Search Results

Search found 7529 results on 302 pages for 'replace'.

Page 245/302 | < Previous Page | 241 242 243 244 245 246 247 248 249 250 251 252  | Next Page >

  • using jquery selector to change attribute in variable returned from ajax request

    - by Blake
    I'm trying to pull in a filename.txt (contains html) using ajax and change the src path in the data variable before I load it into the target div. If I first load it into the div the browser first requests the broken image and I don't want this so I would like to do my processing before I load anything onto the page. I can pull the src values fine but I can't change them. In this example the src values aren't changed. Is there a way to do this with selectors or can they only modify DOM elements? Otherwise I may have to do some regex replace but using a selector will be more convenient if possible. $.ajax( { url: getDate+'/'+name+'.txt', success: function(data) { $('img', data).attr('src', 'new_test_src'); $('#'+target).fadeOut('slow', function(){ $('#'+target).html(data); $('#'+target).fadeIn('slow'); }); } }); My reason is I'm building a fully standalone javascript template system for a newsletter and since images and other things are upload via a drupal web file manager I want the content creators to keep their paths very short and simple and I can then modify them before I load in the content. This will also be distributed on a CD so I can need to change the paths for that so they still work.

    Read the article

  • Creating a function in Postgresql that does not return composite values

    - by celenius
    I'm learning how to write functions in Postgresql. I've defined a function called _tmp_myfunction() which takes in an id and returns a table (I also define a table object type called _tmp_mytable) -- create object type to be returned CREATE TYPE _tmp_mytable AS ( id integer, cost double precision ); -- create function which returns query CREATE OR REPLACE FUNCTION _tmp_myfunction( id integer ) RETURNS SETOF _tmp_mytable AS $$ BEGIN RETURN QUERY SELECT id, cost FROM sales WHERE id = sales.id; END; $$ LANGUAGE plpgsql; This works fine when I use one id and call it using the following approach: SELECT * FROM _tmp_myfunction(402); What I would like to be able to do is to call it, but to use a column of values instead of just one value. However, if I use the following approach I end up with all values of the table in one column, separated by commas: -- call function using all values in a column SELECT _tmp_myfunction(t.id) FROM transactions as t; I understand that I can get the same result if I use SELECT _tmp_myfunction(402); instead of SELECT * FROM _tmp_myfunction(402); but I don't know how to construct my query in such a way that I can separate out the results.

    Read the article

  • Manifesto for Integrated Development Environments

    - by Hugo S Ferreira
    Have you recently take a peek at Coda, or Espresso, or Textmate? Or even Google Chrome's Developer Tools? They are well designed, intuitive, interface rich, and extensible. But Coda, Espresso or Textmate, among several, are text editors, not IDEs. On the other side, VIM and Emacs live in the last century, and Eclipse is an overbloated platform. This is more like an outcry for a decent, common infrastructure for REAL IDEs. But there's some questions attached: (i) what features are needed for such a product and (ii) what products are out there that could fullfil this need, and what are they missing. So here's my draft for a manifesto: Manifesto for Integrated Development Environments: We favor interactivity and productivity over syntax and tools. We favor inline, contextual documentation over man and html files. We favor high-definition, graphic-capable color screens over 80x25 character terminals. We favor the use of advanced input schemas over unintuitive keyboard shortcuts. We favor a common, extensible and customizable infrastructure over unmaintained chaintools. We know the difference between search&replace and refactoring. We know the difference between integrated debugging support over a terminal window. We know the difference between semantic-aware code-completion over dumb textual templates. We favor the usage of standards like (E)BNF.

    Read the article

  • Using `<List>` when dealing with pointers in C#.

    - by Gorchestopher H
    How can I add an item to a list if that item is essentially a pointer and avoid changing every item in my list to the newest instance of that item? Here's what I mean: I am doing image processing, and there is a chance that I will need to deal with images that come in faster than I can process (for a short period of time). After this "burst" of images I will rely on the fact that I can process faster than the average image rate, and will "catch-up" eventually. So, what I want to do is put my images into a <List> when I acquire them, then if my processing thread isn't busy, I can take an image from that list and hand it over. My issue is that I am worried that since I am adding the image "Image1" to the list, then filling "Image1" with a new image (during the next image acquisition) I will be replacing the image stored in the list with the new image as well (as the image variable is actually just a pointer). So, my code looks a little like this: while (!exitcondition) { if(ImageAvailabe()) { Image1 = AcquireImage(); ImgList.Add(Image1); } if(ImgList.Count 0) { ProcessEngine.NewImage(ImgList[0]); ImgList.RemoveAt(0); } } Given the above, how can I ensure that: - I don't replace all items in the list every time Image1 is modified. - I don't need to pre-declare a number of images in order to do this kind of processing. - I don't create a memory devouring monster. Any advice is greatly appreciated.

