Search Results

Search found 7529 results on 302 pages for 'replace'.

Page 245/302 | < Previous Page | 241 242 243 244 245 246 247 248 249 250 251 252  | Next Page >

  • array of structures, or structure of arrays?

    - by Jason S
    Hmmm. I have a table which is an array of structures I need to store in Java. The naive don't-worry-about-memory approach says do this: public class Record { final private int field1; final private int field2; final private long field3; /* constructor & accessors here */ } List<Record> records = new ArrayList<Record>(); If I end up using a large number ( 106 ) of records, where individual records are accessed occasionally, one at a time, how would I figure out how the preceding approach (an ArrayList) would compare with an optimized approach for storage costs: public class OptimizedRecordStore { final private int[] field1; final private int[] field2; final private long[] field3; Record getRecord(int i) { return new Record(field1[i],field2[i],field3[i]); } /* constructor and other accessors & methods */ } edit: assume the # of records is something that is changed infrequently or never I'm probably not going to use the OptimizedRecordStore approach, but I want to understand the storage cost issue so I can make that decision with confidence. obviously if I add/change the # of records in the OptimizedRecordStore approach above, I either have to replace the whole object with a new one, or remove the "final" keyword. kd304 brings up a good point that was in the back of my mind. In other situations similar to this, I need column access on the records, e.g. if field1 and field2 are "time" and "position", and it's important for me to get those values as an array for use with MATLAB, so I can graph/analyze them efficiently.

    Read the article

  • "rsAccessDenied" error for SSRS 2008

    - by JackLocke
    Hi All, I have been trying to access SSRS Web Service URL hxxp://myServer:80/ReportServer (from Reporting Service Configuration Manager), but my IE always shows "rsAccessDenied" message saying that my account doesn't have privilage required to view. Here are my system specs. Its my laptop with Windows 7 x64, and SQL Server 2008 with SP1 and I am using Mixed Mode Authentication with My account as SysAdmin privilages and this is what I have been trying / tried ... (ofcourse with restarting the service everytime I make any change in configuration), I changed service account from Reporting Service Configuration Manager to make it use My account but nothing happend. I tried running my IE as admin, by RUN AS ADMIN but still same message. Then I read somewhere I have to delete/recreate my encryption keys as well, so I tried again with that, then it was asking me to enter ID/PWD to access server here I am totally blank because it was not accepting my account credentials !!!. Weird thing is I can see my existing reports if I follow this URL hxxp://myServer:80/Reports , for which My guess is solely used to view reports. I have read post here about kind of same problem, but it seems that OP just left forum after asking question... Also, MSDN does have these helps hxxp://msdn.microsoft.com/en-us/library/ms156034.aspx hxxp://msdn.microsoft.com/en-us/library/bb630430.aspx but both of this didn't workout for me. I will really appriciate it if any one can help me out. Jack p.s. I was not allowed to post more than 1 URL because of my "reputation" so I had to change the string a bit. Please replace hxxp wih http in URLs.

    Read the article

  • problems with async jquery and loops

    - by Seth Vargo
    I am so confused. I am trying to append portals to a page by looping through an array and calling a method I wrote called addModule(). The method gets called the right number of times (checked via an alert statement), in the correct order, but only one or two of the portals actually populate. I have a feeling its something with the loop and async, but it's easier explained with the code: moduleList = [['weather','test'],['test']]; for(i in moduleList) { $('#content').append(''); for(j in moduleList[i]) { addModule(i,moduleList[i][j]); //column,name } } function addModule(column,name) { alert('adding module ' + name); $.get('/modules/' + name.replace(' ','-') + '.php',function(data){ $('#'+column).append(data); }); } for each array in the main array, I append a new column, since that's what each sub-array is - a column of portals. Then I loop through that sub array and call addModule on that column and the name of that module (which works correctly). Something buggy happens in my addModule method that it only adds the first and last modules, or sometimes a middle one, or sometimes none at all... im so confused!

    Read the article

  • Changing where a resource is pulled during runtime?

