Search Results

Search found 7634 results on 306 pages for 'preg replace'.

Page 249/306 | < Previous Page | 245 246 247 248 249 250 251 252 253 254 255 256  | Next Page >

  • Regular expression to match HTML table row ( <tr> ) NOT containing a specific value

    - by user1821136
    I'm using Notepad++ to clean up a long and messy HTML table. I'm trying to use regular expressions even if I'm a total noob. :) I need to remove all the table rows that doesn't contain a specific value (may I call that substring?). After having all the file contents unwrapped, I've been able to use the following regular expression to select, one by one, every table row with all its contents: <tr>.+?</tr> How can I improve the regular expression in order to select and replace only table rows containing, somewhere inside a part of them, that defined substring? I don't know if this does matter but the structure of every table row is the following (I've put there every HTML tag, the dots stand for standard content/values) <tr> <td> ... </td> <td> ... </td> <td> <a sfref="..." href="...">!! SUBSTRING I HAVE TO MATCH HERE !!</a> </td> <td> <img /> </td> <td> ... </td> <td> ... </td> <td> ... </td> <td> ... </td> </tr> Thanks in advance for your help!

    Read the article

  • "rsAccessDenied" error for SSRS 2008

    - by JackLocke
    Hi All, I have been trying to access SSRS Web Service URL hxxp://myServer:80/ReportServer (from Reporting Service Configuration Manager), but my IE always shows "rsAccessDenied" message saying that my account doesn't have privilage required to view. Here are my system specs. Its my laptop with Windows 7 x64, and SQL Server 2008 with SP1 and I am using Mixed Mode Authentication with My account as SysAdmin privilages and this is what I have been trying / tried ... (ofcourse with restarting the service everytime I make any change in configuration), I changed service account from Reporting Service Configuration Manager to make it use My account but nothing happend. I tried running my IE as admin, by RUN AS ADMIN but still same message. Then I read somewhere I have to delete/recreate my encryption keys as well, so I tried again with that, then it was asking me to enter ID/PWD to access server here I am totally blank because it was not accepting my account credentials !!!. Weird thing is I can see my existing reports if I follow this URL hxxp://myServer:80/Reports , for which My guess is solely used to view reports. I have read post here about kind of same problem, but it seems that OP just left forum after asking question... Also, MSDN does have these helps hxxp://msdn.microsoft.com/en-us/library/ms156034.aspx hxxp://msdn.microsoft.com/en-us/library/bb630430.aspx but both of this didn't workout for me. I will really appriciate it if any one can help me out. Jack p.s. I was not allowed to post more than 1 URL because of my "reputation" so I had to change the string a bit. Please replace hxxp wih http in URLs.

    Read the article

  • What does it mean to double license?

    - by Adrian Panasiuk
    What does it mean to double license code? I can't just put both licenses in the source files. That would mean that I mandate users to follow the rules of both of them, but the licenses will probably be contradictory (otherwise there'd be no reason to double license). I guess this is something like in cryptographic chaining, cipher = crypt_2(crypt_1(clear)) (generally) means, that cipher is neither the output of crypt_2 on clear nor the output of crypt_1 on clear. It's the output of the composition. Likewise, in double-licensing, in reality my code has one license, it's just that this new license says please follow all of the rules of license1, or all of the rules of license2, and you are hereby granted the right to redistribute this application under this "double" license, license1 or license2, or any license under which license1 or license2 allow you to redistribute this software, in which case you shall replace the relevant licensing information in this application with that of the new license. (Does this mean that before someone may use the app under license1, he has to perform the operation of redistributing to self? How would he document the fact that he did that operation?) Am I correct. What LICENSE file and what text to put in the source files would I need if I wanted to double license on, for the sake of example, Apachev2 and GPLv3 ?

    Read the article

  • array of structures, or structure of arrays?