    Read the article

  • array of structures, or structure of arrays?

    - by Jason S
    Hmmm. I have a table which is an array of structures I need to store in Java. The naive don't-worry-about-memory approach says do this: public class Record { final private int field1; final private int field2; final private long field3; /* constructor & accessors here */ } List<Record> records = new ArrayList<Record>(); If I end up using a large number ( 106 ) of records, where individual records are accessed occasionally, one at a time, how would I figure out how the preceding approach (an ArrayList) would compare with an optimized approach for storage costs: public class OptimizedRecordStore { final private int[] field1; final private int[] field2; final private long[] field3; Record getRecord(int i) { return new Record(field1[i],field2[i],field3[i]); } /* constructor and other accessors & methods */ } edit: assume the # of records is something that is changed infrequently or never I'm probably not going to use the OptimizedRecordStore approach, but I want to understand the storage cost issue so I can make that decision with confidence. obviously if I add/change the # of records in the OptimizedRecordStore approach above, I either have to replace the whole object with a new one, or remove the "final" keyword. kd304 brings up a good point that was in the back of my mind. In other situations similar to this, I need column access on the records, e.g. if field1 and field2 are "time" and "position", and it's important for me to get those values as an array for use with MATLAB, so I can graph/analyze them efficiently.

    Read the article

  • Starting Beyond Compare from the Command Line

    - by Logan
    I have Beyond Compare 3 installed at; "C:\Program Files\Beyond Compare 3\BCompare.exe" and Cygwin; "C:\Cygwin\bin\bash.exe" What I would like is to be able to use a command such as; diff <file1> <file2> into the Cygwin shell and to have the shell fork a process opening the two files in beyond compare. I looked at the Beyond Compare Support Page but I'm afraid It was too brief for me. I tried copying the text verbatim (apart from path to executable) to no avail; Instead of using a batch file, create a file named "bc.sh" with the following line: "$(cygpath 'C:\Progra~1\Beyond~1\bcomp.exe')" `cygpath -w "$6"` `cygpath -w "$7"` /title1="$3" /title2="$5" /readonly Was I supposed to replace cygpath? I get a 'Command not found' error when I enter the name of the script on the command line. gavina@whwgavina1 /cygdrive $ "C:\Documents and Settings\gavina\Desktop\bc.sh" bash: C:\Documents and Settings\gavina\Desktop\bc.sh: command not found Does anyone have Beyond Compare working as I have described? Is this even possible in a Windows environment? Thanks in advance!

    Read the article

  • Trying to use jquery ui in google chrome extension in the content level

    - by user135697
    The problem is that the scope of the content script is on the web page that your plugin is suppose to be used at. So the css background:url(images/ui-bg_inset-hard_100_fcfdfd_1x100.png) becomes url('http://webpageforplugin/images/ui-bg_inset-hard_100_fcfdfd_1x100.png') in order for this to work as far as i understood i need to have it to point to: url('chrome-extension://extensionId/images/ui-bg_inset-hard_100_fcfdfd_1x100.png') So i tried to haxorz the document.styleSheets var ss = document.styleSheets; for (var i=0; i<ss.length; i++) { var found=-1, x,i; var rules = ss[i].cssRules || ss[i].rules; for (var j=0; j<rules.length; j++) { if ('.ui-helper-hidden'==rules[j].selectorText){ found=i; break; } } if (found>-1){ for (var j=0; j<rules.length; j++) { if (x=rules[j].style.background){ if ((i=x.indexOf('url'))!=-1) rules[j].style.background = x.replace('http://page/images/','chrome-extension://extensionId/images/'); } } break; } }; I feel that i'm missing the obvious. That there must be an easier way. Even if i manage to change this how will i get the extension id to build the string. Btw this doesn't work, the icons are not properly fetched. (I hardcoded the extension id) Any ideas?

    Read the article

  • Question about the evolution of interaction paradigm between web server program and content provider program?

