Search Results

Search found 7529 results on 302 pages for 'replace'.

Page 244/302 | < Previous Page | 240 241 242 243 244 245 246 247 248 249 250 251  | Next Page >

  • Syntax Error? When parsing XML value

    - by Ace Munim
    I don't know if I'm having a syntax error but the compiler is giving me TypeError: 'undefined' is not an object (evaluating 'xmlDoc.getElementsByTagName("icon")[i].childNodes') Its me giving me this problem when im parsing the XML from my server, my actual javascript code is like this var xmlDoc = Obj.responseXML; var count = 0; if(xmlDoc){ while(count <= xmlDoc.getElementsByTagName("item").length){ document.getElementById("flow").innerHTML += "<div class='item'><img class='content' src='" + xmlDoc.getElementsByTagName("icon")[i].childNodes[0].nodeValue.replace(/\s+$/g,' ') +"' /></div>"; count++; } }else{ alert("Unable to parse!"); } and my XML goes like this. <feed> <item> <title>Given Title</title> <icon> http://i178.photobucket.com/albums/w255/ace003_album/Logo-ETC-RGB-e1353503652739.jpg </icon> </item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> </feed> i just want to parse the image link and to show it.

    Read the article

  • Alternative to using c:out to prevent XSS

    - by lynxforest
    I'm working on preventing cross site scripting (XSS) in a Java, Spring based, Web application. I have already implemented a servlet filter similar to this example http://greatwebguy.com/programming/java/simple-cross-site-scripting-xss-servlet-filter/ which sanitizes all the input into the application. As an extra security measure I would like to also sanitize all output of the application in all JSPs. I have done some research to see how this could be done and found two complementary options. One of them is the use of Spring's defaultHtmlEscape attribute. This was very easy to implement (a few lines in web.xml), and it works great when your output is going through one of spring's tags (ie: message, or form tags). The other option I have found is to not directly use EL expressions such as ${...} and instead use <c:out value="${...}" /> That second approach works perfectly, however due to the size of the application I am working on (200+ JSP files). It is a very cumbersome task to have to replace all inappropriate uses of EL expressions with the c:out tag. Also it would become a cumbersome task in the future to make sure all developers stick to this convention of using the c:out tag (not to mention, how much more unreadable the code would be). Is there alternative way to escape the output of EL expressions that would require fewer code modifications? Thank you in advance.

    Read the article

  • How to get the most out of a 3 month intern?

    - by firoso
    We've got a software engineering intern coming in who's fairly competent and shows promise. There's one catch: we have him for 3 months full time and can't count on anything past that. He still has a year of school left, which is why we can't say for sure that we have him past 3 months. We have a specific project we're putting him on. How can we maximize his productivity while still giving him a positive learning experience? He wants to learn about development cycles and real-world software engineering. Anything that you think would be critical that you wish you had learned earlier? Nearly six months later: He's preformed admirably and even I have learned a lot from him. Thank you all for the input. Now I want to provide feedback to YOU! He has benefited most from sitting down and writing code. However, he has had a nasty history of bad software engineering practices which I'm trying to replace with good habits (properly finishing a method before moving on, not hacking code together, proper error channeling, etc). He has also really gained a lot by feeling involved in design decisions, even if most of the time they're related to my own design plans.

    Read the article

  • Silverlight Socket Constantly Returns With Empty Buffer

    - by Benny
    I am using Silverlight to interact with a proxy application that I have developed but, without the proxy sending a message to the Silverlight application, it executes the receive completed handler with an empty buffer ('\0's). Is there something I'm doing wrong? It is causing a major memory leak. this._rawBuffer = new Byte[this.BUFFER_SIZE]; SocketAsyncEventArgs receiveArgs = new SocketAsyncEventArgs(); receiveArgs.SetBuffer(_rawBuffer, 0, _rawBuffer.Length); receiveArgs.Completed += new EventHandler<SocketAsyncEventArgs>(ReceiveComplete); this._client.ReceiveAsync(receiveArgs); if (args.SocketError == SocketError.Success && args.LastOperation == SocketAsyncOperation.Receive) { // Read the current bytes from the stream buffer int bytesRecieved = this._client.ReceiveBufferSize; // If there are bytes to process else the connection is lost if (bytesRecieved > 0) { try { //Find out what we just received string messagePart = UTF8Encoding.UTF8.GetString(_rawBuffer, 0, _rawBuffer.GetLength(0)); //Take out any trailing empty characters from the message messagePart = messagePart.Replace('\0'.ToString(), ""); //Concatenate our current message with any leftovers from previous receipts string fullMessage = _theRest + messagePart; int seperator; //While the index of the seperator (LINE_END defined & initiated as private member) while ((seperator = fullMessage.IndexOf((char)Messages.MessageSeperator.Terminator)) > 0) { //Pull out the first message available (up to the seperator index string message = fullMessage.Substring(0, seperator); //Queue up our new message _messageQueue.Enqueue(message); //Take out our line end character fullMessage = fullMessage.Remove(0, seperator + 1); } //Save whatever was NOT a full message to the private variable used to store the rest _theRest = fullMessage; //Empty the queue of messages if there are any while (this._messageQueue.Count > 0) { ... } } catch (Exception e) { throw e; } // Wait for a new message if (this._isClosing != true) Receive(); } } Thanks in advance.

