Search Results

Search found 7529 results on 302 pages for 'replace'.

Page 244/302 | < Previous Page | 240 241 242 243 244 245 246 247 248 249 250 251  | Next Page >

  • Possible to write an Extension Method for ASP.NET's Html.ActionLink() method?

    - by Pretzel
    Right now, I'm trying to work around an IE6/7 bug which requires the wrapping of the </a closing tag with this IE specific comment to make some drop-down menu work: <!--[if IE 7]><!--></a><!--<![endif]--> Unfortunately, I cannot inject this directly into my View page code like this: <%= Html.ActionLink("LinkName<!--[if IE 7]><!--></a><!--<![endif]-->","Action","Controller") %> As Html.ActionLink will do the safe thing and filter out the comment to prevent a Javascript injection attack. Ok, cool. I'm fine with that. Good design decision. What I'd like to do is write an Extension Method to this, but the process is eluding me as I haven't done this before. I thought this would work, but Intellisense doesn't seem to be picking up this Extension method that I've written. public static class MyLinkExtensions { public static string ActionLinkIE(this HtmlHelper htmlHelper, string linkText, string actionName, string controllerName) { return LinkExtensions.ActionLink(htmlHelper, linkText, actionName, controllerName). Replace(@"</a>", @"<!--[if IE 7]><!--></a><!--<![endif]-->"); } } Any suggestions?

    Read the article

  • google chrome extension update text after response callback

    - by Jerome
    I am writing a Google Chrome extension. I have reached the stage where I can pass messages back and forth readily but I am running into trouble with using the response callback. My background page opens a message page and then the message page requests more information from background. When the message page receives the response I want to replace some of the standard text on the message page with custom text based on the response. Here is the code: chrome.extension.sendRequest({cmd: "sendKeyWords"}, function(response) { keyWordList=response.keyWordsFound; var keyWords=""; for (var i = 0; i FIRST QUESTION: This all seems to work fine but the text on the page doesn't change. I am almost certainly because the callback completes after the page is finished loading and the rest of the code finishes before the callback completes, too. How do I update the page with the new text? Can I listen for the callback to complete or something like that? SECOND QUESTION: The procedure I am pursuing first opens the message page and then the message page requests the keyword list from background. Since I always want the keyword list, it makes more sense to just send it when I create the tab. Can I do that? Here is the code from background that opens the message page: //when request from detail page to open message page chrome.extension.onRequest.addListener(function(request, sender, sendResponse) { if(request.cmd == "openMessage") { console.log("Received Request to Open Message, Profile Score: "+request.keyWordsFound.length); keyWordList=request.keyWordsFound; chrome.tabs.create({url: request.url}, function(tab){ msgTabId=tab.id; //needed to determine if message tab has later been closed chrome.tabs.executeScript(tab.id, {file: "message.js"}); }); console.log("Opening Message"); } });

    Read the article

  • Different standard streams per POSIX thread

    - by Roman Nikitchenko
    Is there any possibility to achieve different redirections for standard output like printf(3) for different POSIX thread? What about standard input? I have lot of code based on standard input/output and I only can separate this code into different POSIX thread, not process. Linux operation system, C standard library. I know I can refactor code to replace printf() to fprintf() and further in this style. But in this case I need to provide some kind of context which old code doesn't have. So doesn't anybody have better idea (look into code below)? #include <pthread.h> #include <stdio.h> void* different_thread(void*) { // Something to redirect standard output which doesn't affect main thread. // ... // printf() shall go to different stream. printf("subthread test\n"); return NULL; } int main() { pthread_t id; pthread_create(&id, NULL, different_thread, NULL); // In main thread things should be printed normally... printf("main thread test\n"); pthread_join(id, NULL); return 0; }

    Read the article

  • Advance: Parsing XML into another XML page using only javascript or jquery; Can't use PhP, Java or MySQL