    - by smwikipedia
    Hi experts, In my opinion, web server is responsible to deliver content to client. If it is static content like pictures and static html document, web server just deliver them as bitstream directly. If it is some dynamic content that is generated during processing client's request, the web server will not generate the conetnt itself but call some external proram to genearte the content. AFAIK, this kind of dynamice content generation technologies include the following: CGI ISAPI ... And from here, I noticed that: ...In IIS 7, modules replace ISAPI filters... Is there any others? Could anyone help me complete the above list and elabrate on or show some links to their evolution? I think it would be very helpful to understand application such as IIS, TomCat, and Apache. I once wrote a small CGI program, and though it serves as a content generator, it is still nothing but a normal standalone program. I call it normal because the CGI program has a main() entry point. But with the recenetly technology like ASP.NET, I am not writing complete program, but only some class library. Why does such radical change happens? Many thanks.

    Read the article

  • Asp.Net MVC - Binding of parameter to model value!

    - by Pino
    This seems like the model binding is causing me issues. Essentially I have a model called ProductOption and for the purpose of this question it has 2 fields ID (Int) PK ProductID (Int) FK I have a standard route set-up context.MapRoute( "Product_default", "Product/{controller}/{action}/{id}", new { controller = "Product", action = "Index", id = UrlParameter.Optional } ); and if the user wants to add an option the URL is, /Product/Options/Add/1 in the above URL 1 is the ProductID, I have the following code to return a blank model the the view, [HttpGet] public ActionResult Add(int id) { return View("Manage", new ProductOptionModel() { ProductID = id }); } Now in my view I keep a hidden field <%= Html.HiddenFor(x=>x.ID) %> This is used to determine (on submit) if we are editing or adding a new option. However the Model binder in .net seems to replace .ID (Which was 0 when leaving the above get actionresult) with 1 (or the value of the id parameter in the URL) How can I stop or work around this? ViewModel public class ProductExtraModel { //Database public int ID { get; set; } public string Name { get; set; } public int ProductID { get; set; } public ProductModel Product { get; set; } }

    Read the article

  • Python 3.3 Webserver restarting problems

    - by IPDGino
    I have made a simple webserver in python, and had some problems with it before as described here: Python (3.3) Webserver script with an interesting error In that question, the answer was to use a While True: loop so that any crashes or errors would be resolved instantly, because it would just start itself again. I've used this for a while, and still want to make the server restart itself every few minutes, but on Linux for some reason it won't work for me. On windows the code below works fine, but on linux it keeps saying Handler class up here ... ... class Server: def __init__(self): self.server_class = HTTPServer self.server_adress = ('MY IP GOES HERE, or localhost', 8080) global httpd httpd = self.server_class(self.server_adress, Handler) self.main() def main(self): if count > 1: global SERVER_UP_SINCE HOUR_CHECK = int(((count - 1) * RESTART_INTERVAL) / 60) SERVER_UPTIME = str(HOUR_CHECK) + " MINUTES" if HOUR_CHECK > 60: minutes = int(HOUR_CHECK % 60) hours = int(HOUR_CHECK // 60) SERVER_UPTIME = ("%s HOURS, %s MINUTES" % (str(hours), str(minutes))) SERVING_ON_ADDR = self.server_adress SERVER_UP_SINCE = str(SERVER_UP_SINCE) SERVER_RESTART_NUMBER = count - 1 print(""" SERVER INFO ------------------------------------- SERVER_UPTIME: %s SERVER_UP_SINCE: %s TOTAL_FILES_SERVED: %d SERVING_ON_ADDR: %s SERVER_RESTART_NUMBER: %s \n\nSERVER HAS RESTARTED """ % (SERVER_UPTIME, SERVER_UP_SINCE, TOTAL_FILES, SERVING_ON_ADDR, SERVER_RESTART_NUMBER)) else: print("SERVER_BOOT=1\nSERVER_ONLINE=TRUE\nRESTART_LOOP=TRUE\nSERVING_ON_ADDR:%s" % str(self.server_adress)) while True: try: httpd.serve_forever() except KeyboardInterrupt: print("Shutting down...") break httpd.shutdown() httpd.socket.close() raise(SystemExit) return def server_restart(): """If you want the restart timer to be longer, replace the number after the RESTART_INTERVAL variable""" global RESTART_INTERVAL RESTART_INTERVAL = 10 threading.Timer(RESTART_INTERVAL, server_restart).start() global count count = count + 1 instance = Server() if __name__ == "__main__": global SERVER_UP_SINCE SERVER_UP_SINCE = strftime("%d-%m-%Y %H:%M:%S", gmtime()) server_restart() Basically, I make a thread to restart it every 10 seconds (For testing purposes) and start the server. After ten seconds it will say File "/home/username/Desktop/Webserver/server.py", line 199, in __init__ httpd = self.server_class(self.server_adress, Handler) File "/usr/lib/python3.3/socketserver.py", line 430, in __init__ self.server_bind() File "/usr/lib/python3.3/http/server.py", line 135, in server_bind socketserver.TCPServer.server_bind(self) File "/usr/lib/python3.3/socketserver.py", line 441, in server_bind self.socket.bind(self.server_address) OSError: [Errno 98] Address already in use As you can see in the except KeyboardInterruption line, I tried everything to make the server stop, and the program stop, but it will NOT stop. But the thing I really want to know is how to make this server able to restart, without giving some wonky errors.