    Read the article

  • Compilation errors calling find_if using a functor

    - by Jim Wong
    We are having a bit of trouble using find_if to search a vector of pairs for an entry in which the first element of the pair matches a particular value. To make this work, we have defined a trivial functor whose operator() takes a pair as input and compares the first entry against a string. Unfortunately, when we actually add a call to find_if using an instance of our functor constructed using a temporary string value, the compiler produces a raft of error messages. Oddly (to me, anyway), if we replace the temporary with a string that we've created on the stack, things seem to work. Here's what the code (including both versions) looks like: typedef std::pair<std::string, std::string> MyPair; typedef std::vector<MyPair> MyVector; struct MyFunctor: std::unary_function <const MyPair&, bool> { explicit MyFunctor(const std::string& val) : m_val(val) {} bool operator() (const MyPair& p) { return p.first == m_val; } const std::string m_val; }; bool f(const char* s) { MyFunctor f(std::string(s)); // ERROR // std::string str(s); // MyFunctor f(str); // OK MyVector vec; MyVector::const_iterator i = std::find_if(vec.begin(), vec.end(), f); return i != vec.end(); } And here's what the most interesting error message looks like: /usr/include/c++/4.2.1/bits/stl_algo.h:260: error: conversion from ‘std::pair, std::allocator , std::basic_string, std::allocator ’ to non-scalar type ‘std::string’ requested Because we have a workaround, we're mostly curious as to why the first form causes problems. I'm sure we're missing something, but we haven't been able to figure out what it is.

    Read the article

  • radio input replacement using jquery

    - by altvali
    It may seem a bit odd to ask this since there are several solutions out there but the fact is that all of them look pretty and none of what i've seem save the input value for form submission the right way. I'm looking for something that will replace all radio inputs with divs that get special classes when they are hovered or clicked, and an input type hidden for every group of radio inputs with the same name, hidden input that will be updated with the value corresponding to the div the user clicks on. Long sentence, i know. Here's what i've come up with: $('input:radio').each(function(){ if (this.style.display!='none') { var inputName = $(this).attr('name'); var inputValue = $(this).attr('value'); var isChecked = $(this).attr('checked'); if (!$('input:hidden[name='+inputName+']').length) // if the hidden input wasn't already created $(this).replaceWith('<div class="inputRadioButton" id="'+inputName+'X'+inputValue+'"></div><input type="hidden" name="'+inputName+'" value="'+inputValue+'" />'); else{ $(this).replaceWith('<div class="inputRadioButton" id="'+inputName+'X'+inputValue+'"></div>'); if (isChecked) $('input:hidden[name='+inputName+']').attr({'value':inputValue}); } //this bind doesn't work $("#"+inputName+"X"+inputValue).click(function(){ if($('input:hidden[name='+inputName+']').val()!=inputValue){ $('input:hidden[name='+inputName+']').attr({'value':inputValue}); $('div[id*='+inputName+'].inputRadioButton').removeClass('inputRadioButtonSelected'); } if (!$("#"+inputName+"X"+inputValue).hasClass('inputRadioButtonSelected')) $("#"+inputName+"X"+inputValue).addClass('inputRadioButtonSelected'); }); } }); Please tell me how to fix it. Thank you. Edit I've found the reason. It should normally work but some of my radio inputs generated by an e-commerce software had brackets in them (e.g. id[12] ) and jQuery was parsing that. The fix is adding var inputButton = document.getElementById(inputName+"X"+inputValue); before the bind and replacing $("#"+inputName+"X"+inputValue) with $(inputButton).