    - by UrBestFriend
    Current site: http://cardwall.tk/ Example of intended outcome: http://www.shockwave.com/downloadWall.jsp I have an embeded flash object that uses XML/RSS (Picasa) to feed itself pictures. Now I created my own XML/RSS feed so that I can add additional XML tags and values. Now here's my big problem: enabling search. Since I'm not relying on Picasa's API anymore to return custom RSS/XML for the user's search, how can I create xml from another xml based on the user's search queries using only JavaScript and Jquery? Here is the current code: <script type="text/javascript"> var flashvars = { feed : "http%3A%2F%2Frssfeed.ucoz.com%2Frssfeed.xml", backgroundColor : "#FFFFFF", metadataFont : "Arial", wmode : "opaque", iFrameScrolling: "no", numRows : "3", }; var params = { allowFullScreen: "true", allowscriptaccess : "always", wmode: "opaque" }; swfobject.embedSWF("http://apps.cooliris.com/embed/cooliris.swf", "gamewall", "810", "410", "9.0.0", "", flashvars, params); $(document).ready(function() { $("#cooliris input").keydown(function(e) { if(e.keyCode == 13) { $("#cooliris a#searchCooliris").click(); return false; } }); doCoolIrisSearch = function() { cooliris.embed.setFeedContents( '** JAVA STRING OF PARSED RSS/XML based on http%3A%2F%2Frssfeed.ucoz.com%2Frssfeed.xml and USER'S SEARCH INPUT** ' ) }); <form id="searchForm" name="searchForm" class="shockwave"> <input type="text" name="coolIrisSearch" id="coolIrisSearch" value="Search..." class="field text short" onfocus="this.value='';" /> <a id="searchCooliris" href="#" onclick="doCoolIrisSearch();return false;" class="clearLink">Search Cooliris</a> </form> <div id="gamewall"></div> So basically, I want to replace cooliris.embed.setFeedContents's value with a Javastring based on the parsed RSS/XML and user search input. Any code or ideas would be greatly appreciated.

    Read the article

  • Showing latex commands in text string using mathjax

    - by robezy
    I have a text string, for ex. 'A vehicle travels from A to B, distance {$d} km at constant speed. While returning back to A on same path it {$variation} its speed by {$v} km/hr. The total time of journey is {$t} hours. Find the original speed of vehicle.' The variables in the curly brackets are to be replaced by appropriate latex equation. I'm using php's preg_replace to replace the variables with latex commands. Unfortunately, my latex commands are coming as it is. It is not processed by mathjax. For ex, above text becomes A vehicle travels from A to B, distance 1 km at constant speed. While returning back to A on same path it increased its speed by (\frac{3}{2}) km/hr. The total time of journey is 1 hours. Find the original speed of vehicle. The frac is show as it is. What is wrong here? Please ask me if you need any more info. Thanks

    Read the article

  • What does it mean to double license?

    - by Adrian Panasiuk
    What does it mean to double license code? I can't just put both licenses in the source files. That would mean that I mandate users to follow the rules of both of them, but the licenses will probably be contradictory (otherwise there'd be no reason to double license). I guess this is something like in cryptographic chaining, cipher = crypt_2(crypt_1(clear)) (generally) means, that cipher is neither the output of crypt_2 on clear nor the output of crypt_1 on clear. It's the output of the composition. Likewise, in double-licensing, in reality my code has one license, it's just that this new license says please follow all of the rules of license1, or all of the rules of license2, and you are hereby granted the right to redistribute this application under this "double" license, license1 or license2, or any license under which license1 or license2 allow you to redistribute this software, in which case you shall replace the relevant licensing information in this application with that of the new license. (Does this mean that before someone may use the app under license1, he has to perform the operation of redistributing to self? How would he document the fact that he did that operation?) Am I correct. What LICENSE file and what text to put in the source files would I need if I wanted to double license on, for the sake of example, Apachev2 and GPLv3 ?

