Search Results

Search found 7529 results on 302 pages for 'replace'.

Page 245/302 | < Previous Page | 241 242 243 244 245 246 247 248 249 250 251 252  | Next Page >

  • What does it mean to double license?

    - by Adrian Panasiuk
    What does it mean to double license code? I can't just put both licenses in the source files. That would mean that I mandate users to follow the rules of both of them, but the licenses will probably be contradictory (otherwise there'd be no reason to double license). I guess this is something like in cryptographic chaining, cipher = crypt_2(crypt_1(clear)) (generally) means, that cipher is neither the output of crypt_2 on clear nor the output of crypt_1 on clear. It's the output of the composition. Likewise, in double-licensing, in reality my code has one license, it's just that this new license says please follow all of the rules of license1, or all of the rules of license2, and you are hereby granted the right to redistribute this application under this "double" license, license1 or license2, or any license under which license1 or license2 allow you to redistribute this software, in which case you shall replace the relevant licensing information in this application with that of the new license. (Does this mean that before someone may use the app under license1, he has to perform the operation of redistributing to self? How would he document the fact that he did that operation?) Am I correct. What LICENSE file and what text to put in the source files would I need if I wanted to double license on, for the sake of example, Apachev2 and GPLv3 ?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • jQuery dynamic css loading weired behavior

    - by jimpsr
    The app I am working on requires dynamic loading of css and js, right now the solution is as follows: myapp.loadCss = function(css){ $("head").append("<link>"); cssDom = $("head").children(":last"); cssDom.attr({rel: "stylesheet", type: "text/css", href: css }); } myapp.loadJs = funciton(js){ ... //$.ajax call is used in synchronized mode to make sure the js is fully loaded } } When some widgets need to be load, the usual call with be myapp.loadCss('/widgets/widget1/css/example.css'); myapp.loadJs('/wiggets/widget1/js/example.js'); The weired thing is that once a while (1 out of 10 or 20), the newly created dom elements from example.js will not be able to get its css from example.css, it seems however my loadCss method does not load the css in a synchronized mode? I have tried to replace my loadCss with the the following code: myapp.loadCss(css){ $('<link href="' + css + '" rel="stylesheet" type="text/css" />').appendTo($('head')); } It seems to be OK then (I refreshed the webpage a hundred times for verification :-( ) But unfortunately this method failed in IE(IE7, not tested in IE6, 8) Is there any better solution for this?

    Read the article

  • Visual C++ overrides/mock objects for unit testing?

    - by Mark
    When I'm running unit tests, I want to be able to "stub out" or create a mock object, but I'm running into DLL Hell. For example: There are two DLL libraries built: A.dll and B.dll -- Classes in A.dll have calls to classes in B.dll so when A.dll was built, the link line was using B.lib for the defintions. My test driver (Foo.exe) is testing classes in A.dll, so it links against A.lib. However, I want to "stub out" some of the calls A.dll makes to B.dll with simple versions (return basic value, no DB look up, etc). I can't build an Override.dll that just overrides the needed methods (not entire classes) and replace B.dll because Foo.exe will A) complain that B.dll is missing if I just remove it and put Override.dll in it's place or B) if I rename Override.dll to B.dll, Foo.exe complains that there are unresolved symbols because Override.dll is not a complete implementation of B.dll. Is there a way to do this? Is there a way to statically link Foo.exe with A.lib, B.lib and Override.lib such that it will work without having to completely rebuild A.lib and B.lib to remove the __delcspec(dllexport)? Is there another option?