    - by Brandon
    I have a website that goes out to multiple clients. Sometimes a client will insist on minor changes. For reasons beyond my control, I have to comply no matter how minor the request. Usually this isn't a problem, I would just create a client specific version of the user control or page and overwrite the default one during build time or make a configuration setting to handle it. Now that I am localizing the site, I'm curious about the best way to go about making minor wording changes. Lets say I have a resource file called Resources.resx that has 300 resources in it. It has a resource called Continue. English value is "Continue", the French value is "Continuez". Now one client, for whatever reason, wants it to say "Next" and "Après" and the others want to keep it the same. What is the best way to accomodate a request like this? (This is just a simple example). The only two ways I can think of is to Create another Resources.resx specific to the client, and replace the .dll during build time. Since I'd be completely replacing the dll, the new resource file would have to contain all 300 strings. The obvious problem being that I now have 2 resource files, each with 300 strings to maintain. Create a custom user control/page and change it to use a custom resource file. e.g. SignIn.ascx would be replaced during the build and it would pull its resources from ClientName.resx instead of Resources.resx. Are there any other things I could try? Is there any way to change it so that the application will always look in a ClientResources.resx file for the overridden values before actually look at the specified resource file?

    Read the article

  • using ini file in vb6, problem with path to file

    - by DrPut
    I have read many articles about how to use an INI file within my VB6 project. I don't have a problem with the methods, my problem is how to make the EXE file find the INI file. I don't want to hard code the path in the program. I simply want the EXE to expect the INI file to be present in the same folder the EXE is executed from. When I run the program from inside VB6 IDE, the INI is found and processed. When I compile the program and run the EXE, nothing is found. My code looks like: gServer = sGetINI(sINIFile, "TOOLBOM", "ServerName", "?") where TOOLBOM is the [Section] and "ServerName" is the key for the value. I obtained the following code for the API: Rem API DECLARATIONS Declare Function GetPrivateProfileString Lib "kernel32" Alias _ "GetPrivateProfileStringA" (ByVal lpApplicationName _ As String, ByVal lpKeyName As Any, ByVal lpDefault _ As String, ByVal lpReturnedString As String, ByVal _ nSize As Long, ByVal lpFileName As String) As Long Declare Function WritePrivateProfileString Lib "kernel32" Alias _ "WritePrivateProfileStringA" (ByVal lpApplicationName _ As String, ByVal lpKeyName As Any, ByVal lpString As Any, _ ByVal lpFileName As String) As Long Public Function sGetINI(sINIFile As String, sSection As String, sKey _ As String, sDefault As String) As String Dim sTemp As String * 256 Dim nLength As Integer sTemp = Space$(256) nLength = GetPrivateProfileString(sSection, sKey, sDefault, sTemp, _ 255, sINIFile) sGetINI = Left$(sTemp, nLength) End Function Public Sub writeINI(sINIFile As String, sSection As String, sKey _ As String, sValue As String) Dim n As Integer Dim sTemp As String sTemp = sValue Rem Replace any CR/LF characters with spaces For n = 1 To Len(sValue) If Mid$(sValue, n, 1) = vbCr Or Mid$(sValue, n, 1) = vbLf _ Then Mid$(sValue, n) = " " Next n n = WritePrivateProfileString(sSection, sKey, sTemp, sINIFile) End Sub