    Read the article

  • How to redirect a URL with GET variables in routes.rb without Rails stripping out the variable first?

    - by Michael Hopkins
    I am building a website in Rails to replace an existing website. In routes.rb I am trying to redirect some of the old URLs to their new equivalents (some of the URL slugs are changing so a dynamic solution is not possible.) My routes.rb looks like this: match "/index.php?page=contact-us" => redirect("/contact-us") match "/index.php?page=about-us" => redirect("/about-us") match "/index.php?page=committees" => redirect("/teams") When I visit /index.php?page=contact-us I am not redirected to /contact-us. I have determined this is because Rails is removing the get variables and only trying to match /index.php. For example, If I pass /index.php?page=contact-us into the below routes I will be redirected to /foobar: match "/index.php?page=contact-us" => redirect("/contact-us") match "/index.php?page=about-us" => redirect("/about-us") match "/index.php?page=committees" => redirect("/teams") match "/index.php" => redirect("/foobar") How can I keep the GET variables in the string and redirect the old URLs the way I'd like? Does Rails have an intended mechanism for this?

    Read the article

  • DDD and Entity Base, Model using multiple identity types

    - by Thomas
    I have a model that looks like this: public interface IEntity { int Id { get; set; } } Then the idea is to have my entities inherit from this interface: public class User : IEntity { public int Id { get; set; } } However, one of my entities actually has a Guid as an identifier. public class UserSession { public Guid Id { get; set; } } I really would like all my entities inheriting from the same interface but that would force me to add an integer based identity column to the UserSession which is unnecessary since Guid is the identity, but it would keep the domain model nice since all entities would inherit from the same base. What options do I have in this scenario? Can I have two base interfaces, one for int and one for Guid? Should I add an identity column into the UserSession entity although it is unnecessary? I need the Guid so I can't just get rid of it and replace it with and integer. Any thoughts on best practices?

    Read the article

  • Wrapper Classes for Backward compatibility in Java

    - by Casebash
    There is an interesting article here on maintaing backwards compatibility for Java. In the wrapper class section, I can't actually understand what the wrapper class accomplishes. In the following code from MyApp, WrapNewClass.checkAvailable() could be replaced by Class.forName("NewClass"). static { try { WrapNewClass.checkAvailable(); mNewClassAvailable = true; } catch (Throwable ex) { mNewClassAvailable = false; } } Consider when NewClass is unavailable. In the code where we use the wrapper (see below), all we have done is replace a class that doesn't exist, with one that exists, but which can't be compiled as it uses a class that doesn't exist. public void diddle() { if (mNewClassAvailable) { WrapNewClass.setGlobalDiv(4); WrapNewClass wnc = new WrapNewClass(40); System.out.println("newer API is available - " + wnc.doStuff(10)); }else { System.out.println("newer API not available"); } } Can anyone explain why this makes a difference? I assume it has something to do with how Java compiles code - which I don't know much about.

    Read the article

  • Error logging in C#

    - by rschuler
    I am making my switch from coding in C++ to C#. I need to replace my C++ error logging/reporting macro system with something similar in C#. In my C++ source I can write LOGERR("Some error"); or LOGERR("Error with inputs %s and %d", stringvar, intvar); The macro & supporting library code then passes the (possibly varargs) formatted message into a database along with the source file, source line, user name, and time. The same data is also stuffed into a data structure for later reporting to the user. Does anybody have C# code snippets or pointers to examples that do this basic error reporting/logging? Edit: At the time I asked this question I was really new to .NET and was unaware of System.Diagnostics.Trace. System.Diagnostics.Trace was what I needed at that time. Since then I have used log4net on projects where the logging requirements were larger and more complex. Just edit that 500 line XML configuration file and log4net will do everything you will ever need :)

    Read the article

  • Regular expression to match HTML table row ( <tr> ) NOT containing a specific value