    Read the article

  • sql server mdf file database attachment

    - by jnsohnumr
    hello all i'm having a bear of a time getting visual studio 2010 (ultimate i think) to properly attach to my database. it was moved from original spot to #MYAPP#/#MYAPP#.Web/App_Data/#MDF_FILE#.mdf. I have three instances of sql server running on this machine. i have tried to replace the old mdf file with my new one and cannot get the connectionstring right for it. what i'm really wanting to do is to just open some DB instance, run a DB create script. Then I can have a DB that was generated via my edmx (generate database from model) in silverlight business application (c#) right now, when i go to server explorer in VS, choose add new connection, choose MS SQL Server Database FIle (SqlClient), choose my file location (app_data directory), use windows authentication, and hit the Test Connection button I get the following error: Unable to open the physical file "". Operating system error 5: "5(Access Denied.)". An attempt to attach to an auto-named database for file"" failed. A database with the same name exists, or specified file cannot be opened, or it is located on UNC share. The mdf file was created on the same machine by connecting to (local) on the sql server management studio, getting a new query, pasting in the SQL from the generated ddl file, adding a CREATE DATABASE [NcrCarDatabase]; GO before the pasted SQL, and executing the query. I then disconnected from the DB in management studio, closed management studio, navigated to the DATA directory for that instance, and copying the mdf and ldf files to my application's app_data folder. I am then trying to connect to the same file inside visual studio. I hope that gives more clarity to my problems :). Connection string is: Data Source=.\SQLEXPRESS;AttachDbFilename=C:\SourceCode\NcrCarDatabase\NcrCarDatabase.Web\App_Data\NcrCarDatabase.mdf;Integrated Security=True;Connect Timeout=30;User Instance=True

    Read the article

  • How do I reference my MainViewController from another class?

    - by todd412
    Hi, I am building an iPhone Utility app that uses UIImageView to display an animation. Within the MainViewController's viewDidLoad() method, I am creating an instance of a CustomClass, and then setting up the animations: - (void)viewDidLoad { [super viewDidLoad]; cc = [CustomClass new]; NSArray * imageArray = [[NSArray alloc] initWithObjects: [UIImage imageNamed:@"image-1-off.jpg"], [UIImage imageNamed:@"image-2-off.jpg"], [UIImage imageNamed:@"image-3-off.jpg"], [UIImage imageNamed:@"image-4-off.jpg"], nil]; offSequence = [[UIImageView alloc] initWithFrame:CGRectMake(0, 0, 320, 480)]; offSequence.animationImages = imageArray; offSequence.animationDuration = .8; offSequence.contentMode = UIViewContentModeBottomLeft; [self.view addSubview:offSequence]; [offSequence startAnimating]; } That works fine. However, I would like to be able to move all the above code that sets up the UIImageView into my CustomClass. The problem is in the second to last line: [self.view addSubview:offSequence]; I basically need to replace 'self' with a reference to the MainControllerView, so I can call addSubview from within my CustomClass. I tried creating an instance var of CustomClass called mvc and a setter method that takes a reference to the MainViewController as an argument as such: - (void) setMainViewController: (MainViewController *) the_mvc { mvc = the_mvc; } And then I called it within MainViewController like so: [cc setMainController:MainViewController:self]; But this yields all sorts of errors which I can post here, but it strikes me that I may be overcomplicating this. Is there an easier way to reference the MainViewController that instanatiated my CustomClass?

    Read the article

  • Matlab GUI - How to get the previous value entered from a callback function?

    - by Graham
    Hi, I know that this is probably a simple problem but I am new to Matlab GUI's and basically want to get the old value which used to be stored in the text box to replace the value which has just been entered. E.g. Text box contains a valid string, User enters invalid string, Callback func, validates input and realises new input is an error and reverts to the old previous value. How should this be implemented or done? Atm I am just using the get and set property values. Below is some sample code: function sampledist_Callback(hObject, eventdata, handles) % hObject handle to sampledist (see GCBO) % eventdata reserved - to be defined in a future version of MATLAB % handles structure with handles and user data (see GUIDATA) % Hints: get(hObject,'String') returns contents of sampledist as text % str2double(get(hObject,'String')) returns contents of sampledist as a double input = str2double(get(hObject,'String')); if(input < 0 || input > 500) errordlg('Sampled Dist. must be > 0 and < 500','Sample Dist - Input Error'); set(handles.sampledist,'String',['10']); %<--- I would like this value 10 to be the previous entry! guidata(hObject,handles); else set(handles.sampledist,'String',['',input]); guidata(hObject,handles); end