    Read the article

  • Java function changing input

    - by Doodle
    I would like to go from one number to another. For example if I started at 6 and my goal was 10 I want a function that on every pass would bring me from 6 towards 10 or if I had the number 14 and my goal was 9 it would count down from 14 towards 9.So far I have (this is written in Processing a Java Api but there is essentially no difference from regualr Java, draw is just a continuous loop) int x=100; void draw(){ x=towards(x,10); println(x); } int towards(int current ,int target){ if(current!=target){ if (current <target){ current=current+1; } else { current=current-1; } } return current; } this gives me the results I would like but I would like to have everything in side of the towards() function. When I replace X with a variable it of course resets it self to the static variable. To sum it up how can I pass a variable to a function and have that variable thats been passed change on every subsequent pass. I have looked into recursion as a solution but that of just brings me to a final solution. I can pass the count to an array but wouldn't like to do that either.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • problems with async jquery and loops

    - by Seth Vargo
    I am so confused. I am trying to append portals to a page by looping through an array and calling a method I wrote called addModule(). The method gets called the right number of times (checked via an alert statement), in the correct order, but only one or two of the portals actually populate. I have a feeling its something with the loop and async, but it's easier explained with the code: moduleList = [['weather','test'],['test']]; for(i in moduleList) { $('#content').append(''); for(j in moduleList[i]) { addModule(i,moduleList[i][j]); //column,name } } function addModule(column,name) { alert('adding module ' + name); $.get('/modules/' + name.replace(' ','-') + '.php',function(data){ $('#'+column).append(data); }); } for each array in the main array, I append a new column, since that's what each sub-array is - a column of portals. Then I loop through that sub array and call addModule on that column and the name of that module (which works correctly). Something buggy happens in my addModule method that it only adds the first and last modules, or sometimes a middle one, or sometimes none at all... im so confused!

    Read the article

  • Removing HTML entities while preserving line breaks with JSoup

    - by shrodes
    I have been using JSoup to parse lyrics and it has been great until now, but have run into a problem. I can use Node.html() to return the full HTML of the desired node, which retains line breaks as such: Gl&oacute;andi augu, silfurn&aacute;tt <br />Bl&oacute;&eth; alv&ouml;ru, starir &aacute; <br />&Oacute;&eth;ur hundur er &iacute; v&iacute;gam&oacute;&eth;, &iacute; maga... m&eacute;r <br /> <br />Kolni&eth;ur gref, kvik sem dreg h&eacute;r <br />Kolni&eth;ur svart, hvergi bjart n&eacute; But has the unfortunate side-effect, as you can see, of retaining HTML entities and tags. However, if I use Node.text(), I can get a better looking result, free of tags and entities: Glóandi augu, silfurnátt Blóð alvöru, starir á Óður hundur er í vígamóð, í maga... mér Kolniður gref, kvik sem dreg hér Kolniður svart, Which has another unfortunate side-effect of removing the line breaks and compressing into a single line. Simply replacing <br /> from the node before calling Node.text() yields the same result, and it seems that that method is compressing the text onto a single line in the method itself, ignoring newlines. Is it possible to have the best of both worlds, and have tags and entities replaced correctly which preserving the line breaks, or is there another method or way of decoding entities and removing tags without having to replace them manually?

