Search Results

Search found 7634 results on 306 pages for 'preg replace'.

Page 249/306 | < Previous Page | 245 246 247 248 249 250 251 252 253 254 255 256  | Next Page >

  • jQuery AJAX Redirection problem

    - by meosoft
    Hello please consider this: On page A I have a link that takes you to page B when JS is off, but when JS is on, I want to replace content on current page with content from the page B. Pages A and B are in fact the same script that is able to tell AJAX calls from regular ones and serve the content appropriately. Everything works fine, as long as there are no redirects involved. But, sometimes there is a 301 redirect and what seems to be happening is that client browser then makes a second request, which will return with a 200 OK. Only the second request is sent without a X-Requested-With header, therefore I cannot tell within my script wether it came from AJAX or not, and will send a complete page instead of just the content. I have tried checking for 301 status code in my error, success, and complete handlers but none of them worked. It seems to be handling the 301 behind the scenes. Could anyone help me with this? jQuery 1.4, PHP 5 Edit: People requested the code to this, which I didn't think was necessary but here goes: // hook up menu ajax loading $('#menu a').live("click", function(){ // update menu highlight if($(this).parents('#menu').size() > 0){ $("#menu>li").removeClass("current_page_item"); $(this).parent().addClass("current_page_item"); } // get the URL where we will be retrieving content from var url = $(this).attr('href'); window.location.hash = hash = url; $.ajax({ type: "GET", url: url, success: function(data){ // search for an ID that is only present if page is requested directly if($(data).find('#maincontent').size() > 0){ data = $(data).find('#maincontent .content-slide *').get(); } // the rest is just animating the content into view $("#scroller").html(data); $('.content-slide').each(setHeight); $('.content-slide').animate({ left: "0px" }, 1000, 'easeOutQuart', function(){ $('#home').css("left", "-760px").html(data); $('#scroller').css("left", "-760px"); $('.content-slide').each(setHeight); } ); } }); return false; });

    Read the article

  • What does it mean to double license?

    - by Adrian Panasiuk
    What does it mean to double license code? I can't just put both licenses in the source files. That would mean that I mandate users to follow the rules of both of them, but the licenses will probably be contradictory (otherwise there'd be no reason to double license). I guess this is something like in cryptographic chaining, cipher = crypt_2(crypt_1(clear)) (generally) means, that cipher is neither the output of crypt_2 on clear nor the output of crypt_1 on clear. It's the output of the composition. Likewise, in double-licensing, in reality my code has one license, it's just that this new license says please follow all of the rules of license1, or all of the rules of license2, and you are hereby granted the right to redistribute this application under this "double" license, license1 or license2, or any license under which license1 or license2 allow you to redistribute this software, in which case you shall replace the relevant licensing information in this application with that of the new license. (Does this mean that before someone may use the app under license1, he has to perform the operation of redistributing to self? How would he document the fact that he did that operation?) Am I correct. What LICENSE file and what text to put in the source files would I need if I wanted to double license on, for the sake of example, Apachev2 and GPLv3 ?

    Read the article

  • Word wrap in multiline textbox after 35 characters

    - by Kanavi
    <asp:TextBox CssClass="txt" ID="TextBox1" runat="server" onkeyup="CountChars(this);" Rows="20" Columns="35" TextMode="MultiLine" Wrap="true"> </asp:TextBox> I need to implement word-wrapping in a multi-line textbox. I cannot allow users to write more then 35 chars a line. I am using the following code, which breaks at precisely the specified character on every line, cutting words in half. Can we fix this so that if there's not enough space left for a word on the current line, we move the whole word to the next line? function CountChars(ID) { var IntermediateText = ''; var FinalText = ''; var SubText = ''; var text = document.getElementById(ID.id).value; var lines = text.split("\n"); for (var i = 0; i < lines.length; i++) { IntermediateText = lines[i]; if (IntermediateText.length <= 50) { if (lines.length - 1 == i) FinalText += IntermediateText; else FinalText += IntermediateText + "\n"; } else { while (IntermediateText.length > 50) { SubText = IntermediateText.substring(0, 50); FinalText += SubText + "\n"; IntermediateText = IntermediateText.replace(SubText, ''); } if (IntermediateText != '') { if (lines.length - 1 == i) FinalText += IntermediateText; else FinalText += IntermediateText + "\n"; } } } document.getElementById(ID.id).value = FinalText; $('#' + ID.id).scrollTop($('#' + ID.id)[0].scrollHeight); } Edit - 1 I have to show total max 35 characters in line without specific word break and need to keep margin of two characters from the right. Again, the restriction should be for 35 characters but need space for total 37 (Just for the Visibility issue.)