    - by Jason S
    Hmmm. I have a table which is an array of structures I need to store in Java. The naive don't-worry-about-memory approach says do this: public class Record { final private int field1; final private int field2; final private long field3; /* constructor & accessors here */ } List<Record> records = new ArrayList<Record>(); If I end up using a large number ( 106 ) of records, where individual records are accessed occasionally, one at a time, how would I figure out how the preceding approach (an ArrayList) would compare with an optimized approach for storage costs: public class OptimizedRecordStore { final private int[] field1; final private int[] field2; final private long[] field3; Record getRecord(int i) { return new Record(field1[i],field2[i],field3[i]); } /* constructor and other accessors & methods */ } edit: assume the # of records is something that is changed infrequently or never I'm probably not going to use the OptimizedRecordStore approach, but I want to understand the storage cost issue so I can make that decision with confidence. obviously if I add/change the # of records in the OptimizedRecordStore approach above, I either have to replace the whole object with a new one, or remove the "final" keyword. kd304 brings up a good point that was in the back of my mind. In other situations similar to this, I need column access on the records, e.g. if field1 and field2 are "time" and "position", and it's important for me to get those values as an array for use with MATLAB, so I can graph/analyze them efficiently.

    Read the article

  • Sharing same vector control between different places

    - by Alexander K
    Hi everyone, I'm trying to implement the following: I have an Items Manager, that has an Item class inside. Item class can store two possible visual representations of it - BitmapImage(bitmap) and UserControl(vector). Then later, in the game, I need to share the same image or vector control between all possible places it takes place. For example, consider 10 trees on the map, and all point to the same vector control. Or in some cases this can be bitmap image source. So, the problem is that BitmapImage source can be easily shared in the application by multiple UIElements. However, when I try to share vector control, it fails, and says Child Element is already a Child element of another control. I want to know how to organize this in the best way. For example replace UserControl with other type of control, or storage, however I need to be sure it supports Storyboard animations inside. The code looks like this: if (bi.item.BitmapSource != null) { Image previewImage = new Image(); previewImage.Source = bi.item.BitmapSource; itemPane.ItemPreviewCanvas.Children.Add(previewImage); } else if (bi.item.VectorSource != null) { UserControl previewControl = bi.item.VectorSource; itemPane.ItemPreviewCanvas.Children.Add(previewControl); } Thanks in advance

    Read the article

  • using ini file in vb6, problem with path to file

    - by DrPut
    I have read many articles about how to use an INI file within my VB6 project. I don't have a problem with the methods, my problem is how to make the EXE file find the INI file. I don't want to hard code the path in the program. I simply want the EXE to expect the INI file to be present in the same folder the EXE is executed from. When I run the program from inside VB6 IDE, the INI is found and processed. When I compile the program and run the EXE, nothing is found. My code looks like: gServer = sGetINI(sINIFile, "TOOLBOM", "ServerName", "?") where TOOLBOM is the [Section] and "ServerName" is the key for the value. I obtained the following code for the API: Rem API DECLARATIONS Declare Function GetPrivateProfileString Lib "kernel32" Alias _ "GetPrivateProfileStringA" (ByVal lpApplicationName _ As String, ByVal lpKeyName As Any, ByVal lpDefault _ As String, ByVal lpReturnedString As String, ByVal _ nSize As Long, ByVal lpFileName As String) As Long Declare Function WritePrivateProfileString Lib "kernel32" Alias _ "WritePrivateProfileStringA" (ByVal lpApplicationName _ As String, ByVal lpKeyName As Any, ByVal lpString As Any, _ ByVal lpFileName As String) As Long Public Function sGetINI(sINIFile As String, sSection As String, sKey _ As String, sDefault As String) As String Dim sTemp As String * 256 Dim nLength As Integer sTemp = Space$(256) nLength = GetPrivateProfileString(sSection, sKey, sDefault, sTemp, _ 255, sINIFile) sGetINI = Left$(sTemp, nLength) End Function Public Sub writeINI(sINIFile As String, sSection As String, sKey _ As String, sValue As String) Dim n As Integer Dim sTemp As String sTemp = sValue Rem Replace any CR/LF characters with spaces For n = 1 To Len(sValue) If Mid$(sValue, n, 1) = vbCr Or Mid$(sValue, n, 1) = vbLf _ Then Mid$(sValue, n) = " " Next n n = WritePrivateProfileString(sSection, sKey, sTemp, sINIFile) End Sub