    - by user1821136
    I'm using Notepad++ to clean up a long and messy HTML table. I'm trying to use regular expressions even if I'm a total noob. :) I need to remove all the table rows that doesn't contain a specific value (may I call that substring?). After having all the file contents unwrapped, I've been able to use the following regular expression to select, one by one, every table row with all its contents: <tr>.+?</tr> How can I improve the regular expression in order to select and replace only table rows containing, somewhere inside a part of them, that defined substring? I don't know if this does matter but the structure of every table row is the following (I've put there every HTML tag, the dots stand for standard content/values) <tr> <td> ... </td> <td> ... </td> <td> <a sfref="..." href="...">!! SUBSTRING I HAVE TO MATCH HERE !!</a> </td> <td> <img /> </td> <td> ... </td> <td> ... </td> <td> ... </td> <td> ... </td> </tr> Thanks in advance for your help!

    Read the article

  • jQuery dynamic css loading weired behavior

    - by jimpsr
    The app I am working on requires dynamic loading of css and js, right now the solution is as follows: myapp.loadCss = function(css){ $("head").append("<link>"); cssDom = $("head").children(":last"); cssDom.attr({rel: "stylesheet", type: "text/css", href: css }); } myapp.loadJs = funciton(js){ ... //$.ajax call is used in synchronized mode to make sure the js is fully loaded } } When some widgets need to be load, the usual call with be myapp.loadCss('/widgets/widget1/css/example.css'); myapp.loadJs('/wiggets/widget1/js/example.js'); The weired thing is that once a while (1 out of 10 or 20), the newly created dom elements from example.js will not be able to get its css from example.css, it seems however my loadCss method does not load the css in a synchronized mode? I have tried to replace my loadCss with the the following code: myapp.loadCss(css){ $('<link href="' + css + '" rel="stylesheet" type="text/css" />').appendTo($('head')); } It seems to be OK then (I refreshed the webpage a hundred times for verification :-( ) But unfortunately this method failed in IE(IE7, not tested in IE6, 8) Is there any better solution for this?

    Read the article

  • Which languages support class replacement?

    - by Alix
    Hi, I'm writing my master thesis, which deals with AOP in .NET, among other things, and I mention the lack of support for replacing classes at load time as an important factor in the fact that there are currently no .NET AOP frameworks that perform true dynamic weaving -- not without imposing the requirement that woven classes must extend ContextBoundObject or MarshalByRefObject or expose all their semantics on an interface. You can however do this in Java thanks to ClassFileTransformer: You extend ClassFileTransformer. You subscribe to the class load event. On class load, you rewrite the class and replace it. All this is very well, but my project director has asked me, quite in the last minute, to give him a list of languages that do / do not support class replacement. I really have no time to look for this now: I wouldn't feel comfortable just doing a superficial research and potentially putting erroneous information in my thesis. So I ask you, oh almighty programming community, can you help out? Of course, I'm not asking you to research this yourselves. Simply, if you know for sure that a particular language supports / doesn't support this, leave it as an answer. If you're not sure please don't forget to point it out. Thanks so much!

    Read the article

  • What shall be the code in xaml which makes a particular image to act as a button?

    - by Abhi
    Dear all I am new to Silverlight. And i have to make a demo application where in designing is done by using Microsoft Expression Blend 2 and developing should be done using Visual Studio(c++). Now i am first trying to become familiar with xaml files. So i was trying to make a simple demo where in i have to create a button and that button should be replace with an png image. In order to do so i tried with the mentioned below example. But i was not able to see anything in the screen. <UserControl xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" x:Class="SilverlightApplication1.Page" Width="640" Height="480"> <Grid x:Name="LayoutRoot" Background="White"> <Button x:Name="LogoutButton" > <Button.Template> <ControlTemplate> <Image Source="SilverlightApplication1\bounce_photo.png" /> </ControlTemplate> </Button.Template> </Button> </Grid> Please let me know where i am wrong and what shall i do to obtain the result. With regards Abhineet Agarwal