    Read the article

  • Python: Copying files with special characters in path

    - by erikderwikinger
    Hi is there any possibility in Python 2.5 to copy files having special chars (Japanese chars, cyrillic letters) in their path? shutil.copy cannot handle this. here is some example code: import copy, os,shutil,sys fname=os.getenv("USERPROFILE")+"\\Desktop\\testfile.txt" print fname print "type of fname: "+str(type(fname)) fname0 = unicode(fname,'mbcs') print fname0 print "type of fname0: "+str(type(fname0)) fname1 = unicodedata.normalize('NFKD', fname0).encode('cp1251','replace') print fname1 print "type of fname1: "+str(type(fname1)) fname2 = unicode(fname,'mbcs').encode(sys.stdout.encoding) print fname2 print "type of fname2: "+str(type(fname2)) shutil.copy(fname2,'C:\\') the output on a Russian Windows XP C:\Documents and Settings\+????????????\Desktop\testfile.txt type of fname: <type 'str'> C:\Documents and Settings\?????????????\Desktop\testfile.txt type of fname0: <type 'unicode'> C:\Documents and Settings\+????????????\Desktop\testfile.txt type of fname1: <type 'str'> C:\Documents and Settings\?????????????\Desktop\testfile.txt type of fname2: <type 'str'> Traceback (most recent call last): File "C:\Test\getuserdir.py", line 23, in <module> shutil.copy(fname2,'C:\\') File "C:\Python25\lib\shutil.py", line 80, in copy copyfile(src, dst) File "C:\Python25\lib\shutil.py", line 46, in copyfile fsrc = open(src, 'rb') IOError: [Errno 2] No such file or directory: 'C:\\Documents and Settings\\\x80\ xa4\xac\xa8\xad\xa8\xe1\xe2\xe0\xa0\xe2\xae\xe0\\Desktop\\testfile.txt'

    Read the article

  • Is there a FAST way to export and install an app on my phone, while signing it with my own keystore?

    - by Alexei Andreev
    So, I've downloaded my own application from the market and installed it on my phone. Now, I am trying to install a temporary new version from Eclipse, but here is the message I get: Re-installation failed due to different application signatures. You must perform a full uninstall of the application. WARNING: This will remove the application data! Please execute 'adb uninstall com.applicationName' in a shell. Launch canceled! Now, I really really don't want to uninstall the application, because I will lose all my data. One solution I found is to Export my application, creating new .apk, and then install it via HTC Sync (probably a different program based on what phone you have). The problem is this takes a long time to do, since I need to enter the password for the keystore each time and then wait for HTC Sync. It's a pain in the ass! So the question is: Is there a way to make Eclipse automatically use my keystore to sign the application (quickly and automatically)? Or perhaps to replace debug keystore with my own? Or perhaps just tell it to remember the password, so I don't have to enter it every time...? Or some other way to solve this problem?

    Read the article

  • XAML get new width and height for Canvas

    - by Jack Navarro
    I have searched through many times but have not seen this before. Probably really simple question but can't wrap my head around it. Wrote a VSTO add-in for Excel that draws a Grid dynamically. Then launches a new window and replaces the contents of the Canvas with the generated Grid. The problem is with printing. When I call the print procedure the canvas.height and canvas.width returned is the old value prior to replacing it with the grid. Sample: string="<Grid Name=\"CanvasGrid\" xmlns=\"http://schemas.microsoft.com/winfx/2006/xaml/presentation\">..Lots of stuff..</Grid>"; // Launch new window and replace the Canvas element WpfUserControl newWindow = new WpfUserControl(); newWindow.Show(); //To test MessageBox.Show(myCanvas.ActualWidth.ToString()); //return 894 Grid testGrid = myCanvas.FindName("CanvasGrid") as Grid; MessageBox.Show("Grid " + testGrid.ActualWidth.ToString()); //return 234 StringReader stringReader = new StringReader(LssAllcChrt); XmlReader xmlReader = XmlReader.Create(stringReader); Canvas myCanvas = newWindow.FindName("GrphCnvs") as Canvas; myCanvas.Children.Clear(); myCanvas.Children.Add((UIElement)XamlReader.Load(xmlReader)); //To test MessageBox.Show(myCanvas.ActualWidth.ToString()); //return 894 but should be much larger the Grid spans all three of my screens Grid testGrid = myCanvas.FindName("CanvasGrid") as Grid; MessageBox.Show("Grid " + testGrid.ActualWidth.ToString()); //return 234 but should be much larger the Grid spans all three of my screens //Run code from WpfUserControl.cs after it loads from button click Grid testGrid = canvas.FindName("CanvasGrid") as Grid; MessageBox.Show("Grid " + testGrid.ActualWidth.ToString()); //return 234 but should be much larger the Grid spans all three of my screens So basically I have no way of telling what my new width and height are.