    Read the article

  • Dice Emulation - ImageView

    - by Michelle Harris
    I am trying to emulate dice using ImageView. When I click the button, nothing seems to happen. I have hard coded this example to replace the image with imageView4 for debugging purposes (I was making sure the random wasn't fail). Can anyone point out what I am doing wrong? I am new to Java, Eclipse and Android so I'm sure I've probably made more than one mistake. Java: import java.util.Random; import android.app.Activity; import android.os.Bundle; import android.view.View; import android.widget.ArrayAdapter; import android.widget.ImageView; import android.widget.Spinner; import android.widget.Toast; public class Yahtzee4Activity extends Activity { /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); Spinner s = (Spinner) findViewById(R.id.spinner); ArrayAdapter adapter = ArrayAdapter.createFromResource( this, R.array.score_types, android.R.layout.simple_spinner_dropdown_item); adapter.setDropDownViewResource(android.R.layout.simple_spinner_dropdown_item); s.setAdapter(adapter); } public void onMyButtonClick(View view) { ImageView imageView1 = new ImageView(this); Random rand = new Random(); int rndInt = 4; //rand.nextInt(6) + 1; // n = the number of images, that start at index 1 String imgName = "die" + rndInt; int id = getResources().getIdentifier(imgName, "drawable", getPackageName()); imageView1.setImageResource(id); } } XML for the button: <Button android:id="@+id/button_roll" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/roll" android:onClick="onMyButtonClick" />

    Read the article

  • performSelector:withObject:afterDelay: not working from scrollViewDidZoom

    - by oldbeamer
    Hi all, I feel like I should know this but I've been stumped for hours now and I've run out of ideas. The theory is simple, the user manipulates the zoom and positioning in a scrollview using a pinch. If they hold that pinch for a short period of time then the scrollview records the zoom level and content offsets. So I thought I'd start a performSelector:withObject:withDelay on the scrollViewDidZoom delegate method. If it expires then I record the settings. I delete the scheduled call every time scrollViewDidZoom is called and when the pinch gesture finishes. This is what I have: - (void)scrollViewDidZoom:(UIScrollView *)scrollView{ NSLog(@"resetting timer"); [NSObject cancelPreviousPerformRequestsWithTarget:self selector:@selector(positionLock) object:nil]; [self performSelector:@selector(positionLock) withObject:nil afterDelay:0.4]; } -(void)positionLock{ NSLog(@"position locked "); } - (void)scrollViewDidEndZooming:(UIScrollView *)scrollView withView:(UIView *)view atScale:(float)scale{ NSLog(@"deleting timer"); [NSObject cancelPreviousPerformRequestsWithTarget:self selector:@selector(positionLock) object:nil]; } This is the output: 2010-05-19 22:43:01.931 resetting timer 2010-05-19 22:43:01.964 resetting timer 2010-05-19 22:43:02.231 resetting timer 2010-05-19 22:43:02.253 resetting timer 2010-05-19 22:43:02.269 resetting timer 2010-05-19 22:43:02.298 resetting timer 2010-05-19 22:43:05.399 deleting timer As you can see the delay between the last and second last events should have been more than enough for the delayed selector call to execute. If I replace performSelector:withObject:withDelay with plain old performSelector: I get this: 2010-05-19 23:08:30.333 resetting timer 2010-05-19 23:08:30.333 position locked 2010-05-19 23:08:30.366 resetting timer 2010-05-19 23:08:30.367 position locked 2010-05-19 23:08:30.688 deleting timer Which isn't what I want but serves to show that it's only the delay that's causing it to not function, not something to do with the selector not being declared in the header, being misspelt or any other reason. Any ideas as to why it's not working?

    Read the article

  • Old dll.config problem !

    - by user313421
    Since 2005 as I googled it's a problem for who needs to read the configuration of an assembly from it's config file "*.dll.config" and Microsoft didn't do anything yet. Story: If you try to read a setting from a class library (plug-in) you fail. Instead the main application domain (EXE which is using the plug-in) config is read and because probably there's not such a config your plug-in will use default setting which is hard-coded when you create it's settings for first time. Any change to .dll.config wouldn't see by your plug-in and you wonder why it's there! If you want to replace it and start searching you may find something like this: http://stackoverflow.com/questions/594298/c-dll-config-file But just some ideas and one line code. A good replacement for built-in config shouldn't read from file system each time we need a config value, so we can store them in memory; Then what if user changes config file ? we need a FileSystemWatcher and we need some design like singleton ... and finally we are at the same point configuration of .NET is except our one's working. It seems MS did everything but forgot why they built the ".dll.config". Since no DLL is gonna execute by itself, they are referenced from other apps (even if used in web) and so why there's such a "*.dll.config" file ? I'm not gonna argue if it's good to have multiple config files or not. It's my design (plug-able components). Finally { After these years, is there any good practice such as a custom setting class to add in each assemly and read from it's own config file ? }

    Read the article

  • Why can't I roll a loop in Javascript?