    Read the article

  • Replacement for Hamachi for SVN access

    - by Piers
    My company has been using Hamachi to access our SVN repository for a number of years. We are a small yet widely distributed development team with each programmer in a different country working from home. The server is hosted by a non-techie in our central office. Hamachi is useful here since it has a GUI and supports remote management. This system worked well for a while, but recently I have moved to a country with poor internet speeds. Hamachi will no longer connect 99% of the time - instead I get a "Probing..." message that doesn't resolve. It's certain to be a latency issue, as the same laptop will connect without problems when I cross the border and connect using a different ISP with better speeds. So I really need to replace Hamachi with some other VPN/protocol that handles latency better. The techie managing the repository is not comfortable installing and configuring Apache or IIS, so it looks like HTTP is out. I tried to convince my boss to go for a web hosting company, but he doesn't trust a 3rd party with our source. Any other recommended options / experiences out there for accessing our SVN repos that would be as simple as Hamachi for setup; but be more tolerant of network latency issues?

    Read the article

  • jQuery cycle floats on top of other content

    - by Angie Dubis
    I tried to replace my Flash video with a jQuery cycle. The cycle works, but the images will not stay in the editable region I placed them in. Instead they are floating on top of other content. Any ideas? This is happening on the home page of massageeducator.com There are 2 cycles on the page. “Slideshow1” and “slideshow2”. “slideshow1” works perfectly. The only thing I did differently was set up “slideshow2” as a library item since it will appear on every page, but added function code manually. I tried adding code and images via the template and had the same issue. I also tried adding both the function code and slideshow to each page instead of library item - same problem. I have both slide shows pointing to the same jquery.cycle.lite.1.0.js. Should I rename this .js file and have each cycle point to a different file? I am new to jQuery so any help is appreciated. I can't seem to post my code due to the spam filters in here!

    Read the article

  • Mongodb - how to deserialze when a property has an Interface return type

    - by Mark Kelly
    I'm attempting to avoid introducing any dependencies between my Data layer and client code that makes use of this layer, but am running into some problems when attempting to do this with Mongo (using the MongoRepository) MongoRepository shows examples where you create Types that reflect your data structure, and inherit Entity where required. Eg. [CollectionName("track")] public class Track : Entity { public string name { get; set; } public string hash { get; set; } public Artist artist { get; set; } public List<Publish> published {get; set;} public List<Occurence> occurence {get; set;} } In order to make use of these in my client code, I'd like to replace the Mongo-specific types with Interfaces, e.g: [CollectionName("track")] public class Track : Entity, ITrackEntity { public string name { get; set; } public string hash { get; set; } public IArtistEntity artist { get; set; } public List<IPublishEntity> published {get; set;} public List<IOccurenceEntity> occurence {get; set;} } However, the Mongo driver doesn't know how to treat these interfaces, and I understandably get the following error: An error occurred while deserializing the artist property of class sf.data.mongodb.entities.Track: No serializer found for type sf.data.IArtistEntity. --- MongoDB.Bson.BsonSerializationException: No serializer found for type sf.data.IArtistEntity. Does anyone have any suggestions about how I should approach this?

    Read the article

  • Is there any way to filter certain things in pages served by IIS?

    - by Ruslan
    Hello, This is my first time posting here so please keep that in mind... I'll try to be short and get right to defining the problem. We have an ASP.NET 2 application (eCommerce package) running on IIS (Windows Server 2003). The main site's page(s) are using plain HTTP (no SSL), but the whole checkout process and the shopping cart page is using SSL (HTTPS). Now, the problem is that the site's header is located in a template file, and inside it it has a plain HTML 'img' tag calling an image with the "http://" portion hard-coded into it... This header appears on absolutely every page (including the https pages), and due to its insecure image tag, a warning box pops up in IE on every stage of the checkout process... Now, the problem: The live application cannot be touched in any way (no changes can be made to the template (so simply changing "http://" to "//" is not an option), IIS cannot be restarted, and the website/app pool cannot be restarted). Is there any way in the world (maybe plugin for IIS or a setting somewhere) that I can filter the pages right before they are served to replace the '<img src="http://example.com/image.jpg">' with '<img src="//example.com/image.jpg">' in the final HTML? Possibly via a regular expression or something? Thanks to everybody in advance.