    Read the article

  • Is it possible to refer to metadata of the target from within the target implementation in MSBuild?

    - by mark
    Dear ladies and sirs. My msbuild targets file contains the following section: <ItemGroup> <Targets Include="T1"> <Project>A\B.sln"</Project> <DependsOnTargets>The targets T1 depends on</DependsOnTargets> </Targets> <Targets Include="T2"> <Project>C\D.csproj"</Project> <DependsOnTargets>The targets T2 depends on</DependsOnTargets> </Targets> ... </ItemGroup> <Target Name="T1" DependsOnTargets="The targets T1 depends on"> <MSBuild Projects="A\B.sln" Properties="Configuration=$(Configuration)" /> </Target> <Target Name="T2" DependsOnTargets="The targets T2 depends on"> <MSBuild Projects="C\D.csproj" Properties="Configuration=$(Configuration)" /> </Target> As you can see, A\B.sln appears twice: As Project metadata of T1 in the ItemGroup section. In the Target statement itself passed to the MSBuild task. I am wondering whether I can remove the second instance and replace it with the reference to the Project metadata of the target, which name is given to the Target task? Exactly the same question is asked for the (Targets.DependsOnTargets) metadata. It is mentioned twice much like the %(Targets.Project) metadata. Thanks. EDIT: I should probably describe the constraints, which must be satisfied by the solution: I want to be able to build individual projects with ease. Today I can simply execute msbuild file.proj /t:T1 to build the T1 target and I wish to keep this ability. I wish to emphasize, that some projects depend on others, so the DependsOnTargets attribute is really necessary for them.

    Read the article

  • -[UITableViewRowData isEqualToString:]: unrecognized selector sent to instance 0x391dce0

    - by tak
    I have a datatable which shows the list of contacts. when I start the application all the data is loaded correctly.But after selecting a contact, I am sometimes getting this exception :- Program received signal: “EXC_BAD_ACCESS”. and sometimes -[UITableViewRowData isEqualToString:]: unrecognized selector sent to instance 0x391dce0 most probably for this code:- - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithStyle:UITableViewCellStyleDefault reuseIdentifier:CellIdentifier] autorelease]; } ExpenseTrackerAppDelegate *appDelegate = (ExpenseTrackerAppDelegate *)[[UIApplication sharedApplication] delegate]; Person *person = (Person *)[appDelegate.expensivePersonsList objectAtIndex:indexPath.row]; NSString *name = (NSString *)[NSMutableString stringWithFormat:@"%@ %@" ,person.lastName , person.firstName]; cell.textLabel.text = name; //cell.detailTextLabel.text = person.lastName; // Configure the cell. return cell; } If I replace these lines of code NSString *name = (NSString *)[NSMutableString stringWithFormat:@"%@ %@" ,person.lastName , person.firstName]; cell.textLabel.text = name; with this code cell.textLabel.text = person.lastName; then everything works fine? I dont know what exactly happens?

    Read the article

  • How can I move TinyMCE's toolbar into a modal popup?