    Read the article

  • How to run setInterval() on multiple canvases simultaneously?

    - by Alex
    I have a page which has several <canvas> elements. I am passing the canvas ID and an array of data to a function which then grabs the canvas info and passes the data onto a draw() function which in turn processes the given data and draws the results onto the canvas. So far, so good. Example data arrays; $(function() { setup($("#canvas-1"), [[110,110,100], [180,180,50], [220,280,80]]); setup($("#canvas-2"), [[110,110,100], [180,180,50], [220,280,80]]); }); setup function; function setup(canvas, data) { ctx = canvas[0].getContext('2d'); var i = data.length; var dimensions = { w : canvas.innerWidth(), h : canvas.innerHeight() }; draw(dimensions, data, i); } This works perfectly. draw() runs and each canvas is populated. However - I need to animate the canvas. As soon as I replace line 8 of the above example; draw(dimensions, data, i); with setInterval( function() { draw(dimensions, data, i); }, 33 ); It stops working and only draws the last canvas (with the others remaining blank). I'm new to both javascript and canvas so sorry if this is an obvious one, still feeling my way around. Guidance in the right direction much appreciated! Thanks.

    Read the article

  • is using private shared objects/variables on class level harmful ?

    - by haansi
    Hello, Thanks for your attention and time. I need your opinion on an basic architectural issue please. In page behind classes I am using a private and shared object and variables (list or just client or simplay int id) to temporary hold data coming from database or class library. This object is used temporarily to catch data and than to return, pass to some function or binding a control. 1st: Can this approach harm any way ? I couldn't analyze it but a thought was using such shared variables may replace data in it when multiple users may be sending request at a time? 2nd: Please comment also on using such variables in BLL (to hold data coming from DAL/database). In this example every time new object of BLL class will be made. Here is sample code: public class ClientManager { Client objclient = new Client(); //Used in 1st and 2nd method List<Client> clientlist = new List<Client>();// used in 3rd and 4th method ClientRepository objclientRep = new ClientRepository(); public List<Client> GetClients() { return clientlist = objclientRep.GetClients(); } public List<Client> SearchClients(string Keyword) { return clientlist = objclientRep.SearchClients(Keyword); } public Client GetaClient(int ClientId) { return objclient = objclientRep.GetaClient(ClientId); } public Client GetClientDetailForConfirmOrder(int UserId) { return objclientRep.GetClientDetailForConfirmOrder(UserId); } } I am really thankful to you for sparing time and paying kind attention.

    Read the article

  • jQuery cycle floats on top of other content

    - by Angie Dubis
    I tried to replace my Flash video with a jQuery cycle. The cycle works, but the images will not stay in the editable region I placed them in. Instead they are floating on top of other content. Any ideas? This is happening on the home page of massageeducator.com There are 2 cycles on the page. “Slideshow1” and “slideshow2”. “slideshow1” works perfectly. The only thing I did differently was set up “slideshow2” as a library item since it will appear on every page, but added function code manually. I tried adding code and images via the template and had the same issue. I also tried adding both the function code and slideshow to each page instead of library item - same problem. I have both slide shows pointing to the same jquery.cycle.lite.1.0.js. Should I rename this .js file and have each cycle point to a different file? I am new to jQuery so any help is appreciated. I can't seem to post my code due to the spam filters in here!

    Read the article

  • Given a typical Rails 3 environment, why am I unable to execute any tests?