    - by Carl Manaster
    I am working on a web page that uses dojo and has a number (6 in my test case, but variable in general) of project widgets on it. I'm invoking dojo.addOnLoad(init), and in my init() function I have these lines: dojo.connect(dijit.byId("project" + 0).InputNode, "onChange", function() {makeMatch(0);}); dojo.connect(dijit.byId("project" + 1).InputNode, "onChange", function() {makeMatch(1);}); dojo.connect(dijit.byId("project" + 2).InputNode, "onChange", function() {makeMatch(2);}); dojo.connect(dijit.byId("project" + 3).InputNode, "onChange", function() {makeMatch(3);}); dojo.connect(dijit.byId("project" + 4).InputNode, "onChange", function() {makeMatch(4);}); dojo.connect(dijit.byId("project" + 5).InputNode, "onChange", function() {makeMatch(5);}); and change events for my project widgets properly invoke the makeMatch function. But if I replace them with a loop: for (var i = 0; i < 6; i++) dojo.connect(dijit.byId("project" + i).InputNode, "onChange", function() {makeMatch(i);}); same makeMatch() function, same init() invocation, same everything else - just rolling my calls up into a loop - the makeMatch function is never called; the objects are not wired. What's going on, and how do I fix it? I've tried using dojo.query, but its behavior is the same as the for loop case.

    Read the article

  • Free solution for automatic updates with .NET/C#?

    - by a2h
    Yes, from searching I can see this has been asked time and time again. Here's a backstory. I'm an individual hobbyist developer with zero budget. A program I've been developing has been in need of constant bugfixes, and me and users are getting tired of having to manually update. Me, because my current solution of Manually FTP to my website Update a file "newest.txt" with the newest version Update index.html with a link to the newest version Hope for people to see the "there's an update" message Have them manually download the update sucks, and whenever I screw up an update, I get pitchforks. Users, because, well, "Are you ever going to implement auto-update?" "Will there ever be an auto-update feature?" Over the past few hours I have looked into: http://windowsclient.net/articles/appupdater.aspx - I can't comprehend the documentation http://www.codeproject.com/KB/vb/Auto_Update_Revisited.aspx - Doesn't appear to support anything other than working with files that aren't in use http://wyday.com/wyupdate/ - wyBuild isn't free, and the file specification is simply too complex. Maybe if I was under a company paying me I could spend the time, but then I may as well pay for wyBuild. http://www.kineticjump.com/update/default.aspx - Ditto. ClickOnce - Workarounds for implementing launching on startup are massive, horrendous and not worth it for such a simple feature. Publishing is a pain; manual FTP and replace of all files is required for servers without FrontPage Extensions. I'm pretty much ready to throw in the towel right now and strangle myself. And then I think about Sparkle...

    Read the article

  • sql server mdf file database attachment

    - by jnsohnumr
    hello all i'm having a bear of a time getting visual studio 2010 (ultimate i think) to properly attach to my database. it was moved from original spot to #MYAPP#/#MYAPP#.Web/App_Data/#MDF_FILE#.mdf. I have three instances of sql server running on this machine. i have tried to replace the old mdf file with my new one and cannot get the connectionstring right for it. what i'm really wanting to do is to just open some DB instance, run a DB create script. Then I can have a DB that was generated via my edmx (generate database from model) in silverlight business application (c#) right now, when i go to server explorer in VS, choose add new connection, choose MS SQL Server Database FIle (SqlClient), choose my file location (app_data directory), use windows authentication, and hit the Test Connection button I get the following error: Unable to open the physical file "". Operating system error 5: "5(Access Denied.)". An attempt to attach to an auto-named database for file"" failed. A database with the same name exists, or specified file cannot be opened, or it is located on UNC share. The mdf file was created on the same machine by connecting to (local) on the sql server management studio, getting a new query, pasting in the SQL from the generated ddl file, adding a CREATE DATABASE [NcrCarDatabase]; GO before the pasted SQL, and executing the query. I then disconnected from the DB in management studio, closed management studio, navigated to the DATA directory for that instance, and copying the mdf and ldf files to my application's app_data folder. I am then trying to connect to the same file inside visual studio. I hope that gives more clarity to my problems :). Connection string is: Data Source=.\SQLEXPRESS;AttachDbFilename=C:\SourceCode\NcrCarDatabase\NcrCarDatabase.Web\App_Data\NcrCarDatabase.mdf;Integrated Security=True;Connect Timeout=30;User Instance=True

    Read the article

  • Are function-local typedefs visible inside C++0x lambdas?