    Read the article

  • ODP.NET Procedure Compilation

    - by Bobcat1506
    When I try to execute a create procedure using ODP.NET I get back ORA-24344: success with compilation error. However, when I run the same statement in SQL Developer it compiles successfully. Does anyone know what I need to change to get my procedure to compile? Is it a character set issue? I am using Oracle 10g Express, .NET 3.5 SP 1, and ODP.NET 2.111.7.20 (version from Oracle.DataAccess.dll) [TestMethod] public void OdpNet_CreateProcedure() { ConnectionStringSettings settings = ConfigurationManager.ConnectionStrings["ODP.NET"]; using (var con = new OracleConnection(settings.ConnectionString)) { con.InfoMessage += new OracleInfoMessageEventHandler(con_InfoMessage); con.Open(); var cmd = new OracleCommand(); cmd.Connection = con; cmd.CommandText = @" CREATE OR REPLACE PROCEDURE TABLE1_GET ( P_CURSOR OUT SYS_REFCURSOR ) IS BEGIN OPEN P_CURSOR FOR SELECT * FROM TABLE1; END;"; cmd.ExecuteNonQuery(); // ORA-24344: success with compilation error cmd.CommandText = @"ALTER PROCEDURE TABLE1_GET COMPILE"; cmd.ExecuteNonQuery(); // ORA-24344: success with compilation error } } void con_InfoMessage(object sender, OracleInfoMessageEventArgs eventArgs) { System.Diagnostics.Debug.WriteLine(eventArgs.Message); }

    Read the article

  • using jquery selector to change attribute in variable returned from ajax request

    - by Blake
    I'm trying to pull in a filename.txt (contains html) using ajax and change the src path in the data variable before I load it into the target div. If I first load it into the div the browser first requests the broken image and I don't want this so I would like to do my processing before I load anything onto the page. I can pull the src values fine but I can't change them. In this example the src values aren't changed. Is there a way to do this with selectors or can they only modify DOM elements? Otherwise I may have to do some regex replace but using a selector will be more convenient if possible. $.ajax( { url: getDate+'/'+name+'.txt', success: function(data) { $('img', data).attr('src', 'new_test_src'); $('#'+target).fadeOut('slow', function(){ $('#'+target).html(data); $('#'+target).fadeIn('slow'); }); } }); My reason is I'm building a fully standalone javascript template system for a newsletter and since images and other things are upload via a drupal web file manager I want the content creators to keep their paths very short and simple and I can then modify them before I load in the content. This will also be distributed on a CD so I can need to change the paths for that so they still work.

    Read the article

  • Silverlight performance with many loaded controls

    - by gius
    I have a SL application with many DataGrids (from Silverlight Toolkit), each on its own view. If several DataGrids are opened, changing between views (TabItems, for example) takes a long time (few seconds) and it freezes the whole application (UI thread). The more DataGrids are loaded, the longer the change takes. These DataGrids that slow the UI chanage might be on other places in the app and not even visible at that moment. But once they are opened (and loaded with data), they slow showing other DataGrids. Note that DataGrids are NOT disposed and then recreated again, they still remain in memory, only their parent control is being hidden and visible again. I have profiled the application. It shows that agcore.dll's SetValue function is the bottleneck. Unfortunately, debug symbols are not available for this Silverlight native library responsible for drawing. The problem is not in the DataGrid control - I tried to replace it with XCeed's grid and the performance when changing views is even worse. Do you have any idea how to solve this problem? Why more opened controls slow down other controls? I have created a sample that shows this issue: http://cenud.cz/PerfTest.zip UPDATE: Using VS11 profiler on the sample provided suggests that the problem could be in MeasureOverride being called many times (for each DataGridCell, I guess). But still, why is it slower as more controls are loaded elsewhere? Is there a way to improve the performance?

    Read the article

  • Which languages support class replacement?

    - by Alix
    Hi, I'm writing my master thesis, which deals with AOP in .NET, among other things, and I mention the lack of support for replacing classes at load time as an important factor in the fact that there are currently no .NET AOP frameworks that perform true dynamic weaving -- not without imposing the requirement that woven classes must extend ContextBoundObject or MarshalByRefObject or expose all their semantics on an interface. You can however do this in Java thanks to ClassFileTransformer: You extend ClassFileTransformer. You subscribe to the class load event. On class load, you rewrite the class and replace it. All this is very well, but my project director has asked me, quite in the last minute, to give him a list of languages that do / do not support class replacement. I really have no time to look for this now: I wouldn't feel comfortable just doing a superficial research and potentially putting erroneous information in my thesis. So I ask you, oh almighty programming community, can you help out? Of course, I'm not asking you to research this yourselves. Simply, if you know for sure that a particular language supports / doesn't support this, leave it as an answer. If you're not sure please don't forget to point it out. Thanks so much!