    - by Nate Wagar
    I'm using TinyMCE & jQuery and am having a problem moving TinyMCE's external toolbar to another location in the DOM. To further complicate things, there are multiple TinyMCE instances on the page. I only want the toolbar for the one that's currently being edited. Here's some sample code: $(textarea).tinymce({ setup: function(ed) {setupMCEToolbar(ed, componentID, displaySettingsPane)} ,script_url: '/clubs/data/shared/scripts/tiny_mce/tiny_mce.js' ,theme : "advanced" ,plugins : "safari,pagebreak,style,layer,table,save,advhr,advimage,advlink,emotions,iespell,inlinepopups,insertdatetime,preview,media,searchreplace,print,contextmenu,paste,directionality,fullscreen,noneditable,visualchars,nonbreaking,xhtmlxtras,template" ,theme_advanced_buttons1 : "save,newdocument,|,bold,italic,underline,strikethrough,|,justifyleft,justifycenter,justifyright,justifyfull,styleselect,formatselect,fontselect,fontsizeselect" ,theme_advanced_buttons2 : "cut,copy,paste,pastetext,pasteword,|,search,replace,|,bullist,numlist,|,outdent,indent,blockquote,|,undo,redo,|,link,unlink,anchor,image,cleanup,help,code,|,insertdate,inserttime,preview,|,forecolor,backcolor" ,theme_advanced_buttons3 : "tablecontrols,|,hr,removeformat,visualaid,|,sub,sup,|,charmap,emotions,iespell,media,advhr,|,print,|,ltr,rtl,|,fullscreen" ,theme_advanced_buttons4 : "insertlayer,moveforward,movebackward,absolute,|,styleprops,|,cite,abbr,acronym,del,ins,attribs,|,visualchars,nonbreaking,template,pagebreak" ,theme_advanced_toolbar_location : "external" ,theme_advanced_toolbar_align : "left" ,theme_advanced_statusbar_location : "bottom" ,theme_advanced_resizing : true }); var setupMCEToolbar = function (mce, componentID, displaySettingsPane) { mce.onClick.add(function(ed,e){ displaySettingsPane($('#' + componentID)); $('#' + componentID).fetch('.mceExternalToolbar').eq(0).appendTo('#settingsPaneContent'); }); } Basically, it seems as though the setupMCEToolbar function cannot track down the mceExternalToolbar to move it. Has anyone ever had success trying to do something like this? EDIT It's a Monday alright... it couldn't find the external toolbar because I was using children() instead of fetch(). There's still an issue in that: 1) Moving it is incredibly slow and 2) Once it moves, TinyMCE breaks. EDIT 2 A bit more clarification: The modal is draggable, thus making any purely-CSS workarounds a bit awkward...

    Read the article

  • Given a typical Rails 3 environment, why am I unable to execute any tests?

    - by Tom
    I'm working on writing simple unit tests for a Rails 3 project, but I'm unable to actually execute any tests. Case in point, attempting to run the test auto-generated by Rails fails: require 'test_helper' class UserTest < ActiveSupport::TestCase # Replace this with your real tests. test "the truth" do assert true end end Results in the following error: <internal:lib/rubygems/custom_require>:29:in `require': no such file to load -- test_helper (LoadError) from <internal:lib/rubygems/custom_require>:29:in `require' from user_test.rb:1:in `<main>' Commenting out the require 'test_helper' line and attempting to run the test results in this error: user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) The action pack gems appear to be properly installed and up to date: actionmailer (3.0.3, 2.3.5) actionpack (3.0.3, 2.3.5) activemodel (3.0.3) activerecord (3.0.3, 2.3.5) activeresource (3.0.3, 2.3.5) activesupport (3.0.3, 2.3.5) Ruby is at 1.9.2p0 and Rails is at 3.0.3. The sample dump of my test directory is as follows: /fixtures /functional /integration /performance /unit -- /helpers -- user_helper_test.rb -- user_test.rb test_helper.rb I've never seen this problem before - I've run the typical rake tasks for preparing the test environment. I have nothing out of the ordinary in my application or environment configuration files, nor have I installed any unusual gems that would interfere with the test environment. Edit Xavier Holt's suggestion, explicitly specifying the path to the test_helper worked; however, this revealed an issue with ActiveSupport. Now when I attempt to run the test, I receive the following error message (as also listed above): user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) But as you can see above, Action Pack is all installed and update to date.

    Read the article

  • How use unobtrusive validation without a model

    - by Ross Cyrus
    i have simple a form wich made by htmlHelper(mvc3) then inside of it i have 2 input field 1:type=text 2:type=submit to submit the form. there is no model behind.so i need to perfom a clientside validation on the textfield before submit it to the server.but i dont know how. i tried this puting manualy the 'data-* artibute , but does not work : @using( Html.BeginForm()) { <label for="UserName" >User Name</label> <div class="editor-field"> <input type="text" data-val="true" data-val-requierd="You must provide an user Name" id="userName" name="userName" placeholder="Enter Your User Name" /> </div> <input type="submit" value="Recover" /> } the "jquery.validate.min.js" and jquery.validate.unobtrusive.min.js and jquery.validate.min.js and jquery.validate.unobtrusive.min.js are loaded to the page. It doesnt let me to answer my self ,so i put it here : I solve it my self,just made an other view wich has its own model and Required on its propertyis and then just copy the renderd html to my own,and i got this and works : <input data-val="true" data-val-required="You must provide an user Name" id="UserName" name="UserName" type="text" value="" placeholder="Enter your User Name"/> <span class="field-validation-valid" data-valmsg-for="UserName" data-valmsg-replace="true"></span> And there is no type="Required".any way thank you guys.