    Read the article

  • Problem using the find function in MATLAB

    - by Peter Etchells
    I have two arrays of data that I'm trying to amalgamate. One contains actual latencies from an experiment in the first column (e.g. 0.345, 0.455... never more than 3 decimal places), along with other data from that experiment. The other contains what is effectively a 'look up' list of latencies ranging from 0.001 to 0.500 in 0.001 increments, along with other pieces of data. Both data sets are X-by-Y doubles. What I'm trying to do is something like... for i = 1:length(actual_latency) row = find(predicted_data(:,1) == actual_latency(i)) full_set(i,1:4) = [actual_latency(i) other_info(i) predicted_info(row,2) ... predicted_info(row,3)]; end ...in order to find the relevant row in predicted_data where the look up latency corresponds to the actual latency. I then use this to created an amalgamated data set, full_set. I figured this would be really simple, but the find function keeps failing by throwing up an empty matrix when looking for an actual latency that I know is in predicted_data(:,1) (as I've double-checked during debugging). Moreover, if I replace find with a for loop to do the same job, I get a similar error. It doesn't appear to be systematic - using different participant data sets throws it up in different places. Furthermore, during debugging mode, if I use find to try and find a hard-coded value of actual_latency, it doesn't always work. Sometimes yes, sometimes no. I'm really scratching my head over this, so if anyone has any ideas about what might be going on, I'd be really grateful.

    Read the article

  • copy rows before updating them to preserve archive in Postgres

    - by punkish
    I am experimenting with creating a table that keeps a version of every row. The idea is to be able to query for how the rows were at any point in time even if the query has JOINs. Consider a system where the primary resource is books, that is, books are queried for, and author info comes along for the ride CREATE TABLE authors ( author_id INTEGER NOT NULL, version INTEGER NOT NULL CHECK (version > 0), author_name TEXT, is_active BOOLEAN DEFAULT '1', modified_on TIMESTAMP DEFAULT CURRENT_TIMESTAMP, PRIMARY KEY (author_id, version) ) INSERT INTO authors (author_id, version, author_name) VALUES (1, 1, 'John'), (2, 1, 'Jack'), (3, 1, 'Ernest'); I would like to be able to update the above like so UPDATE authors SET author_name = 'Jack K' WHERE author_id = 1; and end up with 2, 1, Jack, t, 2012-03-29 21:35:00 2, 2, Jack K, t, 2012-03-29 21:37:40 which I can then query with SELECT author_name, modified_on FROM authors WHERE author_id = 2 AND modified_on < '2012-03-29 21:37:00' ORDER BY version DESC LIMIT 1; to get 2, 1, Jack, t, 2012-03-29 21:35:00 Something like the following doesn't really work CREATE OR REPLACE FUNCTION archive_authors() RETURNS TRIGGER AS $archive_author$ BEGIN IF (TG_OP = 'UPDATE') THEN -- The following fails because author_id,version PK already exists INSERT INTO authors (author_id, version, author_name) VALUES (OLD.author_id, OLD.version, OLD.author_name); UPDATE authors SET version = OLD.version + 1 WHERE author_id = OLD.author_id AND version = OLD.version; RETURN NEW; END IF; RETURN NULL; -- result is ignored since this is an AFTER trigger END; $archive_author$ LANGUAGE plpgsql; CREATE TRIGGER archive_author AFTER UPDATE OR DELETE ON authors FOR EACH ROW EXECUTE PROCEDURE archive_authors(); How can I achieve the above? Or, is there a better way to accomplish this? Ideally, I would prefer to not create a shadow table to store the archived rows.