    - by GMan - Save the Unicorns
    I've run into a strange problem. The following simplified code reproduces the problem in MSVC 2010 Beta 2: template <typename T> struct dummy { static T foo(void) { return T(); } }; int main(void) { typedef dummy<bool> dummy_type; auto x = [](void){ bool b = dummy_type::foo(); }; // auto x = [](void){ bool b = dummy<bool>::foo(); }; // works } The typedef I created locally in the function doesn't seem to be visible in the lambda. If I replace the typedef with the actual type, it works as expected. Here are some other test cases: // crashes the compiler, credit to Tarydon int main(void) { struct dummy {}; auto x = [](void){ dummy d; }; } // works as expected int main(void) { typedef int integer; auto x = [](void){ integer i = 0; }; } I don't have g++ 4.5 available to test it, right now. Is this some strange rule in C++0x, or just a bug in the compiler? From the results above, I'm leaning towards bug. Though the crash is definitely a bug. For now, I have filed two bug reports. All code snippets above should compile. The error has to do with using the scope resolution on locally defined scopes. (Spotted by dvide.) And the crash bug has to do with... who knows. :) Update According to the bug reports, they have both been fixed for the next release of Visual Studio 2010.

    Read the article

  • asp.net mvc ajax helper/post additional data w/o jquery.

    - by Jopache
    I would like to use the ajax helper to create ajax requests that send additional, dynamic data with the post (for example, get the last element with class = blogCommentDateTime and send the value of that last one to the controller which will return only blog comments after it). I have successfully done so with the help of jQuery Form plugin like so: $(document).ready(function () { $("#addCommentForm").submit(function () { var lastCommentDate = $(".CommentDateHidden:last").val(); var lastCommentData = { lastCommentDateTicks: lastCommentDate }; var formSubmitParams = { data: lastCommentData, success: AddCommentResponseHandler } $("#addCommentForm").ajaxSubmit(formSubmitParams); return false; }); This form was created with html.beginform() method. I am wondering if there is an easy way to do this using the ajax.beginform() helper? When I try to use the same code but replace html.beginform() with ajax.beginform(), when i try to submit the form, I am issuing 2 posts (which is understandable, one being taken care of by the helper, the other one by me with the JS above. I can't create 2 requests, so this option is out) I tried getting rid of the return false and changing ajaxSubmit() to ajaxForm() so that it would only "prepare" the form, and this leads in only one post, but it does not include the extra parameter that I defined, so this is worthless as well. I then tried keeping the ajaxForm() but calling that whenever the submit button on the form gets clicked rather than when the form gets submitted (I guess this is almost the same thing) and that results in 2 posts also. The biggest reason I am asking this question is that I have run in to some issues with the javascript above and using mvc validation provided by the mvc framework (which i will set up another question for) and would like to know this so I can dive further in to my validation issue.

    Read the article

  • Advance: Parsing XML into another XML page using only javascript or jquery; Can't use PhP, Java or MySQL

    - by UrBestFriend
    Current site: http://cardwall.tk/ Example of intended outcome: http://www.shockwave.com/downloadWall.jsp I have an embeded flash object that uses XML/RSS (Picasa) to feed itself pictures. Now I created my own XML/RSS feed so that I can add additional XML tags and values. Now here's my big problem: enabling search. Since I'm not relying on Picasa's API anymore to return custom RSS/XML for the user's search, how can I create xml from another xml based on the user's search queries using only JavaScript and Jquery? Here is the current code: <script type="text/javascript"> var flashvars = { feed : "http%3A%2F%2Frssfeed.ucoz.com%2Frssfeed.xml", backgroundColor : "#FFFFFF", metadataFont : "Arial", wmode : "opaque", iFrameScrolling: "no", numRows : "3", }; var params = { allowFullScreen: "true", allowscriptaccess : "always", wmode: "opaque" }; swfobject.embedSWF("http://apps.cooliris.com/embed/cooliris.swf", "gamewall", "810", "410", "9.0.0", "", flashvars, params); $(document).ready(function() { $("#cooliris input").keydown(function(e) { if(e.keyCode == 13) { $("#cooliris a#searchCooliris").click(); return false; } }); doCoolIrisSearch = function() { cooliris.embed.setFeedContents( '** JAVA STRING OF PARSED RSS/XML based on http%3A%2F%2Frssfeed.ucoz.com%2Frssfeed.xml and USER'S SEARCH INPUT** ' ) }); <form id="searchForm" name="searchForm" class="shockwave"> <input type="text" name="coolIrisSearch" id="coolIrisSearch" value="Search..." class="field text short" onfocus="this.value='';" /> <a id="searchCooliris" href="#" onclick="doCoolIrisSearch();return false;" class="clearLink">Search Cooliris</a> </form> <div id="gamewall"></div> So basically, I want to replace cooliris.embed.setFeedContents's value with a Javastring based on the parsed RSS/XML and user search input. Any code or ideas would be greatly appreciated.