    Read the article

  • is it better to test if a function is needed inside or outside of it?

    - by b0x0rz
    what is the best practice? call a function then return if you test for something, or test for something then call? i prefer the test inside of function because it makes an easier viewing of what functions are called. for example: protected void Application_BeginRequest(object sender, EventArgs e) { this.FixURLCosmetics(); } and private void FixURLCosmetics() { HttpContext context = HttpContext.Current; if (!context.Request.HttpMethod.ToString().Equals("GET", StringComparison.OrdinalIgnoreCase)) { // if not a GET method cancel url cosmetics return; }; string url = context.Request.RawUrl.ToString(); bool doRedirect = false; // remove > default.aspx if (url.EndsWith("/default.aspx", StringComparison.OrdinalIgnoreCase)) { url = url.Substring(0, url.Length - 12); doRedirect = true; } // remove > www if (url.Contains("//www")) { url = url.Replace("//www", "//"); doRedirect = true; } // redirect if necessary if (doRedirect) { context.Response.Redirect(url); } } is this good: if (!context.Request.HttpMethod.ToString().Equals("GET", StringComparison.OrdinalIgnoreCase)) { // if not a GET method cancel url cosmetics return; }; or should that test be done in Application_BeginRequest? what is better? thnx

    Read the article

  • Django + jquery : getting 301

    - by llazzaro
    Hello, I have tabs that calls via javascript urls of django to complete the "container" But i am getting 301, any idea why this is happening? Server misconfiguration? urls.py urlpatterns = patterns('', (r'^admin/', include(admin.site.urls)), (r'^list/', 'carsproj.cars.views.list'), ) view def list(request): if request.is_ajax(): return render_to_response('templates/generic_list.html', { 'items' : Cars.objects.all(), 'name' : 'List - Cars' }, context_instance = RequestContext(request)) javascript the_tabs.click(function(e){ var element = $(this); if(element.find('#overLine').length) return false; var bg = element.attr('class').replace('tab ',''); $('#overLine').remove(); $('<div>',{ id:'overLine', css:{ display:'none', width:element.outerWidth()-2, background:topLineColor[bg] || 'white' }}).appendTo(element).fadeIn('slow'); if(!element.data('cache')) { $('#contentHolder').html('<img src="/media/img/ajax_preloader.gif" width="64" height="64" class="preloader" />'); $.get(element.data('page'),function(msg){ $('#contentHolder').html(msg); element.data('cache',msg); }); } else $('#contentHolder').html(element.data('cache')); e.preventDefault(); }) Please tell me what more information you need, js code? template? url.py? I WILL EDIT THIS POST FOR ADD MORE DATA

    Read the article

  • Is it possible to guarantee a unique id for multiple items using the same id variable at a point in

    - by Scarface
    First of all, do not be overwhelmed by the long code, I just put it for reference...I have a function that preg_replaces content and puts it in a jquery dialog box with a matching open-link. For example, if there is a paragraph with two matches, they will be put inside two divs, and a jquery dialog function will be echoed twice; one for each div. While this works for one match, if there are multiple matches, it does not. I am not sure how to distribute unique ids at a point in time for each of the divs and matching dialog open-scripts. Keep in mind, I removed the preg replace function since it kind of complicates the problem. If anyone has any ideas, they will be greatly appreciated. <?php $id=uniqid(); $id2=uniqid(); echo "<div id=\"$id2\"> </div>"; ?> $.ui.dialog.defaults.bgiframe = true; $(function() { $("<?php echo"#$id2"; ?>").dialog({hide: 'clip', modal: true ,width: 600,height: 350,position: 'center', show: 'clip',stack: true,title: 'title', minHeight: 25, minWidth: 100, autoOpen: false}); $('<?php echo"#$id"; ?>').click(function() { $('<?php echo"#$id2"; ?>').dialog('open'); }) .hover( function(){ $(this).addClass("ui-state-hover"); }, function(){ $(this).removeClass("ui-state-hover"); } ).mousedown(function(){ $(this).addClass("ui-state-active"); }) .mouseup(function(){ $(this).removeClass("ui-state-active"); }); });

    Read the article

< Previous Page | 241 242 243 244 245 246 247 248 249 250 251 252  | Next Page >