    - by Tom
    I'm working on writing simple unit tests for a Rails 3 project, but I'm unable to actually execute any tests. Case in point, attempting to run the test auto-generated by Rails fails: require 'test_helper' class UserTest < ActiveSupport::TestCase # Replace this with your real tests. test "the truth" do assert true end end Results in the following error: <internal:lib/rubygems/custom_require>:29:in `require': no such file to load -- test_helper (LoadError) from <internal:lib/rubygems/custom_require>:29:in `require' from user_test.rb:1:in `<main>' Commenting out the require 'test_helper' line and attempting to run the test results in this error: user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) The action pack gems appear to be properly installed and up to date: actionmailer (3.0.3, 2.3.5) actionpack (3.0.3, 2.3.5) activemodel (3.0.3) activerecord (3.0.3, 2.3.5) activeresource (3.0.3, 2.3.5) activesupport (3.0.3, 2.3.5) Ruby is at 1.9.2p0 and Rails is at 3.0.3. The sample dump of my test directory is as follows: /fixtures /functional /integration /performance /unit -- /helpers -- user_helper_test.rb -- user_test.rb test_helper.rb I've never seen this problem before - I've run the typical rake tasks for preparing the test environment. I have nothing out of the ordinary in my application or environment configuration files, nor have I installed any unusual gems that would interfere with the test environment. Edit Xavier Holt's suggestion, explicitly specifying the path to the test_helper worked; however, this revealed an issue with ActiveSupport. Now when I attempt to run the test, I receive the following error message (as also listed above): user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) But as you can see above, Action Pack is all installed and update to date.

    Read the article

  • Wrapper Classes for Backward compatibility in Java

    - by Casebash
    There is an interesting article here on maintaing backwards compatibility for Java. In the wrapper class section, I can't actually understand what the wrapper class accomplishes. In the following code from MyApp, WrapNewClass.checkAvailable() could be replaced by Class.forName("NewClass"). static { try { WrapNewClass.checkAvailable(); mNewClassAvailable = true; } catch (Throwable ex) { mNewClassAvailable = false; } } Consider when NewClass is unavailable. In the code where we use the wrapper (see below), all we have done is replace a class that doesn't exist, with one that exists, but which can't be compiled as it uses a class that doesn't exist. public void diddle() { if (mNewClassAvailable) { WrapNewClass.setGlobalDiv(4); WrapNewClass wnc = new WrapNewClass(40); System.out.println("newer API is available - " + wnc.doStuff(10)); }else { System.out.println("newer API not available"); } } Can anyone explain why this makes a difference? I assume it has something to do with how Java compiles code - which I don't know much about.

    Read the article

  • Regular expression to match HTML table row ( <tr> ) NOT containing a specific value

    - by user1821136
    I'm using Notepad++ to clean up a long and messy HTML table. I'm trying to use regular expressions even if I'm a total noob. :) I need to remove all the table rows that doesn't contain a specific value (may I call that substring?). After having all the file contents unwrapped, I've been able to use the following regular expression to select, one by one, every table row with all its contents: <tr>.+?</tr> How can I improve the regular expression in order to select and replace only table rows containing, somewhere inside a part of them, that defined substring? I don't know if this does matter but the structure of every table row is the following (I've put there every HTML tag, the dots stand for standard content/values) <tr> <td> ... </td> <td> ... </td> <td> <a sfref="..." href="...">!! SUBSTRING I HAVE TO MATCH HERE !!</a> </td> <td> <img /> </td> <td> ... </td> <td> ... </td> <td> ... </td> <td> ... </td> </tr> Thanks in advance for your help!

    Read the article

  • What shall be the code in xaml which makes a particular image to act as a button?

    - by Abhi
    Dear all I am new to Silverlight. And i have to make a demo application where in designing is done by using Microsoft Expression Blend 2 and developing should be done using Visual Studio(c++). Now i am first trying to become familiar with xaml files. So i was trying to make a simple demo where in i have to create a button and that button should be replace with an png image. In order to do so i tried with the mentioned below example. But i was not able to see anything in the screen. <UserControl xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" x:Class="SilverlightApplication1.Page" Width="640" Height="480"> <Grid x:Name="LayoutRoot" Background="White"> <Button x:Name="LogoutButton" > <Button.Template> <ControlTemplate> <Image Source="SilverlightApplication1\bounce_photo.png" /> </ControlTemplate> </Button.Template> </Button> </Grid> Please let me know where i am wrong and what shall i do to obtain the result. With regards Abhineet Agarwal