    Read the article

  • Alternative or succesor to GDBM

    - by Anon Guy
    We a have a GDBM key-value database as the backend to a load-balanced web-facing application that is in implemented in C++. The data served by the application has grown very large, so our admins have moved the GDBM files from "local" storage (on the webservers, or very close by) to a large, shared, remote, NFS-mounted filesystem. This has affected performance. Our performance tests (in a test environment) show page load times jumping from hundreds of milliseconds (for local disk) to several seconds (over NFS, local network), and sometimes getting as high as 30 seconds. I believe a large part of the problem is that the application makes lots of random reads from the GDBM files, and that these are slow over NFS, and this will be even worse in production (where the front-end and back-end have even more network hardware between them) and as our database gets even bigger. While this is not a critical application, I would like to improve performance, and have some resources available, including the application developer time and Unix admins. My main constraint is time only have the resources for a few weeks. As I see it, my options are: Improve NFS performance by tuning parameters. My instinct is we wont get much out of this, but I have been wrong before, and I don't really know very much about NFS tuning. Move to a different key-value database, such as memcachedb or Tokyo Cabinet. Replace NFS with some other protocol (iSCSI has been mentioned, but i am not familiar with it). How should I approach this problem?

    Read the article

  • Problem with UPDATE statement in stored-procedure in Oracle Database

    - by MKP
    Hello, I have stored-procedure in Oracle database like this: create or replace PROCEDURE EDYTUJ_PRACOWNIKA (PR_IMIE IN VARCHAR2, PR_NAZWISKO IN VARCHAR2, PR_PENSJA IN FLOAT, PR_PRZELOZONY IN NUMBER, PR_ODDZIAL IN NUMBER, PRAC_ID IN NUMBER) AS tmpPensja FLOAT := 0; tmpPrzel NUMBER := 0; BEGIN select przelozony into tmpPrzel from pracownik where id = PRAC_ID; IF(tmpPrzel IS NOT NULL) THEN select pensja into tmpPensja from pracownik where id = tmpPrzel; IF(tmpPensja < 1150) THEN UPDATE PRACOWNIK SET pensja = 1000 WHERE id = tmpPrzel; ELSE UPDATE PRACOWNIK SET pensja = pensja - 150 WHERE id = tmpPrzel; (4) END IF; END IF; IF(PR_PRZELOZONY > 0) THEN UPDATE PRACOWNIK SET imie = PR_IMIE, nazwisko = PR_NAZWISKO, pensja = PR_PENSJA, przelozony = PR_PRZELOZONY, oddzial = PR_ODDZIAL WHERE id = PRAC_ID; (2) select pensja into tmpPensja from pracownik where id = PR_PRZELOZONY; IF(tmpPensja > 4850) THEN UPDATE PRACOWNIK SET pensja = 5000 WHERE id = PR_PRZELOZONY; ELSE UPDATE PRACOWNIK SET pensja = pensja + 150 WHERE id = PR_PRZELOZONY; (1) END IF; ELSE UPDATE PRACOWNIK SET imie = PR_IMIE, nazwisko = PR_NAZWISKO, pensja = PR_PENSJA, przelozony = NULL, oddzial = PR_ODDZIAL WHERE ID = PRAC_ID; (3) END IF; END; where przelozony and pensja are columns in pracownik table. And I have problem that when running procedure with parameters that provide that line marked with "(1)" (there is the same problem with line marked with "(4)") should be executed that update statement don't have any effect. What's more statements in lines marked with "(2)" and "(3)" works fine. I have no ideas how to fix it. Thank you in advance for your help.

    Read the article

  • What VC++ compiler/linker does when building a C++ project with Managed Extension

    - by ???
    The initial problem is that I tried to rebuild a C++ project with debug symbols and copied it to test machine, The output of the project is external COM server(.exe file). When calling the COM interface function, there's a RPC call failre: COMException(0x800706BE): The remote procedure call failed. According to the COM HRESULT design, if the FACILITY code is 7, it's actually a WIN32 error, and the win32 error code is 0x6BE, which is the above mentioned "remote procedure call failed". All I do is replace the COM server .exe file, the origin file works well. When I checked into the project, I found it's a C++ project with Managed Extension. When I checking the DLL with reflector, it shows there's 2 additional .NET assembly reference. Then I checked the project setting and found nothing about the extra 2 assembly reference. I turned on the show includes option of compiler and verbose library of linker, and try to analyze whether the assembly is indirectly referenced via .h file. I've collect all the .h file and grep all the files with '#using' '#import' and the assembly file itself. There really is a '#using ' in one of the .h file but not-relevant to the referenced assembly. And about the linked .lib library files, only one of the .lib file is a side-product of another managed-extension-enabled C++ project, all others are produced by a pure, traditional C++ project. For the managed-extension-enabled C++ project, I checked the output DLL assembly, it did NOT reference to the 2 assembly. I even try to capture the access of the additional assembly file via sysinternal's filemon and procmon, but the rebuild process does NOT access these file. I'm very confused about the compile and linking process model of a VC++/CLI project, where the additional assembly reference slipped into the final assembly? Thanks in advance for any of your help.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • nServiceBus - Not all commands being received by handler