    Read the article

  • Creating a function in Postgresql that does not return composite values

    - by celenius
    I'm learning how to write functions in Postgresql. I've defined a function called _tmp_myfunction() which takes in an id and returns a table (I also define a table object type called _tmp_mytable) -- create object type to be returned CREATE TYPE _tmp_mytable AS ( id integer, cost double precision ); -- create function which returns query CREATE OR REPLACE FUNCTION _tmp_myfunction( id integer ) RETURNS SETOF _tmp_mytable AS $$ BEGIN RETURN QUERY SELECT id, cost FROM sales WHERE id = sales.id; END; $$ LANGUAGE plpgsql; This works fine when I use one id and call it using the following approach: SELECT * FROM _tmp_myfunction(402); What I would like to be able to do is to call it, but to use a column of values instead of just one value. However, if I use the following approach I end up with all values of the table in one column, separated by commas: -- call function using all values in a column SELECT _tmp_myfunction(t.id) FROM transactions as t; I understand that I can get the same result if I use SELECT _tmp_myfunction(402); instead of SELECT * FROM _tmp_myfunction(402); but I don't know how to construct my query in such a way that I can separate out the results.

    Read the article

  • Removing HTML entities while preserving line breaks with JSoup

    - by shrodes
    I have been using JSoup to parse lyrics and it has been great until now, but have run into a problem. I can use Node.html() to return the full HTML of the desired node, which retains line breaks as such: Gl&oacute;andi augu, silfurn&aacute;tt <br />Bl&oacute;&eth; alv&ouml;ru, starir &aacute; <br />&Oacute;&eth;ur hundur er &iacute; v&iacute;gam&oacute;&eth;, &iacute; maga... m&eacute;r <br /> <br />Kolni&eth;ur gref, kvik sem dreg h&eacute;r <br />Kolni&eth;ur svart, hvergi bjart n&eacute; But has the unfortunate side-effect, as you can see, of retaining HTML entities and tags. However, if I use Node.text(), I can get a better looking result, free of tags and entities: Glóandi augu, silfurnátt Blóð alvöru, starir á Óður hundur er í vígamóð, í maga... mér Kolniður gref, kvik sem dreg hér Kolniður svart, Which has another unfortunate side-effect of removing the line breaks and compressing into a single line. Simply replacing <br /> from the node before calling Node.text() yields the same result, and it seems that that method is compressing the text onto a single line in the method itself, ignoring newlines. Is it possible to have the best of both worlds, and have tags and entities replaced correctly which preserving the line breaks, or is there another method or way of decoding entities and removing tags without having to replace them manually?

    Read the article

  • Given a typical Rails 3 environment, why am I unable to execute any tests?

    - by Tom
    I'm working on writing simple unit tests for a Rails 3 project, but I'm unable to actually execute any tests. Case in point, attempting to run the test auto-generated by Rails fails: require 'test_helper' class UserTest < ActiveSupport::TestCase # Replace this with your real tests. test "the truth" do assert true end end Results in the following error: <internal:lib/rubygems/custom_require>:29:in `require': no such file to load -- test_helper (LoadError) from <internal:lib/rubygems/custom_require>:29:in `require' from user_test.rb:1:in `<main>' Commenting out the require 'test_helper' line and attempting to run the test results in this error: user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) The action pack gems appear to be properly installed and up to date: actionmailer (3.0.3, 2.3.5) actionpack (3.0.3, 2.3.5) activemodel (3.0.3) activerecord (3.0.3, 2.3.5) activeresource (3.0.3, 2.3.5) activesupport (3.0.3, 2.3.5) Ruby is at 1.9.2p0 and Rails is at 3.0.3. The sample dump of my test directory is as follows: /fixtures /functional /integration /performance /unit -- /helpers -- user_helper_test.rb -- user_test.rb test_helper.rb I've never seen this problem before - I've run the typical rake tasks for preparing the test environment. I have nothing out of the ordinary in my application or environment configuration files, nor have I installed any unusual gems that would interfere with the test environment. Edit Xavier Holt's suggestion, explicitly specifying the path to the test_helper worked; however, this revealed an issue with ActiveSupport. Now when I attempt to run the test, I receive the following error message (as also listed above): user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) But as you can see above, Action Pack is all installed and update to date.

    Read the article

  • Which languages support class replacement?