    Read the article

  • Calc_Anniversary Function with a Loop

    - by Rachel Ann Arndt
    Name: Calc_Anniversary Input: Pay_Date, Hire_Date, Termination_Date Output: "Y" if is the anniversary of the employee's Hire_Date, "N" if it is not, and "T" if he has been terminated before his anniversary. Description: Create local variables to hold the month and day of the employee's Date_of_Hire, Termination_Date, and of the processing date using the TO_CHAR function. First check to see if he was terminated before his anniversary. The anniversary could be on any day during the pay period, so there will be a loop to check all 14 days in the pay period to see if one was his anniversary. CREATE OR replace FUNCTION Calc_anniversary( incoming_anniversary_date IN VARCHAR2) RETURN BOOLEAN IS hiredate VARCHAR2(20); terminationdate VARCHAR(20); employeeid VARCHAR2(38); paydate NUMBER := 0; BEGIN SELECT Count(arndt_raw_time_sheet_data.pay_date) INTO paydate FROM arndt_raw_time_sheet_data; WHILE paydate <= 14 LOOP SELECT To_char(employee_id, '999'), To_char(hire_date, 'DD-MON'), To_char(termination_date, 'DD-MON') INTO employeeid, hiredate, terminationdate FROM employees, time_sheet WHERE employees.employee_id = time_sheet.employee_id AND paydate = pay_date; IF terminationdate > hiredate THEN RETURN 'T'; ELSE IF To_char(SYSDATE, 'DD-MON') = To_char(hiredate, 'DD-MON')THEN RETURN 'Y'; ELSE RETURN 'N'; END IF; END IF; paydate := paydate + 1; END LOOP; END; I need help with the loop..

    Read the article

  • Changing default compiler in Linux, using SCons

    - by ereOn
    On my Linux platform, I have several versions of gcc. Under usr/bin I have: gcc34 gcc44 gcc Here are some outputs: $ gcc --version gcc (GCC) 4.1.2 20080704 (Red Hat 4.1.2-48) $ gcc44 --version gcc44 (GCC) 4.4.0 20090514 (Red Hat 4.4.0-6) I need to use the 4.4 version of gcc however the default seems to the 4.1 one. I there a way to replace /usr/bin/gcc and make gcc44 the default compiler not using a symlink to /usr/bin/gcc44 ? The reason why I can't use a symlink is because my code will have to be shipped in a RPM package using mock. mock creates a minimal linux installation from scratch and just install the specified dependencies before compiling my code in it. I cannot customize this "minimal installation". Ideally, the perfect solution would be to install an official RPM package that replaces gcc with gcc44 as the default compiler. Is there such a package ? Is this even possible/good ? Additional information I have to use SCons (a make alternative) and it doesn't let me specify the binary to use for gcc. I will also accept any answer that will tell me how to specify the gcc binary in my SConstruct file.

    Read the article

  • Replacement for Hamachi for SVN access

    - by Piers
    My company has been using Hamachi to access our SVN repository for a number of years. We are a small yet widely distributed development team with each programmer in a different country working from home. The server is hosted by a non-techie in our central office. Hamachi is useful here since it has a GUI and supports remote management. This system worked well for a while, but recently I have moved to a country with poor internet speeds. Hamachi will no longer connect 99% of the time - instead I get a "Probing..." message that doesn't resolve. It's certain to be a latency issue, as the same laptop will connect without problems when I cross the border and connect using a different ISP with better speeds. So I really need to replace Hamachi with some other VPN/protocol that handles latency better. The techie managing the repository is not comfortable installing and configuring Apache or IIS, so it looks like HTTP is out. I tried to convince my boss to go for a web hosting company, but he doesn't trust a 3rd party with our source. Any other recommended options / experiences out there for accessing our SVN repos that would be as simple as Hamachi for setup; but be more tolerant of network latency issues?

    Read the article

  • Changing where a resource is pulled during runtime?

    - by Brandon
    I have a website that goes out to multiple clients. Sometimes a client will insist on minor changes. For reasons beyond my control, I have to comply no matter how minor the request. Usually this isn't a problem, I would just create a client specific version of the user control or page and overwrite the default one during build time or make a configuration setting to handle it. Now that I am localizing the site, I'm curious about the best way to go about making minor wording changes. Lets say I have a resource file called Resources.resx that has 300 resources in it. It has a resource called Continue. English value is "Continue", the French value is "Continuez". Now one client, for whatever reason, wants it to say "Next" and "Après" and the others want to keep it the same. What is the best way to accomodate a request like this? (This is just a simple example). The only two ways I can think of is to Create another Resources.resx specific to the client, and replace the .dll during build time. Since I'd be completely replacing the dll, the new resource file would have to contain all 300 strings. The obvious problem being that I now have 2 resource files, each with 300 strings to maintain. Create a custom user control/page and change it to use a custom resource file. e.g. SignIn.ascx would be replaced during the build and it would pull its resources from ClientName.resx instead of Resources.resx. Are there any other things I could try? Is there any way to change it so that the application will always look in a ClientResources.resx file for the overridden values before actually look at the specified resource file?