    - by SimonB
    In a test project based of the nServiceBus pub/sub sample, I've replace the bus.publish with bus.send in the server. The server sends 50 messages with a 1sec wait after each 5 (ie 10 burst of 5 messages). The client does not get all the messages. The soln has 3 projects - Server, Client, and common messages. The server and client are hosted via the nServiceBus generic host. Only a single bus is defined. Both client and server are configured to use StructureMap builder and BinarySerialisation. Server Endpoint: public class EndPointConfig : AsA_Publisher, IConfigureThisEndpoint, IWantCustomInitialization { public void Init() { NServiceBus.Configure.With() .StructureMapBuilder() .BinarySerializer(); } } Server Code : for (var nextId = 1; nextId <= 50; nextId++) { Console.WriteLine("Sending {0}", nextId); IDataMsg msg = new DataMsg { Id = nextId, Body = string.Format("Batch Msg #{0}", nextId) }; _bus.SendLocal(msg); Console.WriteLine(" ...sent {0}", nextId); if ((nextId % 5) == 0) Thread.Sleep(1000); } Client Endpoint: public class EndPointConfig : AsA_Client, IConfigureThisEndpoint, IWantCustomInitialization { public void Init() { NServiceBus.Configure.With() .StructureMapBuilder() .BinarySerializer(); } } Client Clode: public class DataMsgHandler : IMessageHandler<IDataMsg> { public void Handle(IDataMsg msg) { Console.WriteLine("DataMsgHandler.Handle({0}, {1}) - ({2})", msg.Id, msg.Body, Thread.CurrentThread.ManagedThreadId); } } Client and Server App.Config: <MsmqTransportConfig InputQueue="nsbt02a" ErrorQueue="error" NumberOfWorkerThreads="1" MaxRetries="5" /> <UnicastBusConfig DistributorControlAddress="" DistributorDataAddress=""> <MessageEndpointMappings> <add Messages="Test02.Messages" Endpoint="nsbt02a" /> </MessageEndpointMappings> </UnicastBusConfig> All run via VisualStudio 2008. All 50 messages are sent - but after the 1st or 2nd batch. only 1 msg per batch is sent? Any ideas? I'm assuming config or misuse but ....?

    Read the article

  • Possible to write an Extension Method for ASP.NET's Html.ActionLink() method?

    - by Pretzel
    Right now, I'm trying to work around an IE6/7 bug which requires the wrapping of the </a closing tag with this IE specific comment to make some drop-down menu work: <!--[if IE 7]><!--></a><!--<![endif]--> Unfortunately, I cannot inject this directly into my View page code like this: <%= Html.ActionLink("LinkName<!--[if IE 7]><!--></a><!--<![endif]-->","Action","Controller") %> As Html.ActionLink will do the safe thing and filter out the comment to prevent a Javascript injection attack. Ok, cool. I'm fine with that. Good design decision. What I'd like to do is write an Extension Method to this, but the process is eluding me as I haven't done this before. I thought this would work, but Intellisense doesn't seem to be picking up this Extension method that I've written. public static class MyLinkExtensions { public static string ActionLinkIE(this HtmlHelper htmlHelper, string linkText, string actionName, string controllerName) { return LinkExtensions.ActionLink(htmlHelper, linkText, actionName, controllerName). Replace(@"</a>", @"<!--[if IE 7]><!--></a><!--<![endif]-->"); } } Any suggestions?

    Read the article

  • jQuery AJAX Redirection problem

    - by meosoft
    Hello please consider this: On page A I have a link that takes you to page B when JS is off, but when JS is on, I want to replace content on current page with content from the page B. Pages A and B are in fact the same script that is able to tell AJAX calls from regular ones and serve the content appropriately. Everything works fine, as long as there are no redirects involved. But, sometimes there is a 301 redirect and what seems to be happening is that client browser then makes a second request, which will return with a 200 OK. Only the second request is sent without a X-Requested-With header, therefore I cannot tell within my script wether it came from AJAX or not, and will send a complete page instead of just the content. I have tried checking for 301 status code in my error, success, and complete handlers but none of them worked. It seems to be handling the 301 behind the scenes. Could anyone help me with this? jQuery 1.4, PHP 5 Edit: People requested the code to this, which I didn't think was necessary but here goes: // hook up menu ajax loading $('#menu a').live("click", function(){ // update menu highlight if($(this).parents('#menu').size() > 0){ $("#menu>li").removeClass("current_page_item"); $(this).parent().addClass("current_page_item"); } // get the URL where we will be retrieving content from var url = $(this).attr('href'); window.location.hash = hash = url; $.ajax({ type: "GET", url: url, success: function(data){ // search for an ID that is only present if page is requested directly if($(data).find('#maincontent').size() > 0){ data = $(data).find('#maincontent .content-slide *').get(); } // the rest is just animating the content into view $("#scroller").html(data); $('.content-slide').each(setHeight); $('.content-slide').animate({ left: "0px" }, 1000, 'easeOutQuart', function(){ $('#home').css("left", "-760px").html(data); $('#scroller').css("left", "-760px"); $('.content-slide').each(setHeight); } ); } }); return false; });

