremos el web.config de nuestra aplicación y una pequeña clase que se encargara de Leer y escribir los valores. Lo primero será, abrir nuestro web.config y definir dentro del appSettings dos nuevas KEY que contendrán los valores para el modo OFFLINE de nuestra aplicación: <appSettings> <add key="IsOffline" value="false" /> <add key="IsOfflineMessage" value="Sistema temporalmente no disponible por tareas de mantenimiento." /> </appSettings>   En las KEY anteriores tenemos el IsOffLine con value de false, esto es para indicarle a nuestra aplicación que actualmente su modo de funcionamiento es ONLINE, este valor será el que posteriormente cambiemos a TRUE para volver al modo OFFLINE. Nuestra segunda KEY (IsOfflineMessage) posee el value (Sistema temporalmente….) que será mostrado al usuario como un mensaje cuando el sitio este en modo OFFLINE. Una vez definidas nuestras dos KEY en el web.config, escribiremos una clase personalizada para leer y escribir los valores. Así que, agregamos un nuevo elemento de tipo clase al proyecto llamado SettingsRules y la definimos como Public. Está clase contendrá dos métodos, el primero será para leer los valores: public string readIsOnlineSettings(string sectionToRead) { Configuration cfg = WebConfigurationManager.OpenWebConfiguration(System.Web.Hosting.HostingEnvironment.ApplicationVirtualPath); KeyValueConfigurationElement isOnlineSettings = (KeyValueConfigurationElement)cfg.AppSettings.Settings[sectionToRead]; return isOnlineSettings.Value; }   El segundo método, será el encargado de escribir los nuevos valores al web.config public bool saveIsOnlineSettings(string sectionToWrite, string value) { bool succesFullySaved;   try { Configuration cfg = WebConfigurationManager.OpenWebConfiguration(System.Web.Hosting.HostingEnvironment.ApplicationVirtualPath); KeyValueConfigurationElement repositorySettings = (KeyValueConfigurationElement)cfg.AppSettings.Settings[sectionToWrite];   if (repositorySettings != null) { repositorySettings.Value = value; cfg.Save(ConfigurationSaveMode.Modified); } succesFullySaved = true; } catch (Exception) { succesFullySaved = false; } return succesFullySaved; }   Por último, definiremos en nuestra clase una región llamada instance, que contendrá un método encargado de devolver una instancia de la clase (esto para no tener que hacerlo luego) #region instance   private static SettingsRules m_instance;   // Properties public static SettingsRules Instance { get { if (m_instance == null) { m_instance = new SettingsRules(); } return m_instance; } }   #endregion instance   Con esto, nuestra clase principal esta completa. Así que pasaremos a la implementación de las páginas y el resto de código que completará la funcionalidad.   Para complementar la tarea del web.config utilizaremos el fabuloso GLOBAL.ASAX, este contendrá el código encargado de detectar si nuestra aplicación tiene el valor de ONLINE o OFFLINE y además de bloquear todas las paginas y directorios excepto el que le hayamos definido como administrador, esto para luego poder volver a configurar el sitio.   El evento del Global.Asax que utilizaremos será el Application_BeginRequest   protected void Application_BeginRequest(Object sender, EventArgs e) {   if (Convert.ToBoolean(SettingsRules.Instance.readIsOnlineSettings("IsOffline"))) {   string Virtual = Request.Path.Substring(0, Request.Path.LastIndexOf("/") + 1);   if (Virtual.ToLower().IndexOf("/admin/") == -1) { //We don't makes action, is admin section Server.Transfer("~/TemporarilyOfflineMessage.aspx"); }   } } La primer Línea del IF, verifica si el atributo del web.config es True o False, si es true toma la dirección WEB que se ha solicitado y la incluimos en un IF para verificar si corresponde a la Sección admin (está sección no es mas que un folder en nuestra aplicación llamado admin y puede ser cambiado a cualquier otro). Si el resultado de ese if es –1 quiere decir que no coincide, entonces, esa será la bandera que nos permitirá bloquear inmediatamente la pagina actual, transfiriendo al usuario a una pagina de mantenimiento. Ahora, en nuestra carpeta Admin crearemos una nueva pagina asp.net llamada OnlineSettings.aspx para actualizar y leer los datos del web.config y una pagina Default.aspx para pruebas. Nuestra página OnlineSettings tendrá dos pasos importantes: 1. Leer los datos actuales de configuración protected void Page_Load(object sender, EventArgs e) { if (!IsPostBack) { IsOffline.Checked = Convert.ToBoolean(mySettings.readIsOnlineSettings("IsOffline")); OfflineMessage.Text = mySettings.readIsOnlineSettings("IsOfflineMessage"); } }   2. Actualizar los datos con los nuevos valores. protected void UpdateButton_Click(object sender, EventArgs e) { string htmlMessage = OfflineMessage.Text.Replace(Environment.NewLine, "<br />");   // Update the Application variables Application.Lock(); if (IsOffline.Checked) { mySettings.saveIsOnlineSettings("IsOffline", "True"); mySettings.saveIsOnlineSettings("IsOfflineMessage", htmlMessage); } else { mySettings.saveIsOnlineSettings("IsOffline", "false"); mySettings.saveIsOnlineSettings("IsOfflineMessage", htmlMessage); }   Application.UnLock(); }   Por último en la raíz de la aplicación, crearemos una nueva página aspx llamada TemporarilyOfflineMessage.aspx que será la que se muestre cuando se bloquee la aplicación. Al final nuestra aplicación se vería algo así Página bloqueada Configuración del Bloqueo Y para terminar la aplicación de ejemplo

    Read the article

  • Clarity is important, both in question and in answer.