    Read the article

  • Which languages support class replacement?

    - by Alix
    Hi, I'm writing my master thesis, which deals with AOP in .NET, among other things, and I mention the lack of support for replacing classes at load time as an important factor in the fact that there are currently no .NET AOP frameworks that perform true dynamic weaving -- not without imposing the requirement that woven classes must extend ContextBoundObject or MarshalByRefObject or expose all their semantics on an interface. You can however do this in Java thanks to ClassFileTransformer: You extend ClassFileTransformer. You subscribe to the class load event. On class load, you rewrite the class and replace it. All this is very well, but my project director has asked me, quite in the last minute, to give him a list of languages that do / do not support class replacement. I really have no time to look for this now: I wouldn't feel comfortable just doing a superficial research and potentially putting erroneous information in my thesis. So I ask you, oh almighty programming community, can you help out? Of course, I'm not asking you to research this yourselves. Simply, if you know for sure that a particular language supports / doesn't support this, leave it as an answer. If you're not sure please don't forget to point it out. Thanks so much!

    Read the article

  • Different standard streams per POSIX thread

    - by Roman Nikitchenko
    Is there any possibility to achieve different redirections for standard output like printf(3) for different POSIX thread? What about standard input? I have lot of code based on standard input/output and I only can separate this code into different POSIX thread, not process. Linux operation system, C standard library. I know I can refactor code to replace printf() to fprintf() and further in this style. But in this case I need to provide some kind of context which old code doesn't have. So doesn't anybody have better idea (look into code below)? #include <pthread.h> #include <stdio.h> void* different_thread(void*) { // Something to redirect standard output which doesn't affect main thread. // ... // printf() shall go to different stream. printf("subthread test\n"); return NULL; } int main() { pthread_t id; pthread_create(&id, NULL, different_thread, NULL); // In main thread things should be printed normally... printf("main thread test\n"); pthread_join(id, NULL); return 0; }

    Read the article

  • Hibernate 3.5.0 causes extreme performance problems

    - by user303396
    I've recently updated from hibernate 3.3.1.GA to hibernate 3.5.0 and I'm having a lot of performance issues. As a test, I added around 8000 entities to my DB (which in turn cause other entities to be saved). These entities are saved in batches of 20 so that the transactions aren't too large for performance reasons. When using hibernate 3.3.1.GA all 8000 entities get saved in about 3 minutes. When using hibernate 3.5.0 it starts out slower than with hibernate 3.3.1. But it gets slower and slower. At around 4,000 entities, it sometimes takes 5 minutes just to save a batch of 20. If I then go to a mysql console and manually type in an insert statement from the mysql general query log, half of them run perfect in 0.00 seconds. And half of them take a long time (maybe 40 seconds) or timeout with "ERROR 1205 (HY000): Lock wait timeout exceeded; try restarting transaction" from MySQL. Has something changed in hibernate's transaction management in version 3.5.0 that I should be aware of? The ONLY thing I changed to experience these unusable performance issues is replace the following hibernate 3.3.1.GA jar files: com.springsource.org.hibernate-3.3.1.GA.jar, com.springsource.org.hibernate.annotations-3.4.0.GA.jar, com.springsource.org.hibernate.annotations.common-3.3.0.ga.jar, com.springsource.javassist-3.3.0.ga.jar with the new hibernate 3.5.0 release hibernate3.jar and javassist-3.9.0.GA.jar. Thanks.

    Read the article

  • Add an item to the Finder/Save dialog sidebar

    - by Clinton Blackmore
    I'm working on a script where a user logs into a guest account on OS and is prompted for their network credentials in order to mount their network home folder (while they benefit from working on a local user folder). As the guest folder is deleted when users log out, I want to discourage them from saving anything there. I would like to replace the items on the Finder and Open/Save sidebar lists (such as "Desktop", username, "Documents", etc) with ones that would save into their network home folder. It is possible to do this using AppleScript or Cocoa APIs, or do I need to modify a plist and restart the Finder? [Ack. Looking into ~/Library/Preferences/com.apple.sidebars.plist, it isn't at all clear how I'd populate it.] Similar Questions: AppleScript: adding mounted folder to Finder Sidebar? suggests using fstab; this code will most likely run as a user and really, automounting at that point would be too late. How do you programmatically put folder icons on the Finder sidebar, given that you have to use a custom icon for the folder? Says there is no Cocoa API, but that you can use a carbon-style LSSharedFileList API that is only documented in a single header file. Does anyone know of some example code to add an item to the Finder sidebar?