    Read the article

  • Silverlight performance with many loaded controls

    - by gius
    I have a SL application with many DataGrids (from Silverlight Toolkit), each on its own view. If several DataGrids are opened, changing between views (TabItems, for example) takes a long time (few seconds) and it freezes the whole application (UI thread). The more DataGrids are loaded, the longer the change takes. These DataGrids that slow the UI chanage might be on other places in the app and not even visible at that moment. But once they are opened (and loaded with data), they slow showing other DataGrids. Note that DataGrids are NOT disposed and then recreated again, they still remain in memory, only their parent control is being hidden and visible again. I have profiled the application. It shows that agcore.dll's SetValue function is the bottleneck. Unfortunately, debug symbols are not available for this Silverlight native library responsible for drawing. The problem is not in the DataGrid control - I tried to replace it with XCeed's grid and the performance when changing views is even worse. Do you have any idea how to solve this problem? Why more opened controls slow down other controls? I have created a sample that shows this issue: http://cenud.cz/PerfTest.zip UPDATE: Using VS11 profiler on the sample provided suggests that the problem could be in MeasureOverride being called many times (for each DataGridCell, I guess). But still, why is it slower as more controls are loaded elsewhere? Is there a way to improve the performance?

    Read the article

  • [CODE GENERATION] How to generate DELETE statements in PL/SQL, based on the tables FK relations?

    - by The chicken in the kitchen
    Is it possible via script/tool to generate authomatically many delete statements based on the tables fk relations, using Oracle PL/SQL? In example: I have the table: CHICKEN (CHICKEN_CODE NUMBER) and there are 30 tables with fk references to its CHICKEN_CODE that I need to delete; there are also other 150 tables foreign-key-linked to that 30 tables that I need to delete first. Is there some tool/script PL/SQL that I can run in order to generate all the necessary delete statements based on the FK relations for me? (by the way, I know about cascade delete on the relations, but please pay attention: I CAN'T USE IT IN MY PRODUCTION DATABASE, because it's dangerous!) I'm using Oracle DataBase 10G R2. This is the result I've written, but it is not recursive: This is a view I have previously written, but of course it is not recursive! CREATE OR REPLACE FORCE VIEW RUN ( OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME, VINCOLO ) AS SELECT OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME, '(' || LTRIM ( EXTRACT (XMLAGG (XMLELEMENT ("x", ',' || COLUMN_NAME)), '/x/text()'), ',') || ')' VINCOLO FROM ( SELECT CON1.OWNER OWNER_1, CON1.TABLE_NAME TABLE_NAME_1, CON1.CONSTRAINT_NAME CONSTRAINT_NAME_1, CON1.DELETE_RULE, CON1.STATUS, CON.TABLE_NAME, CON.CONSTRAINT_NAME, COL.POSITION, COL.COLUMN_NAME FROM DBA_CONSTRAINTS CON, DBA_CONS_COLUMNS COL, DBA_CONSTRAINTS CON1 WHERE CON.OWNER = 'TABLE_OWNER' AND CON.TABLE_NAME = 'TABLE_OWNED' AND ( (CON.CONSTRAINT_TYPE = 'P') OR (CON.CONSTRAINT_TYPE = 'U')) AND COL.TABLE_NAME = CON1.TABLE_NAME AND COL.CONSTRAINT_NAME = CON1.CONSTRAINT_NAME --AND CON1.OWNER = CON.OWNER AND CON1.R_CONSTRAINT_NAME = CON.CONSTRAINT_NAME AND CON1.CONSTRAINT_TYPE = 'R' GROUP BY CON1.OWNER, CON1.TABLE_NAME, CON1.CONSTRAINT_NAME, CON1.DELETE_RULE, CON1.STATUS, CON.TABLE_NAME, CON.CONSTRAINT_NAME, COL.POSITION, COL.COLUMN_NAME) GROUP BY OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME; ... and it contains the error of using DBA_CONSTRAINTS instead of ALL_CONSTRAINTS...