    Read the article

  • Trying to use jquery ui in google chrome extension in the content level

    - by user135697
    The problem is that the scope of the content script is on the web page that your plugin is suppose to be used at. So the css background:url(images/ui-bg_inset-hard_100_fcfdfd_1x100.png) becomes url('http://webpageforplugin/images/ui-bg_inset-hard_100_fcfdfd_1x100.png') in order for this to work as far as i understood i need to have it to point to: url('chrome-extension://extensionId/images/ui-bg_inset-hard_100_fcfdfd_1x100.png') So i tried to haxorz the document.styleSheets var ss = document.styleSheets; for (var i=0; i<ss.length; i++) { var found=-1, x,i; var rules = ss[i].cssRules || ss[i].rules; for (var j=0; j<rules.length; j++) { if ('.ui-helper-hidden'==rules[j].selectorText){ found=i; break; } } if (found>-1){ for (var j=0; j<rules.length; j++) { if (x=rules[j].style.background){ if ((i=x.indexOf('url'))!=-1) rules[j].style.background = x.replace('http://page/images/','chrome-extension://extensionId/images/'); } } break; } }; I feel that i'm missing the obvious. That there must be an easier way. Even if i manage to change this how will i get the extension id to build the string. Btw this doesn't work, the icons are not properly fetched. (I hardcoded the extension id) Any ideas?

    Read the article

  • Problem using the find function in MATLAB

    - by Peter Etchells
    I have two arrays of data that I'm trying to amalgamate. One contains actual latencies from an experiment in the first column (e.g. 0.345, 0.455... never more than 3 decimal places), along with other data from that experiment. The other contains what is effectively a 'look up' list of latencies ranging from 0.001 to 0.500 in 0.001 increments, along with other pieces of data. Both data sets are X-by-Y doubles. What I'm trying to do is something like... for i = 1:length(actual_latency) row = find(predicted_data(:,1) == actual_latency(i)) full_set(i,1:4) = [actual_latency(i) other_info(i) predicted_info(row,2) ... predicted_info(row,3)]; end ...in order to find the relevant row in predicted_data where the look up latency corresponds to the actual latency. I then use this to created an amalgamated data set, full_set. I figured this would be really simple, but the find function keeps failing by throwing up an empty matrix when looking for an actual latency that I know is in predicted_data(:,1) (as I've double-checked during debugging). Moreover, if I replace find with a for loop to do the same job, I get a similar error. It doesn't appear to be systematic - using different participant data sets throws it up in different places. Furthermore, during debugging mode, if I use find to try and find a hard-coded value of actual_latency, it doesn't always work. Sometimes yes, sometimes no. I'm really scratching my head over this, so if anyone has any ideas about what might be going on, I'd be really grateful.

    Read the article

  • Which frameworks (and associated languages) support class replacement?

    - by Alix
    Hi, I'm writing my master thesis, which deals with AOP in .NET, among other things, and I mention the lack of support for replacing classes at load time as an important factor in the fact that there are currently no .NET AOP frameworks that perform true dynamic weaving -- not without imposing the requirement that woven classes must extend ContextBoundObject or MarshalByRefObject or expose all their semantics on an interface. You can however do this with the JVM thanks to ClassFileTransformer: You extend ClassFileTransformer. You subscribe to the class load event. On class load, you rewrite the class and replace it. All this is very well, but my project director has asked me, quite in the last minute, to give him a list of frameworks (and associated languages) that do / do not support class replacement. I really have no time to look for this now: I wouldn't feel comfortable just doing a superficial research and potentially putting erroneous information in my thesis. So I ask you, oh almighty programming community, can you help out? Of course, I'm not asking you to research this yourselves. Simply, if you know for sure that a particular framework supports / doesn't support this, leave it as an answer. If you're not sure please don't forget to point it out. Thanks so much!