    - by Alix
    Hi, I'm writing my master thesis, which deals with AOP in .NET, among other things, and I mention the lack of support for replacing classes at load time as an important factor in the fact that there are currently no .NET AOP frameworks that perform true dynamic weaving -- not without imposing the requirement that woven classes must extend ContextBoundObject or MarshalByRefObject or expose all their semantics on an interface. You can however do this in Java thanks to ClassFileTransformer: You extend ClassFileTransformer. You subscribe to the class load event. On class load, you rewrite the class and replace it. All this is very well, but my project director has asked me, quite in the last minute, to give him a list of languages that do / do not support class replacement. I really have no time to look for this now: I wouldn't feel comfortable just doing a superficial research and potentially putting erroneous information in my thesis. So I ask you, oh almighty programming community, can you help out? Of course, I'm not asking you to research this yourselves. Simply, if you know for sure that a particular language supports / doesn't support this, leave it as an answer. If you're not sure please don't forget to point it out. Thanks so much!

    Read the article

  • Advance: Parsing XML into another XML page using only javascript or jquery; Can't use PhP, Java or MySQL

    - by UrBestFriend
    Current site: http://cardwall.tk/ Example of intended outcome: http://www.shockwave.com/downloadWall.jsp I have an embeded flash object that uses XML/RSS (Picasa) to feed itself pictures. Now I created my own XML/RSS feed so that I can add additional XML tags and values. Now here's my big problem: enabling search. Since I'm not relying on Picasa's API anymore to return custom RSS/XML for the user's search, how can I create xml from another xml based on the user's search queries using only JavaScript and Jquery? Here is the current code: <script type="text/javascript"> var flashvars = { feed : "http%3A%2F%2Frssfeed.ucoz.com%2Frssfeed.xml", backgroundColor : "#FFFFFF", metadataFont : "Arial", wmode : "opaque", iFrameScrolling: "no", numRows : "3", }; var params = { allowFullScreen: "true", allowscriptaccess : "always", wmode: "opaque" }; swfobject.embedSWF("http://apps.cooliris.com/embed/cooliris.swf", "gamewall", "810", "410", "9.0.0", "", flashvars, params); $(document).ready(function() { $("#cooliris input").keydown(function(e) { if(e.keyCode == 13) { $("#cooliris a#searchCooliris").click(); return false; } }); doCoolIrisSearch = function() { cooliris.embed.setFeedContents( '** JAVA STRING OF PARSED RSS/XML based on http%3A%2F%2Frssfeed.ucoz.com%2Frssfeed.xml and USER'S SEARCH INPUT** ' ) }); <form id="searchForm" name="searchForm" class="shockwave"> <input type="text" name="coolIrisSearch" id="coolIrisSearch" value="Search..." class="field text short" onfocus="this.value='';" /> <a id="searchCooliris" href="#" onclick="doCoolIrisSearch();return false;" class="clearLink">Search Cooliris</a> </form> <div id="gamewall"></div> So basically, I want to replace cooliris.embed.setFeedContents's value with a Javastring based on the parsed RSS/XML and user search input. Any code or ideas would be greatly appreciated.

    Read the article

  • Silverlight performance with many loaded controls

    - by gius
    I have a SL application with many DataGrids (from Silverlight Toolkit), each on its own view. If several DataGrids are opened, changing between views (TabItems, for example) takes a long time (few seconds) and it freezes the whole application (UI thread). The more DataGrids are loaded, the longer the change takes. These DataGrids that slow the UI chanage might be on other places in the app and not even visible at that moment. But once they are opened (and loaded with data), they slow showing other DataGrids. Note that DataGrids are NOT disposed and then recreated again, they still remain in memory, only their parent control is being hidden and visible again. I have profiled the application. It shows that agcore.dll's SetValue function is the bottleneck. Unfortunately, debug symbols are not available for this Silverlight native library responsible for drawing. The problem is not in the DataGrid control - I tried to replace it with XCeed's grid and the performance when changing views is even worse. Do you have any idea how to solve this problem? Why more opened controls slow down other controls? I have created a sample that shows this issue: http://cenud.cz/PerfTest.zip UPDATE: Using VS11 profiler on the sample provided suggests that the problem could be in MeasureOverride being called many times (for each DataGridCell, I guess). But still, why is it slower as more controls are loaded elsewhere? Is there a way to improve the performance?

    Read the article

  • [CODE GENERATION] How to generate DELETE statements in PL/SQL, based on the tables FK relations?