    Read the article

  • Is it possible to refer to metadata of the target from within the target implementation in MSBuild?

    - by mark
    Dear ladies and sirs. My msbuild targets file contains the following section: <ItemGroup> <Targets Include="T1"> <Project>A\B.sln"</Project> <DependsOnTargets>The targets T1 depends on</DependsOnTargets> </Targets> <Targets Include="T2"> <Project>C\D.csproj"</Project> <DependsOnTargets>The targets T2 depends on</DependsOnTargets> </Targets> ... </ItemGroup> <Target Name="T1" DependsOnTargets="The targets T1 depends on"> <MSBuild Projects="A\B.sln" Properties="Configuration=$(Configuration)" /> </Target> <Target Name="T2" DependsOnTargets="The targets T2 depends on"> <MSBuild Projects="C\D.csproj" Properties="Configuration=$(Configuration)" /> </Target> As you can see, A\B.sln appears twice: As Project metadata of T1 in the ItemGroup section. In the Target statement itself passed to the MSBuild task. I am wondering whether I can remove the second instance and replace it with the reference to the Project metadata of the target, which name is given to the Target task? Exactly the same question is asked for the (Targets.DependsOnTargets) metadata. It is mentioned twice much like the %(Targets.Project) metadata. Thanks. EDIT: I should probably describe the constraints, which must be satisfied by the solution: I want to be able to build individual projects with ease. Today I can simply execute msbuild file.proj /t:T1 to build the T1 target and I wish to keep this ability. I wish to emphasize, that some projects depend on others, so the DependsOnTargets attribute is really necessary for them.

    Read the article

  • Generate syntax tree for simple math operations

    - by M28
    I am trying to generate a syntax tree, for a given string with simple math operators (+, -, *, /, and parenthesis). Given the string "1 + 2 * 3": It should return an array like this: ["+", [1, ["*", [2,3] ] ] ] I made a function to transform "1 + 2 * 3" in [1,"+",2,"*",3]. The problem is: I have no idea to give priority to certain operations. My code is: function isNumber(ch){ switch (ch) { case '0': case '1': case '2': case '3': case '4': case '5': case '6': case '7': case '8': case '9': case '.': return true; break; default: return false; break; } } function generateSyntaxTree(text){ if (typeof text != 'string') return []; var code = text.replace(new RegExp("[ \t\r\n\v\f]", "gm"), ""); var codeArray = []; var syntaxTree = []; // Put it in its on scope (function(){ var lastPos = 0; var wasNum = false; for (var i = 0; i < code.length; i++) { var cChar = code[i]; if (isNumber(cChar)) { if (!wasNum) { if (i != 0) { codeArray.push(code.slice(lastPos, i)); } lastPos = i; wasNum = true; } } else { if (wasNum) { var n = Number(code.slice(lastPos, i)); if (isNaN(n)) { throw new Error("Invalid Number"); return []; } else { codeArray.push(n); } wasNum = false; lastPos = i; } } } if (wasNum) { var n = Number(code.slice(lastPos, code.length)); if (isNaN(n)) { throw new Error("Invalid Number"); return []; } else { codeArray.push(n); } } })(); // At this moment, codeArray = [1,"+",2,"*",3] return syntaxTree; } alert('Returned: ' + generateSyntaxTree("1 + 2 * 3"));

    Read the article

  • Which languages support class replacement?

    - by Alix
    Hi, I'm writing my master thesis, which deals with AOP in .NET, among other things, and I mention the lack of support for replacing classes at load time as an important factor in the fact that there are currently no .NET AOP frameworks that perform true dynamic weaving -- not without imposing the requirement that woven classes must extend ContextBoundObject or MarshalByRefObject or expose all their semantics on an interface. You can however do this in Java thanks to ClassFileTransformer: You extend ClassFileTransformer. You subscribe to the class load event. On class load, you rewrite the class and replace it. All this is very well, but my project director has asked me, quite in the last minute, to give him a list of languages that do / do not support class replacement. I really have no time to look for this now: I wouldn't feel comfortable just doing a superficial research and potentially putting erroneous information in my thesis. So I ask you, oh almighty programming community, can you help out? Of course, I'm not asking you to research this yourselves. Simply, if you know for sure that a particular language supports / doesn't support this, leave it as an answer. If you're not sure please don't forget to point it out. Thanks so much!