    Read the article

  • Changing default compiler in Linux, using SCons

    - by ereOn
    On my Linux platform, I have several versions of gcc. Under usr/bin I have: gcc34 gcc44 gcc Here are some outputs: $ gcc --version gcc (GCC) 4.1.2 20080704 (Red Hat 4.1.2-48) $ gcc44 --version gcc44 (GCC) 4.4.0 20090514 (Red Hat 4.4.0-6) I need to use the 4.4 version of gcc however the default seems to the 4.1 one. I there a way to replace /usr/bin/gcc and make gcc44 the default compiler not using a symlink to /usr/bin/gcc44 ? The reason why I can't use a symlink is because my code will have to be shipped in a RPM package using mock. mock creates a minimal linux installation from scratch and just install the specified dependencies before compiling my code in it. I cannot customize this "minimal installation". Ideally, the perfect solution would be to install an official RPM package that replaces gcc with gcc44 as the default compiler. Is there such a package ? Is this even possible/good ? Additional information I have to use SCons (a make alternative) and it doesn't let me specify the binary to use for gcc. I will also accept any answer that will tell me how to specify the gcc binary in my SConstruct file.

    Read the article

  • Asp.Net MVC - Binding of parameter to model value!

    - by Pino
    This seems like the model binding is causing me issues. Essentially I have a model called ProductOption and for the purpose of this question it has 2 fields ID (Int) PK ProductID (Int) FK I have a standard route set-up context.MapRoute( "Product_default", "Product/{controller}/{action}/{id}", new { controller = "Product", action = "Index", id = UrlParameter.Optional } ); and if the user wants to add an option the URL is, /Product/Options/Add/1 in the above URL 1 is the ProductID, I have the following code to return a blank model the the view, [HttpGet] public ActionResult Add(int id) { return View("Manage", new ProductOptionModel() { ProductID = id }); } Now in my view I keep a hidden field <%= Html.HiddenFor(x=>x.ID) %> This is used to determine (on submit) if we are editing or adding a new option. However the Model binder in .net seems to replace .ID (Which was 0 when leaving the above get actionresult) with 1 (or the value of the id parameter in the URL) How can I stop or work around this? ViewModel public class ProductExtraModel { //Database public int ID { get; set; } public string Name { get; set; } public int ProductID { get; set; } public ProductModel Product { get; set; } }

    Read the article

  • is using private shared objects/variables on class level harmful ?

    - by haansi
    Hello, Thanks for your attention and time. I need your opinion on an basic architectural issue please. In page behind classes I am using a private and shared object and variables (list or just client or simplay int id) to temporary hold data coming from database or class library. This object is used temporarily to catch data and than to return, pass to some function or binding a control. 1st: Can this approach harm any way ? I couldn't analyze it but a thought was using such shared variables may replace data in it when multiple users may be sending request at a time? 2nd: Please comment also on using such variables in BLL (to hold data coming from DAL/database). In this example every time new object of BLL class will be made. Here is sample code: public class ClientManager { Client objclient = new Client(); //Used in 1st and 2nd method List<Client> clientlist = new List<Client>();// used in 3rd and 4th method ClientRepository objclientRep = new ClientRepository(); public List<Client> GetClients() { return clientlist = objclientRep.GetClients(); } public List<Client> SearchClients(string Keyword) { return clientlist = objclientRep.SearchClients(Keyword); } public Client GetaClient(int ClientId) { return objclient = objclientRep.GetaClient(ClientId); } public Client GetClientDetailForConfirmOrder(int UserId) { return objclientRep.GetClientDetailForConfirmOrder(UserId); } } I am really thankful to you for sparing time and paying kind attention.