    Read the article

  • Is it possible to refer to metadata of the target from within the target implementation in MSBuild?

    - by mark
    Dear ladies and sirs. My msbuild targets file contains the following section: <ItemGroup> <Targets Include="T1"> <Project>A\B.sln"</Project> <DependsOnTargets>The targets T1 depends on</DependsOnTargets> </Targets> <Targets Include="T2"> <Project>C\D.csproj"</Project> <DependsOnTargets>The targets T2 depends on</DependsOnTargets> </Targets> ... </ItemGroup> <Target Name="T1" DependsOnTargets="The targets T1 depends on"> <MSBuild Projects="A\B.sln" Properties="Configuration=$(Configuration)" /> </Target> <Target Name="T2" DependsOnTargets="The targets T2 depends on"> <MSBuild Projects="C\D.csproj" Properties="Configuration=$(Configuration)" /> </Target> As you can see, A\B.sln appears twice: As Project metadata of T1 in the ItemGroup section. In the Target statement itself passed to the MSBuild task. I am wondering whether I can remove the second instance and replace it with the reference to the Project metadata of the target, which name is given to the Target task? Exactly the same question is asked for the (Targets.DependsOnTargets) metadata. It is mentioned twice much like the %(Targets.Project) metadata. Thanks. EDIT: I should probably describe the constraints, which must be satisfied by the solution: I want to be able to build individual projects with ease. Today I can simply execute msbuild file.proj /t:T1 to build the T1 target and I wish to keep this ability. I wish to emphasize, that some projects depend on others, so the DependsOnTargets attribute is really necessary for them.

    Read the article

  • array of structures, or structure of arrays?

    - by Jason S
    Hmmm. I have a table which is an array of structures I need to store in Java. The naive don't-worry-about-memory approach says do this: public class Record { final private int field1; final private int field2; final private long field3; /* constructor & accessors here */ } List<Record> records = new ArrayList<Record>(); If I end up using a large number ( 106 ) of records, where individual records are accessed occasionally, one at a time, how would I figure out how the preceding approach (an ArrayList) would compare with an optimized approach for storage costs: public class OptimizedRecordStore { final private int[] field1; final private int[] field2; final private long[] field3; Record getRecord(int i) { return new Record(field1[i],field2[i],field3[i]); } /* constructor and other accessors & methods */ } edit: assume the # of records is something that is changed infrequently or never I'm probably not going to use the OptimizedRecordStore approach, but I want to understand the storage cost issue so I can make that decision with confidence. obviously if I add/change the # of records in the OptimizedRecordStore approach above, I either have to replace the whole object with a new one, or remove the "final" keyword. kd304 brings up a good point that was in the back of my mind. In other situations similar to this, I need column access on the records, e.g. if field1 and field2 are "time" and "position", and it's important for me to get those values as an array for use with MATLAB, so I can graph/analyze them efficiently.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • prototype findElements querySelectorAll error

    - by JD
    i'm call the "down" function but am getting an invalid argument using 1.6.1_rc2 here's the html snippet: <TR id=000000214A class="activeRow searchResultsDisplayOver" conceptID="0000001KIU"> <TD> <DIV class=gridRowWrapper> <SPAN class=SynDesc>Asymmetric breasts</SPAN> <DIV class=buttonWrapper> <SPAN class=btnAddFav title="Add to Favorites">&nbsp;</SPAN> </DIV> </DIV> </TD> </TR> here's the code: var description = row.down('span.SynDesc').innerHTML; row is a dom reference to the element. prototype is appending a # then the id of the element: findElements: function(root) { root = root || document; var e = this.expression, results; switch (this.mode) { case 'selectorsAPI': if (root !== document) { var oldId = root.id, id = $(root).identify(); id = id.replace(/[\.:]/g, "\\$0"); e = "#" + id + " " + e; } results = $A(root.querySelectorAll(e)).map(Element.extend); <-- e = "#000000214A span.SynDesc" root.id = oldId; return results; case 'xpath': return document._getElementsByXPath(this.xpath, root); default: return this.matcher(root); } i get an "invalid argument" error? if i put a breakpoint before the offending line and change e to be equal to "span.SynDesc" it works fine. help. :)