    Read the article

  • Hibernate 3.5.0 causes extreme performance problems

    - by user303396
    I've recently updated from hibernate 3.3.1.GA to hibernate 3.5.0 and I'm having a lot of performance issues. As a test, I added around 8000 entities to my DB (which in turn cause other entities to be saved). These entities are saved in batches of 20 so that the transactions aren't too large for performance reasons. When using hibernate 3.3.1.GA all 8000 entities get saved in about 3 minutes. When using hibernate 3.5.0 it starts out slower than with hibernate 3.3.1. But it gets slower and slower. At around 4,000 entities, it sometimes takes 5 minutes just to save a batch of 20. If I then go to a mysql console and manually type in an insert statement from the mysql general query log, half of them run perfect in 0.00 seconds. And half of them take a long time (maybe 40 seconds) or timeout with "ERROR 1205 (HY000): Lock wait timeout exceeded; try restarting transaction" from MySQL. Has something changed in hibernate's transaction management in version 3.5.0 that I should be aware of? The ONLY thing I changed to experience these unusable performance issues is replace the following hibernate 3.3.1.GA jar files: com.springsource.org.hibernate-3.3.1.GA.jar, com.springsource.org.hibernate.annotations-3.4.0.GA.jar, com.springsource.org.hibernate.annotations.common-3.3.0.ga.jar, com.springsource.javassist-3.3.0.ga.jar with the new hibernate 3.5.0 release hibernate3.jar and javassist-3.9.0.GA.jar. Thanks.

    Read the article

  • Changing where a resource is pulled during runtime?

    - by Brandon
    I have a website that goes out to multiple clients. Sometimes a client will insist on minor changes. For reasons beyond my control, I have to comply no matter how minor the request. Usually this isn't a problem, I would just create a client specific version of the user control or page and overwrite the default one during build time or make a configuration setting to handle it. Now that I am localizing the site, I'm curious about the best way to go about making minor wording changes. Lets say I have a resource file called Resources.resx that has 300 resources in it. It has a resource called Continue. English value is "Continue", the French value is "Continuez". Now one client, for whatever reason, wants it to say "Next" and "Après" and the others want to keep it the same. What is the best way to accomodate a request like this? (This is just a simple example). The only two ways I can think of is to Create another Resources.resx specific to the client, and replace the .dll during build time. Since I'd be completely replacing the dll, the new resource file would have to contain all 300 strings. The obvious problem being that I now have 2 resource files, each with 300 strings to maintain. Create a custom user control/page and change it to use a custom resource file. e.g. SignIn.ascx would be replaced during the build and it would pull its resources from ClientName.resx instead of Resources.resx. Are there any other things I could try? Is there any way to change it so that the application will always look in a ClientResources.resx file for the overridden values before actually look at the specified resource file?

    Read the article

  • Updating Android Tab Icons

    - by lnediger
    I have an activity which has a TabHost containing a set of TabSpecs each with a listview containing the items to be displayed by the tab. When each TabSpec is created, I set an icon to be displayed in the tab header. The TabSpecs are created in this way within a setupTabs() method which loops to create the appropriate number of tabs: TabSpec ts = mTabs.newTabSpec("tab"); ts.setIndicator("TabTitle", iconResource); ts.setContent(new TabHost.TabContentFactory( { public View createTabContent(String tag) { ... } }); mTabs.addTab(ts); There are a couple instances where I want to be able to change the icon which is displayed in each tab during the execution of my program. Currently I am deleting all the tabs, and calling the above code again to re-create them. mTabs.getTabWidget().removeAllViews(); mTabs.clearAllTabs(true); setupTabs(); Is there a way to replace the icon that is being displayed without deleting and re-creating all of the tabs?

    Read the article

  • How to paginate Django with other get variables?