    - by gerrylowry
    clarity is important ... i'm often reminded of the Clouseau movie in which Peter Sellers as Chief Inspector Clouseau asks a hotel clerk "Does your dog bite?" ... the clerk answers "no" ... after Clouseau has been bitten by the dog, he looks at the hotel clerk who says "That's not my dog".  Clarity is important, both in question and in answer. i've been a member of forums.asp.net since 2008 ... like many of my peers at forums.asp.net, i've answered my fair share of questions. FWIW, the purpose of this, my first web log post to http://weblogs.asp.net/gerrylowry is to help new members ask better questions and in turn get better answers. TIMTOWTDI  =.  there is more than one way to do it imho, the best way to ask a question in any forum, or even person to person, is to first formulate your question and then ask yourself to answer your own question. Things to consider when asking (the more complete your question, the more likely you'll get the answer you require): -- have you searched Google and/or your favourite search engine(s) before posting your question to forums.asp.net; examples: site:msdn.microsoft.com entity framework 5.0 c#http://lmgtfy.com/?q=site%3Amsdn.microsoft.com+entity+framework+5.0+c%23 site:forums.asp.net MVC tutorial c#http://lmgtfy.com/?q=site%3Aforums.asp.net+MVC+tutorial+c%23 -- are you asking your question in the correct forum?  look at the forums' descriptions at http://forums.asp.net/; examples: Getting Started If you have a general ASP.NET question on a topic that's not covered by one of the other more specific forums - ask it here. MVC Discussions regarding ASP.NET Model-View-Controller (MVC) C# Questions about using C# for ASP.NET development Note:  if your question pertains more to c# than to MVC, choosing the C# forum is likely to be more appropriate. -- is your post subject clear and concise, yet not too vague? compare these three subjects (all three had something to do with GridView):     (1)    please help     (2)    gridview      (3)    How to show newline in GridView  -- have you clearly explained your scenario? compare:  my leg hurts   with   when i walk too much, my right knee hurts in the knee joint  compare:  my code does not work    with    when i enter a date as 2012-11-8, i get a FormatException -- have you checked your spelling, your grammar, and your English? for better or worse, English is the language of forums.asp.net ... many of the currently 170000++ forums.asp.net are not native speakers of English; that's okay ... however, there are times when choosing the more appropriate words will likely get one a better answer; fortunately, there are web tools to help you formulate your question, for example, http://translate.google.com/.  -- have you provided relevant information about your environment? here are a few examples ... feel free to include other items to your question ... rule of thumb:  if you think a given detail is relevant, it likely is -- what technology are you using?    ASP.NET MVC 4, ASP.NET MVC 3, WebForms, ...  -- what version of Visual Studio are you using?  vs2012 (ultimate, professional, express), vs2010, vs2008 ... -- are you hosting your own website?  are you using a shared hosting service? -- are you experience difficulties in just one browser? more than one browser? -- what browser version(s) are you using?   ie8? ie9? ... -- what is your operating system?     win8, win7, vista, XP, server 2008 R2 ... -- what is your database?   SQL Server 2008 R2, ss2005, MySQL, Oracle, ... -- what is your web server?  iis 7.5, iis 6, .... -- have you provided enough information for someone to be able to answer your question? Here's an actual example from an O.P. that i hope is self-explanatory: I'm trying to make a simple calculator when i write the code in windows application it worked when i tried it in web application it doesn't work and there are no errors what should i do ??!! -- have you included unnecessary information? more than once, i've seen the O.P. (original post, original poster) include many extra lines of code that were not relevant to the actual question; the more unnecessary code that you include, the less likely your volunteer peers will be motivated to donate their time to help you. -- have you asked the question that you want answered? "Does this dog bite?" -- are your expectations reasonable? -- generally, persons who are going to answer your questions are your peers ... they are unpaid volunteers ... -- are you looking for help with your homework, work assignment, or hobby? or, are you expecting someone else to do your work for you?  -- do you expect a complete solution or are you simply looking for guidance and direction? -- you are likely to get more help by first making a reasonable effort to help yourself first Clarity is important, both in question and in answer. if you are answering someone else's question, please remember that clear answers are just as important as clear questions; would you understand your own answer? Things to consider when answering: -- have you tested your code example?  if you have, say so; if you've not tested your code example, also say so -- imho, it's okay to guess as long as you clearly state that you're guessing ... sometimes a wrong guess can still help the O.P. find her/his way to the right answer -- meanness does not contribute to being helpful; sometimes one may become frustrated with the O.P. and/or others participating in a thread, if that happens to you, be kind regardless; speaking from my own experience, at least once i've allowed myself to be frustrated into writing something inappropriate that i've regretted later ... being a meany does not feel good ... being kind and helpful feels fantastic! Tip:  before asking your question, read more than a few existing questions and answers to get a sense of how your peers ask and answer questions. Gerry P.S.:  try to avoid necroposting and piggy backing. necroposting is adding to an old post, especially one that was resolved months ago. piggy backing is adding your own question to someone else's thread.

    Read the article

< Previous Page | 20 21 22 23 24 25 26  | Next Page >