    Read the article

  • using ini file in vb6, problem with path to file

    - by DrPut
    I have read many articles about how to use an INI file within my VB6 project. I don't have a problem with the methods, my problem is how to make the EXE file find the INI file. I don't want to hard code the path in the program. I simply want the EXE to expect the INI file to be present in the same folder the EXE is executed from. When I run the program from inside VB6 IDE, the INI is found and processed. When I compile the program and run the EXE, nothing is found. My code looks like: gServer = sGetINI(sINIFile, "TOOLBOM", "ServerName", "?") where TOOLBOM is the [Section] and "ServerName" is the key for the value. I obtained the following code for the API: Rem API DECLARATIONS Declare Function GetPrivateProfileString Lib "kernel32" Alias _ "GetPrivateProfileStringA" (ByVal lpApplicationName _ As String, ByVal lpKeyName As Any, ByVal lpDefault _ As String, ByVal lpReturnedString As String, ByVal _ nSize As Long, ByVal lpFileName As String) As Long Declare Function WritePrivateProfileString Lib "kernel32" Alias _ "WritePrivateProfileStringA" (ByVal lpApplicationName _ As String, ByVal lpKeyName As Any, ByVal lpString As Any, _ ByVal lpFileName As String) As Long Public Function sGetINI(sINIFile As String, sSection As String, sKey _ As String, sDefault As String) As String Dim sTemp As String * 256 Dim nLength As Integer sTemp = Space$(256) nLength = GetPrivateProfileString(sSection, sKey, sDefault, sTemp, _ 255, sINIFile) sGetINI = Left$(sTemp, nLength) End Function Public Sub writeINI(sINIFile As String, sSection As String, sKey _ As String, sValue As String) Dim n As Integer Dim sTemp As String sTemp = sValue Rem Replace any CR/LF characters with spaces For n = 1 To Len(sValue) If Mid$(sValue, n, 1) = vbCr Or Mid$(sValue, n, 1) = vbLf _ Then Mid$(sValue, n) = " " Next n n = WritePrivateProfileString(sSection, sKey, sTemp, sINIFile) End Sub

    Read the article

  • Compile IL code at runtime using .NET 3.5 and C# from file

    - by nitefrog
    I would like to take a file that is an IL file, and at run time compile it back to an exe. Right now I can use process.start to fire off the command line with parameters (ilasm.exe) but I would like to automate this process from a C# service I will create. Is there a way to do this with reflection and reflection.emit? While this works: string rawText = File.ReadAllText(string.Format("c:\\temp\\{0}.il", Utility.GetAppSetting("baseName")), Encoding.ASCII); rawText = rawText.Replace("[--STRIP--]", guid); File.Delete(string.Format("c:\\temp\\{0}.il", Utility.GetAppSetting("baseName"))); File.WriteAllText(string.Format("c:\\temp\\{0}.il", Utility.GetAppSetting("baseName")),rawText, Encoding.ASCII); pi = new ProcessStartInfo(); pi.WindowStyle = ProcessWindowStyle.Hidden; pi.FileName = "\"" + ilasm + "\""; pi.Arguments = string.Format("c:\\temp\\{0}.il", Utility.GetAppSetting("baseName")); using(Process p = Process.Start(pi)) { p.WaitForExit(); } It is not ideal as I really would like this to be a streamlined process. I have seen examples of creating the IL at runtime, then saving, but I need to use the IL I already have in file form and compile it back to an exe. Thanks.

    Read the article

  • Creating a function in Postgresql that does not return composite values

    - by celenius
    I'm learning how to write functions in Postgresql. I've defined a function called _tmp_myfunction() which takes in an id and returns a table (I also define a table object type called _tmp_mytable) -- create object type to be returned CREATE TYPE _tmp_mytable AS ( id integer, cost double precision ); -- create function which returns query CREATE OR REPLACE FUNCTION _tmp_myfunction( id integer ) RETURNS SETOF _tmp_mytable AS $$ BEGIN RETURN QUERY SELECT id, cost FROM sales WHERE id = sales.id; END; $$ LANGUAGE plpgsql; This works fine when I use one id and call it using the following approach: SELECT * FROM _tmp_myfunction(402); What I would like to be able to do is to call it, but to use a column of values instead of just one value. However, if I use the following approach I end up with all values of the table in one column, separated by commas: -- call function using all values in a column SELECT _tmp_myfunction(t.id) FROM transactions as t; I understand that I can get the same result if I use SELECT _tmp_myfunction(402); instead of SELECT * FROM _tmp_myfunction(402); but I don't know how to construct my query in such a way that I can separate out the results.