    Read the article

  • Sharing same vector control between different places

    - by Alexander K
    Hi everyone, I'm trying to implement the following: I have an Items Manager, that has an Item class inside. Item class can store two possible visual representations of it - BitmapImage(bitmap) and UserControl(vector). Then later, in the game, I need to share the same image or vector control between all possible places it takes place. For example, consider 10 trees on the map, and all point to the same vector control. Or in some cases this can be bitmap image source. So, the problem is that BitmapImage source can be easily shared in the application by multiple UIElements. However, when I try to share vector control, it fails, and says Child Element is already a Child element of another control. I want to know how to organize this in the best way. For example replace UserControl with other type of control, or storage, however I need to be sure it supports Storyboard animations inside. The code looks like this: if (bi.item.BitmapSource != null) { Image previewImage = new Image(); previewImage.Source = bi.item.BitmapSource; itemPane.ItemPreviewCanvas.Children.Add(previewImage); } else if (bi.item.VectorSource != null) { UserControl previewControl = bi.item.VectorSource; itemPane.ItemPreviewCanvas.Children.Add(previewControl); } Thanks in advance

    Read the article

  • Word wrap in multiline textbox after 35 characters

    - by Kanavi
    <asp:TextBox CssClass="txt" ID="TextBox1" runat="server" onkeyup="CountChars(this);" Rows="20" Columns="35" TextMode="MultiLine" Wrap="true"> </asp:TextBox> I need to implement word-wrapping in a multi-line textbox. I cannot allow users to write more then 35 chars a line. I am using the following code, which breaks at precisely the specified character on every line, cutting words in half. Can we fix this so that if there's not enough space left for a word on the current line, we move the whole word to the next line? function CountChars(ID) { var IntermediateText = ''; var FinalText = ''; var SubText = ''; var text = document.getElementById(ID.id).value; var lines = text.split("\n"); for (var i = 0; i < lines.length; i++) { IntermediateText = lines[i]; if (IntermediateText.length <= 50) { if (lines.length - 1 == i) FinalText += IntermediateText; else FinalText += IntermediateText + "\n"; } else { while (IntermediateText.length > 50) { SubText = IntermediateText.substring(0, 50); FinalText += SubText + "\n"; IntermediateText = IntermediateText.replace(SubText, ''); } if (IntermediateText != '') { if (lines.length - 1 == i) FinalText += IntermediateText; else FinalText += IntermediateText + "\n"; } } } document.getElementById(ID.id).value = FinalText; $('#' + ID.id).scrollTop($('#' + ID.id)[0].scrollHeight); } Edit - 1 I have to show total max 35 characters in line without specific word break and need to keep margin of two characters from the right. Again, the restriction should be for 35 characters but need space for total 37 (Just for the Visibility issue.)

    Read the article

  • Writing csv file in asp.net

    - by Keith
    Hello, I'm trying to export data to a csv file, as there are chinese characters in the data i had to use unicode.. but after adding the preamble for unicode, the commas are not recognized as delimiters and all data are now written to the first column. I'm not sure what is wrong. Below is my code which i wrote in a .ashx file. DataView priceQuery = (DataView)context.Session["priceQuery"]; String fundName = priceQuery.Table.Rows[0][0].ToString().Trim().Replace(' ', '_'); context.Response.Clear(); context.Response.ClearContent(); context.Response.ClearHeaders(); context.Response.ContentType = "text/csv"; context.Response.ContentEncoding = System.Text.Encoding.Unicode; context.Response.AddHeader("Content-Disposition", "attachment; filename=" + fundName + ".csv"); context.Response.BinaryWrite(System.Text.Encoding.Unicode.GetPreamble()); String output = fundName + "\n"; output += "Price, Date" + "\n"; foreach (DataRow row in priceQuery.Table.Rows) { string price = row[2].ToString(); string date = ((DateTime)row[1]).ToString("dd-MMM-yy"); output += price + "," + date + "\n"; } context.Response.Write(output);

    Read the article

  • Is there a FAST way to export and install an app on my phone, while signing it with my own keystore?