    - by vagabond
    I am having problems using pagination in Django. Take the URL below as an example: http://127.0.0.1:8000/users/?sort=first_name On this page I sort a list of users by their first_name. Without a sort GET variable it defaults to sort by id. Now if I click the next link I expect the following URL: http://127.0.0.1:8000/users/?sort=first_name&page=2 Instead I lose all get variables and end up with http://127.0.0.1:8000/users/?page=2 This is a problem because the second page is sorted by id instead of first_name. If I use request.get_full_path I will eventually end up with an ugly URL: http://127.0.0.1:8000/users/?sort=first_name&page=2&page=3&page=4 What is the solution? Is there a way to access the GET variables on the template and replace the value for the page? I am using pagination as described in Django's documentation and my preference is to keep using it. The template code I am using is similar to this: {% if contacts.has_next %} <a href="?page={{ contacts.next_page_number }}">next</a> {% endif %}

    Read the article

  • What shall be the code in xaml which makes a particular image to act as a button?

    - by Abhi
    Dear all I am new to Silverlight. And i have to make a demo application where in designing is done by using Microsoft Expression Blend 2 and developing should be done using Visual Studio(c++). Now i am first trying to become familiar with xaml files. So i was trying to make a simple demo where in i have to create a button and that button should be replace with an png image. In order to do so i tried with the mentioned below example. But i was not able to see anything in the screen. <UserControl xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" x:Class="SilverlightApplication1.Page" Width="640" Height="480"> <Grid x:Name="LayoutRoot" Background="White"> <Button x:Name="LogoutButton" > <Button.Template> <ControlTemplate> <Image Source="SilverlightApplication1\bounce_photo.png" /> </ControlTemplate> </Button.Template> </Button> </Grid> Please let me know where i am wrong and what shall i do to obtain the result. With regards Abhineet Agarwal

    Read the article

  • Regular expression to match HTML table row ( <tr> ) NOT containing a specific value

    - by user1821136
    I'm using Notepad++ to clean up a long and messy HTML table. I'm trying to use regular expressions even if I'm a total noob. :) I need to remove all the table rows that doesn't contain a specific value (may I call that substring?). After having all the file contents unwrapped, I've been able to use the following regular expression to select, one by one, every table row with all its contents: <tr>.+?</tr> How can I improve the regular expression in order to select and replace only table rows containing, somewhere inside a part of them, that defined substring? I don't know if this does matter but the structure of every table row is the following (I've put there every HTML tag, the dots stand for standard content/values) <tr> <td> ... </td> <td> ... </td> <td> <a sfref="..." href="...">!! SUBSTRING I HAVE TO MATCH HERE !!</a> </td> <td> <img /> </td> <td> ... </td> <td> ... </td> <td> ... </td> <td> ... </td> </tr> Thanks in advance for your help!

    Read the article

  • Trie Backtracking in Recursion

    - by Darksky
    I am building a tree for a spell checker with suggestions. Each node contains a key (a letter) and a value (array of letters down that path). So assume the following sub-trie in my big trie: W / \ a e | | k k | | is word--> e e | ... This is just a subpath of a sub-trie. W is a node and a and e are two nodes in its value array etc... At each node, I check if the next letter in the word is a value of the node. I am trying to support mistyped vowels for now. So 'weke' will yield 'wake' as a suggestion. Here's my searchWord function in my trie: def searchWord(self, word, path=""): if len(word) > 0: key = word[0] word = word[1:] if self.values.has_key(key): path = path + key nextNode = self.values[key] return nextNode.searchWord(word, path) else: # check here if key is a vowel. If it is, check for other vowel substitutes else: if self.isWord: return path # this is the word found else: return None Given 'weke', at the end when word is of length zero and path is 'weke', my code will hit the second big else block. weke is not marked as a word and so it will return with None. This will return out of searchWord with None. To avoid this, at each stack unwind or recursion backtrack, I need to check if a letter is a vowel and if it is, do the checking again. I changed the if self.values.has_key(key) loop to the following: if self.values.has_key(key): path = path + key nextNode = self.values[key] ret = nextNode.searchWord(word, path) if ret == None: # check if key == vowel and replace path # return nextNode.searchWord(... return ret What am I doing wrong here? What can I do when backtracking to achieve what I'm trying to do?