    Read the article

  • Why can't I roll a loop in Javascript?

    - by Carl Manaster
    I am working on a web page that uses dojo and has a number (6 in my test case, but variable in general) of project widgets on it. I'm invoking dojo.addOnLoad(init), and in my init() function I have these lines: dojo.connect(dijit.byId("project" + 0).InputNode, "onChange", function() {makeMatch(0);}); dojo.connect(dijit.byId("project" + 1).InputNode, "onChange", function() {makeMatch(1);}); dojo.connect(dijit.byId("project" + 2).InputNode, "onChange", function() {makeMatch(2);}); dojo.connect(dijit.byId("project" + 3).InputNode, "onChange", function() {makeMatch(3);}); dojo.connect(dijit.byId("project" + 4).InputNode, "onChange", function() {makeMatch(4);}); dojo.connect(dijit.byId("project" + 5).InputNode, "onChange", function() {makeMatch(5);}); and change events for my project widgets properly invoke the makeMatch function. But if I replace them with a loop: for (var i = 0; i < 6; i++) dojo.connect(dijit.byId("project" + i).InputNode, "onChange", function() {makeMatch(i);}); same makeMatch() function, same init() invocation, same everything else - just rolling my calls up into a loop - the makeMatch function is never called; the objects are not wired. What's going on, and how do I fix it? I've tried using dojo.query, but its behavior is the same as the for loop case.

    Read the article

  • using jquery selector to change attribute in variable returned from ajax request

    - by Blake
    I'm trying to pull in a filename.txt (contains html) using ajax and change the src path in the data variable before I load it into the target div. If I first load it into the div the browser first requests the broken image and I don't want this so I would like to do my processing before I load anything onto the page. I can pull the src values fine but I can't change them. In this example the src values aren't changed. Is there a way to do this with selectors or can they only modify DOM elements? Otherwise I may have to do some regex replace but using a selector will be more convenient if possible. $.ajax( { url: getDate+'/'+name+'.txt', success: function(data) { $('img', data).attr('src', 'new_test_src'); $('#'+target).fadeOut('slow', function(){ $('#'+target).html(data); $('#'+target).fadeIn('slow'); }); } }); My reason is I'm building a fully standalone javascript template system for a newsletter and since images and other things are upload via a drupal web file manager I want the content creators to keep their paths very short and simple and I can then modify them before I load in the content. This will also be distributed on a CD so I can need to change the paths for that so they still work.

    Read the article

  • Question about the evolution of interaction paradigm between web server program and content provider program?

    - by smwikipedia
    Hi experts, In my opinion, web server is responsible to deliver content to client. If it is static content like pictures and static html document, web server just deliver them as bitstream directly. If it is some dynamic content that is generated during processing client's request, the web server will not generate the conetnt itself but call some external proram to genearte the content. AFAIK, this kind of dynamice content generation technologies include the following: CGI ISAPI ... And from here, I noticed that: ...In IIS 7, modules replace ISAPI filters... Is there any others? Could anyone help me complete the above list and elabrate on or show some links to their evolution? I think it would be very helpful to understand application such as IIS, TomCat, and Apache. I once wrote a small CGI program, and though it serves as a content generator, it is still nothing but a normal standalone program. I call it normal because the CGI program has a main() entry point. But with the recenetly technology like ASP.NET, I am not writing complete program, but only some class library. Why does such radical change happens? Many thanks.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

< Previous Page | 240 241 242 243 244 245 246 247 248 249 250 251  | Next Page >