    - by Alexei Andreev
    So, I've downloaded my own application from the market and installed it on my phone. Now, I am trying to install a temporary new version from Eclipse, but here is the message I get: Re-installation failed due to different application signatures. You must perform a full uninstall of the application. WARNING: This will remove the application data! Please execute 'adb uninstall com.applicationName' in a shell. Launch canceled! Now, I really really don't want to uninstall the application, because I will lose all my data. One solution I found is to Export my application, creating new .apk, and then install it via HTC Sync (probably a different program based on what phone you have). The problem is this takes a long time to do, since I need to enter the password for the keystore each time and then wait for HTC Sync. It's a pain in the ass! So the question is: Is there a way to make Eclipse automatically use my keystore to sign the application (quickly and automatically)? Or perhaps to replace debug keystore with my own? Or perhaps just tell it to remember the password, so I don't have to enter it every time...? Or some other way to solve this problem?

    Read the article

  • How to paginate Django with other get variables?

    - by vagabond
    I am having problems using pagination in Django. Take the URL below as an example: http://127.0.0.1:8000/users/?sort=first_name On this page I sort a list of users by their first_name. Without a sort GET variable it defaults to sort by id. Now if I click the next link I expect the following URL: http://127.0.0.1:8000/users/?sort=first_name&page=2 Instead I lose all get variables and end up with http://127.0.0.1:8000/users/?page=2 This is a problem because the second page is sorted by id instead of first_name. If I use request.get_full_path I will eventually end up with an ugly URL: http://127.0.0.1:8000/users/?sort=first_name&page=2&page=3&page=4 What is the solution? Is there a way to access the GET variables on the template and replace the value for the page? I am using pagination as described in Django's documentation and my preference is to keep using it. The template code I am using is similar to this: {% if contacts.has_next %} <a href="?page={{ contacts.next_page_number }}">next</a> {% endif %}

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • [CODE GENERATION] How to generate DELETE statements in PL/SQL, based on the tables FK relations?

    - by The chicken in the kitchen
    Is it possible via script/tool to generate authomatically many delete statements based on the tables fk relations, using Oracle PL/SQL? In example: I have the table: CHICKEN (CHICKEN_CODE NUMBER) and there are 30 tables with fk references to its CHICKEN_CODE that I need to delete; there are also other 150 tables foreign-key-linked to that 30 tables that I need to delete first. Is there some tool/script PL/SQL that I can run in order to generate all the necessary delete statements based on the FK relations for me? (by the way, I know about cascade delete on the relations, but please pay attention: I CAN'T USE IT IN MY PRODUCTION DATABASE, because it's dangerous!) I'm using Oracle DataBase 10G R2. This is the result I've written, but it is not recursive: This is a view I have previously written, but of course it is not recursive! CREATE OR REPLACE FORCE VIEW RUN ( OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME, VINCOLO ) AS SELECT OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME, '(' || LTRIM ( EXTRACT (XMLAGG (XMLELEMENT ("x", ',' || COLUMN_NAME)), '/x/text()'), ',') || ')' VINCOLO FROM ( SELECT CON1.OWNER OWNER_1, CON1.TABLE_NAME TABLE_NAME_1, CON1.CONSTRAINT_NAME CONSTRAINT_NAME_1, CON1.DELETE_RULE, CON1.STATUS, CON.TABLE_NAME, CON.CONSTRAINT_NAME, COL.POSITION, COL.COLUMN_NAME FROM DBA_CONSTRAINTS CON, DBA_CONS_COLUMNS COL, DBA_CONSTRAINTS CON1 WHERE CON.OWNER = 'TABLE_OWNER' AND CON.TABLE_NAME = 'TABLE_OWNED' AND ( (CON.CONSTRAINT_TYPE = 'P') OR (CON.CONSTRAINT_TYPE = 'U')) AND COL.TABLE_NAME = CON1.TABLE_NAME AND COL.CONSTRAINT_NAME = CON1.CONSTRAINT_NAME --AND CON1.OWNER = CON.OWNER AND CON1.R_CONSTRAINT_NAME = CON.CONSTRAINT_NAME AND CON1.CONSTRAINT_TYPE = 'R' GROUP BY CON1.OWNER, CON1.TABLE_NAME, CON1.CONSTRAINT_NAME, CON1.DELETE_RULE, CON1.STATUS, CON.TABLE_NAME, CON.CONSTRAINT_NAME, COL.POSITION, COL.COLUMN_NAME) GROUP BY OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME; ... and it contains the error of using DBA_CONSTRAINTS instead of ALL_CONSTRAINTS...