    Read the article

  • using jquery selector to change attribute in variable returned from ajax request

    - by Blake
    I'm trying to pull in a filename.txt (contains html) using ajax and change the src path in the data variable before I load it into the target div. If I first load it into the div the browser first requests the broken image and I don't want this so I would like to do my processing before I load anything onto the page. I can pull the src values fine but I can't change them. In this example the src values aren't changed. Is there a way to do this with selectors or can they only modify DOM elements? Otherwise I may have to do some regex replace but using a selector will be more convenient if possible. $.ajax( { url: getDate+'/'+name+'.txt', success: function(data) { $('img', data).attr('src', 'new_test_src'); $('#'+target).fadeOut('slow', function(){ $('#'+target).html(data); $('#'+target).fadeIn('slow'); }); } }); My reason is I'm building a fully standalone javascript template system for a newsletter and since images and other things are upload via a drupal web file manager I want the content creators to keep their paths very short and simple and I can then modify them before I load in the content. This will also be distributed on a CD so I can need to change the paths for that so they still work.

    Read the article

  • Changing default compiler in Linux, using SCons

    - by ereOn
    On my Linux platform, I have several versions of gcc. Under usr/bin I have: gcc34 gcc44 gcc Here are some outputs: $ gcc --version gcc (GCC) 4.1.2 20080704 (Red Hat 4.1.2-48) $ gcc44 --version gcc44 (GCC) 4.4.0 20090514 (Red Hat 4.4.0-6) I need to use the 4.4 version of gcc however the default seems to the 4.1 one. I there a way to replace /usr/bin/gcc and make gcc44 the default compiler not using a symlink to /usr/bin/gcc44 ? The reason why I can't use a symlink is because my code will have to be shipped in a RPM package using mock. mock creates a minimal linux installation from scratch and just install the specified dependencies before compiling my code in it. I cannot customize this "minimal installation". Ideally, the perfect solution would be to install an official RPM package that replaces gcc with gcc44 as the default compiler. Is there such a package ? Is this even possible/good ? Additional information I have to use SCons (a make alternative) and it doesn't let me specify the binary to use for gcc. I will also accept any answer that will tell me how to specify the gcc binary in my SConstruct file.

    Read the article

  • What is the minimal licensable source code?

    - by Hernán Eche
    Let's suppose I want to "protect" this code about being used without attribution, patenting it, or through any open source licence... #include<stdio.h> int main (void) { int version=2; printf("\r\n.Hello world, ver:(%d).", version); return 0; } It's a little obvious or just a language definition example.. When a source stop being "trivial, banal, commonplace, obvious", and start to be something that you may claim "rights"? Perhaps it depends on who read it, something that could be great geniality for someone that have never programmed, could be just obvious for an expert. It's easy when watching two sources there are 10000 same lines of code, that's a theft.. but that's not always so obvious. How to measure amount of "ownness", it's about creativity? line numbers? complexity? I can't imagine objetive answers for that, only some patches. For example perhaps the complexity, It's not fair to replace "years of engeneering" with "copy and paste". But is there any objetive index for objetive determination of this subject? (In a funny way I imagine this criterion: If the licence is longer than the code, then there is no owner, just to punish not caring storage space and world resources =P)

    Read the article

  • Different standard streams per POSIX thread

    - by Roman Nikitchenko
    Is there any possibility to achieve different redirections for standard output like printf(3) for different POSIX thread? What about standard input? I have lot of code based on standard input/output and I only can separate this code into different POSIX thread, not process. Linux operation system, C standard library. I know I can refactor code to replace printf() to fprintf() and further in this style. But in this case I need to provide some kind of context which old code doesn't have. So doesn't anybody have better idea (look into code below)? #include <pthread.h> #include <stdio.h> void* different_thread(void*) { // Something to redirect standard output which doesn't affect main thread. // ... // printf() shall go to different stream. printf("subthread test\n"); return NULL; } int main() { pthread_t id; pthread_create(&id, NULL, different_thread, NULL); // In main thread things should be printed normally... printf("main thread test\n"); pthread_join(id, NULL); return 0; }

    Read the article

< Previous Page | 241 242 243 244 245 246 247 248 249 250 251 252  | Next Page >