    - by The chicken in the kitchen
    Is it possible via script/tool to generate authomatically many delete statements based on the tables fk relations, using Oracle PL/SQL? In example: I have the table: CHICKEN (CHICKEN_CODE NUMBER) and there are 30 tables with fk references to its CHICKEN_CODE that I need to delete; there are also other 150 tables foreign-key-linked to that 30 tables that I need to delete first. Is there some tool/script PL/SQL that I can run in order to generate all the necessary delete statements based on the FK relations for me? (by the way, I know about cascade delete on the relations, but please pay attention: I CAN'T USE IT IN MY PRODUCTION DATABASE, because it's dangerous!) I'm using Oracle DataBase 10G R2. This is the result I've written, but it is not recursive: This is a view I have previously written, but of course it is not recursive! CREATE OR REPLACE FORCE VIEW RUN ( OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME, VINCOLO ) AS SELECT OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME, '(' || LTRIM ( EXTRACT (XMLAGG (XMLELEMENT ("x", ',' || COLUMN_NAME)), '/x/text()'), ',') || ')' VINCOLO FROM ( SELECT CON1.OWNER OWNER_1, CON1.TABLE_NAME TABLE_NAME_1, CON1.CONSTRAINT_NAME CONSTRAINT_NAME_1, CON1.DELETE_RULE, CON1.STATUS, CON.TABLE_NAME, CON.CONSTRAINT_NAME, COL.POSITION, COL.COLUMN_NAME FROM DBA_CONSTRAINTS CON, DBA_CONS_COLUMNS COL, DBA_CONSTRAINTS CON1 WHERE CON.OWNER = 'TABLE_OWNER' AND CON.TABLE_NAME = 'TABLE_OWNED' AND ( (CON.CONSTRAINT_TYPE = 'P') OR (CON.CONSTRAINT_TYPE = 'U')) AND COL.TABLE_NAME = CON1.TABLE_NAME AND COL.CONSTRAINT_NAME = CON1.CONSTRAINT_NAME --AND CON1.OWNER = CON.OWNER AND CON1.R_CONSTRAINT_NAME = CON.CONSTRAINT_NAME AND CON1.CONSTRAINT_TYPE = 'R' GROUP BY CON1.OWNER, CON1.TABLE_NAME, CON1.CONSTRAINT_NAME, CON1.DELETE_RULE, CON1.STATUS, CON.TABLE_NAME, CON.CONSTRAINT_NAME, COL.POSITION, COL.COLUMN_NAME) GROUP BY OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME; ... and it contains the error of using DBA_CONSTRAINTS instead of ALL_CONSTRAINTS...

    Read the article

  • Java function changing input

    - by Doodle
    I would like to go from one number to another. For example if I started at 6 and my goal was 10 I want a function that on every pass would bring me from 6 towards 10 or if I had the number 14 and my goal was 9 it would count down from 14 towards 9.So far I have (this is written in Processing a Java Api but there is essentially no difference from regualr Java, draw is just a continuous loop) int x=100; void draw(){ x=towards(x,10); println(x); } int towards(int current ,int target){ if(current!=target){ if (current <target){ current=current+1; } else { current=current-1; } } return current; } this gives me the results I would like but I would like to have everything in side of the towards() function. When I replace X with a variable it of course resets it self to the static variable. To sum it up how can I pass a variable to a function and have that variable thats been passed change on every subsequent pass. I have looked into recursion as a solution but that of just brings me to a final solution. I can pass the count to an array but wouldn't like to do that either.

    Read the article

  • How to set HTMLField's widget's height in Admin?