    Read the article

  • What shall be the code in xaml which makes a particular image to act as a button?

    - by Abhi
    Dear all I am new to Silverlight. And i have to make a demo application where in designing is done by using Microsoft Expression Blend 2 and developing should be done using Visual Studio(c++). Now i am first trying to become familiar with xaml files. So i was trying to make a simple demo where in i have to create a button and that button should be replace with an png image. In order to do so i tried with the mentioned below example. But i was not able to see anything in the screen. <UserControl xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" x:Class="SilverlightApplication1.Page" Width="640" Height="480"> <Grid x:Name="LayoutRoot" Background="White"> <Button x:Name="LogoutButton" > <Button.Template> <ControlTemplate> <Image Source="SilverlightApplication1\bounce_photo.png" /> </ControlTemplate> </Button.Template> </Button> </Grid> Please let me know where i am wrong and what shall i do to obtain the result. With regards Abhineet Agarwal

    Read the article

  • Matlab GUI - How to get the previous value entered from a callback function?

    - by Graham
    Hi, I know that this is probably a simple problem but I am new to Matlab GUI's and basically want to get the old value which used to be stored in the text box to replace the value which has just been entered. E.g. Text box contains a valid string, User enters invalid string, Callback func, validates input and realises new input is an error and reverts to the old previous value. How should this be implemented or done? Atm I am just using the get and set property values. Below is some sample code: function sampledist_Callback(hObject, eventdata, handles) % hObject handle to sampledist (see GCBO) % eventdata reserved - to be defined in a future version of MATLAB % handles structure with handles and user data (see GUIDATA) % Hints: get(hObject,'String') returns contents of sampledist as text % str2double(get(hObject,'String')) returns contents of sampledist as a double input = str2double(get(hObject,'String')); if(input < 0 || input > 500) errordlg('Sampled Dist. must be > 0 and < 500','Sample Dist - Input Error'); set(handles.sampledist,'String',['10']); %<--- I would like this value 10 to be the previous entry! guidata(hObject,handles); else set(handles.sampledist,'String',['',input]); guidata(hObject,handles); end

    Read the article

  • prototype findElements querySelectorAll error

    - by JD
    i'm call the "down" function but am getting an invalid argument using 1.6.1_rc2 here's the html snippet: <TR id=000000214A class="activeRow searchResultsDisplayOver" conceptID="0000001KIU"> <TD> <DIV class=gridRowWrapper> <SPAN class=SynDesc>Asymmetric breasts</SPAN> <DIV class=buttonWrapper> <SPAN class=btnAddFav title="Add to Favorites">&nbsp;</SPAN> </DIV> </DIV> </TD> </TR> here's the code: var description = row.down('span.SynDesc').innerHTML; row is a dom reference to the element. prototype is appending a # then the id of the element: findElements: function(root) { root = root || document; var e = this.expression, results; switch (this.mode) { case 'selectorsAPI': if (root !== document) { var oldId = root.id, id = $(root).identify(); id = id.replace(/[\.:]/g, "\\$0"); e = "#" + id + " " + e; } results = $A(root.querySelectorAll(e)).map(Element.extend); <-- e = "#000000214A span.SynDesc" root.id = oldId; return results; case 'xpath': return document._getElementsByXPath(this.xpath, root); default: return this.matcher(root); } i get an "invalid argument" error? if i put a breakpoint before the offending line and change e to be equal to "span.SynDesc" it works fine. help. :)

    Read the article

< Previous Page | 241 242 243 244 245 246 247 248 249 250 251 252  | Next Page >