    Read the article

  • using jquery selector to change attribute in variable returned from ajax request

    - by Blake
    I'm trying to pull in a filename.txt (contains html) using ajax and change the src path in the data variable before I load it into the target div. If I first load it into the div the browser first requests the broken image and I don't want this so I would like to do my processing before I load anything onto the page. I can pull the src values fine but I can't change them. In this example the src values aren't changed. Is there a way to do this with selectors or can they only modify DOM elements? Otherwise I may have to do some regex replace but using a selector will be more convenient if possible. $.ajax( { url: getDate+'/'+name+'.txt', success: function(data) { $('img', data).attr('src', 'new_test_src'); $('#'+target).fadeOut('slow', function(){ $('#'+target).html(data); $('#'+target).fadeIn('slow'); }); } }); My reason is I'm building a fully standalone javascript template system for a newsletter and since images and other things are upload via a drupal web file manager I want the content creators to keep their paths very short and simple and I can then modify them before I load in the content. This will also be distributed on a CD so I can need to change the paths for that so they still work.

    Read the article

  • "rsAccessDenied" error for SSRS 2008

    - by JackLocke
    Hi All, I have been trying to access SSRS Web Service URL hxxp://myServer:80/ReportServer (from Reporting Service Configuration Manager), but my IE always shows "rsAccessDenied" message saying that my account doesn't have privilage required to view. Here are my system specs. Its my laptop with Windows 7 x64, and SQL Server 2008 with SP1 and I am using Mixed Mode Authentication with My account as SysAdmin privilages and this is what I have been trying / tried ... (ofcourse with restarting the service everytime I make any change in configuration), I changed service account from Reporting Service Configuration Manager to make it use My account but nothing happend. I tried running my IE as admin, by RUN AS ADMIN but still same message. Then I read somewhere I have to delete/recreate my encryption keys as well, so I tried again with that, then it was asking me to enter ID/PWD to access server here I am totally blank because it was not accepting my account credentials !!!. Weird thing is I can see my existing reports if I follow this URL hxxp://myServer:80/Reports , for which My guess is solely used to view reports. I have read post here about kind of same problem, but it seems that OP just left forum after asking question... Also, MSDN does have these helps hxxp://msdn.microsoft.com/en-us/library/ms156034.aspx hxxp://msdn.microsoft.com/en-us/library/bb630430.aspx but both of this didn't workout for me. I will really appriciate it if any one can help me out. Jack p.s. I was not allowed to post more than 1 URL because of my "reputation" so I had to change the string a bit. Please replace hxxp wih http in URLs.

    Read the article

  • Powershell finding services using a cmdlet dll

    - by bartonm
    I need to upgrade a dll assemblies, written in C#, in our installation. Before I replace the DLL file, I want to check if the file has a lock and if so display a message. How do I implement this in powershell? I was thinking iterate through Get-Process checking dependencies. Solved. I iterated through list looking a file path match. function IsCaradigmPowershellDLLFree() { # The list of DLLs to check for locks by running processes. $DllsToCheckForLocks = "$env:ProgramFiles\Caradigm Platform\System 3.0\Platform\PowerShell\Caradigm.Platform.Powershell.dll", "$env:ProgramFiles\Caradigm Platform\System 3.0\Platform\PowerShell\Caradigm.Platform.Powershell.InternalPlatformSetup.dll"; # Assume true, then check all process dependencies $result = $true; # Iterate through each process and check module dependencies foreach ($p in Get-Process) { # Iterate through each dll used in a given process foreach ($m in Get-Process -Name $p.ProcessName -Module -ErrorAction SilentlyContinue) { # Check if dll dependency match any DLLs in list foreach ($dll in $DllsToCheckForLocks) { # Compare the fully-qualified file paths, # if there's a match then a lock exists. if ( ($m.FileName.CompareTo($dll) -eq 0) ) { $pName = $p.ProcessName.ToString() Write-Error "$dll is locked by $pName. This dll must be have zero locked prior to upgrade. Stop this service to release this lock on $m1." $result = $false; } } } } return $result; }

    Read the article

< Previous Page | 245 246 247 248 249 250 251 252 253 254 255 256  | Next Page >