    Read the article

  • is using private shared objects/variables on class level harmful ?

    - by haansi
    Hello, Thanks for your attention and time. I need your opinion on an basic architectural issue please. In page behind classes I am using a private and shared object and variables (list or just client or simplay int id) to temporary hold data coming from database or class library. This object is used temporarily to catch data and than to return, pass to some function or binding a control. 1st: Can this approach harm any way ? I couldn't analyze it but a thought was using such shared variables may replace data in it when multiple users may be sending request at a time? 2nd: Please comment also on using such variables in BLL (to hold data coming from DAL/database). In this example every time new object of BLL class will be made. Here is sample code: public class ClientManager { Client objclient = new Client(); //Used in 1st and 2nd method List<Client> clientlist = new List<Client>();// used in 3rd and 4th method ClientRepository objclientRep = new ClientRepository(); public List<Client> GetClients() { return clientlist = objclientRep.GetClients(); } public List<Client> SearchClients(string Keyword) { return clientlist = objclientRep.SearchClients(Keyword); } public Client GetaClient(int ClientId) { return objclient = objclientRep.GetaClient(ClientId); } public Client GetClientDetailForConfirmOrder(int UserId) { return objclientRep.GetClientDetailForConfirmOrder(UserId); } } I am really thankful to you for sparing time and paying kind attention.

    Read the article

  • How to remove a specific category on a selected mail in Outlook 2003 with Macro?

    - by szekelya
    Hi, I am trying to transform my Outlook2003 into the closest thing to gmail. I started to use categories, which are pretty similar to labels in gmail. I can assign categories automatically with rules, and I can add categories manually. I have also created "search folders", that show all mails with a given category, if they are not in the Deleted Items or Sent Items folders. This part is almost like the Label views in gmail. Two things are missing basically, which should be done with macros (VBA to be precise) which I'm totally inexperienced with. So hence my questions: -Can someone show me a macro to remove the category "Inbox"? That would act exactly like the Archive button in gmail. In fact I want to assign this macro to a toolbar button and call it Archive. I have a rule that adds the Inbox category to all incoming mail. As I said, I have a search folder displaying all mails categorized as Inbox, and I also have an All Mail search folder, that displays all messages regardless whether they have the Inbox category. Exactly like gmail, just the easy archiving is missing. -Can someone show me a macro that would delete the selected mail/mails and also would remove the Inbox category before deletion? I would replace the default delete button with this macro. (Somewhat less important, as in my search folders I can filter messages that are physically placed in the Deleted Items folder, but it would be more elegant not to have mails categorized as Inbox in the trash. Many thanks in advance, szekelya

    Read the article

  • array of structures, or structure of arrays?

    - by Jason S
    Hmmm. I have a table which is an array of structures I need to store in Java. The naive don't-worry-about-memory approach says do this: public class Record { final private int field1; final private int field2; final private long field3; /* constructor & accessors here */ } List<Record> records = new ArrayList<Record>(); If I end up using a large number ( 106 ) of records, where individual records are accessed occasionally, one at a time, how would I figure out how the preceding approach (an ArrayList) would compare with an optimized approach for storage costs: public class OptimizedRecordStore { final private int[] field1; final private int[] field2; final private long[] field3; Record getRecord(int i) { return new Record(field1[i],field2[i],field3[i]); } /* constructor and other accessors & methods */ } edit: assume the # of records is something that is changed infrequently or never I'm probably not going to use the OptimizedRecordStore approach, but I want to understand the storage cost issue so I can make that decision with confidence. obviously if I add/change the # of records in the OptimizedRecordStore approach above, I either have to replace the whole object with a new one, or remove the "final" keyword. kd304 brings up a good point that was in the back of my mind. In other situations similar to this, I need column access on the records, e.g. if field1 and field2 are "time" and "position", and it's important for me to get those values as an array for use with MATLAB, so I can graph/analyze them efficiently.

    Read the article

< Previous Page | 240 241 242 243 244 245 246 247 248 249 250 251  | Next Page >