    - by Georgie Porgie
    I have a HTMLField in a model as it's the laziest way to utilize tinymce widget in Admin. But the problem is that the textarea field doesn't have "rows" property set. So the textarea doesn't have enough height comfortable enough for editing in Admin. Is there any way to set the height of HTMLField without defining a ModelAdmin class? Update: I solved the problem by using the following code: def create_mce_formfield(db_field): return db_field.formfield(widget = TinyMCE( attrs = {'cols': 80, 'rows': 30}, mce_attrs = { 'external_link_list_url': reverse('tinymce.views.flatpages_link_list'), 'plugin_preview_pageurl': reverse('tinymce-preview', args= ('tinymce',)), 'plugins': "safari,pagebreak,style,layer,table,save,advhr,advimage,advlink,emotions,iespell,inlinepopups,insertdatetime,preview,media,searchreplace,print,contextmenu,paste,directionality,fullscreen,noneditable,visualchars,nonbreaking,xhtmlxtras,template", 'theme_advanced_buttons1': "save,newdocument,|,bold,italic,underline,strikethrough,|,justifyleft,justifycenter,justifyright,justifyfull,styleselect,formatselect,fontselect,fontsizeselect", 'theme_advanced_buttons2': "cut,copy,paste,pastetext,pasteword,|,search,replace,|,bullist,numlist,|,outdent,indent,blockquote,|,undo,redo,|,link,unlink,anchor,image,cleanup,help,code,|,insertdate,inserttime,preview,|,forecolor,backcolor", 'theme_advanced_buttons3': "tablecontrols,|,hr,removeformat,visualaid,|,sub,sup,|,charmap,emotions,iespell,media,advhr,|,print,|,ltr,rtl,|,fullscreen", 'theme_advanced_buttons4': "insertlayer,moveforward,movebackward,absolute,|,styleprops,|,cite,abbr,acronym,del,ins,attribs,|,visualchars,nonbreaking,template,pagebreak", 'theme_advanced_toolbar_location': "top", 'theme_advanced_toolbar_align': "left", 'theme_advanced_statusbar_location': "bottom", 'theme_advanced_resizing': True, 'extended_valid_elements': "iframe[src|title|width|height|allowfullscreen|frameborder|webkitAllowFullScreen|mozallowfullscreen|allowFullScreen]", }, )) class TinyMCEFlatPageAdmin(FlatPageAdmin): def formfield_for_dbfield(self, db_field, **kwargs): if db_field.name == 'content': return create_mce_formfield(db_field) return super(TinyMCEFlatPageAdmin, self).formfield_for_dbfield(db_field, **kwargs)

    Read the article

  • Question about the evolution of interaction paradigm between web server program and content provider program?

    - by smwikipedia
    Hi experts, In my opinion, web server is responsible to deliver content to client. If it is static content like pictures and static html document, web server just deliver them as bitstream directly. If it is some dynamic content that is generated during processing client's request, the web server will not generate the conetnt itself but call some external proram to genearte the content. AFAIK, this kind of dynamice content generation technologies include the following: CGI ISAPI ... And from here, I noticed that: ...In IIS 7, modules replace ISAPI filters... Is there any others? Could anyone help me complete the above list and elabrate on or show some links to their evolution? I think it would be very helpful to understand application such as IIS, TomCat, and Apache. I once wrote a small CGI program, and though it serves as a content generator, it is still nothing but a normal standalone program. I call it normal because the CGI program has a main() entry point. But with the recenetly technology like ASP.NET, I am not writing complete program, but only some class library. Why does such radical change happens? Many thanks.

    Read the article

  • is using private shared objects/variables on class level harmful ?

    - by haansi
    Hello, Thanks for your attention and time. I need your opinion on an basic architectural issue please. In page behind classes I am using a private and shared object and variables (list or just client or simplay int id) to temporary hold data coming from database or class library. This object is used temporarily to catch data and than to return, pass to some function or binding a control. 1st: Can this approach harm any way ? I couldn't analyze it but a thought was using such shared variables may replace data in it when multiple users may be sending request at a time? 2nd: Please comment also on using such variables in BLL (to hold data coming from DAL/database). In this example every time new object of BLL class will be made. Here is sample code: public class ClientManager { Client objclient = new Client(); //Used in 1st and 2nd method List<Client> clientlist = new List<Client>();// used in 3rd and 4th method ClientRepository objclientRep = new ClientRepository(); public List<Client> GetClients() { return clientlist = objclientRep.GetClients(); } public List<Client> SearchClients(string Keyword) { return clientlist = objclientRep.SearchClients(Keyword); } public Client GetaClient(int ClientId) { return objclient = objclientRep.GetaClient(ClientId); } public Client GetClientDetailForConfirmOrder(int UserId) { return objclientRep.GetClientDetailForConfirmOrder(UserId); } } I am really thankful to you for sparing time and paying kind attention.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Is there a FAST way to export and install an app on my phone, while signing it with my own keystore?

    - by Alexei Andreev
    So, I've downloaded my own application from the market and installed it on my phone. Now, I am trying to install a temporary new version from Eclipse, but here is the message I get: Re-installation failed due to different application signatures. You must perform a full uninstall of the application. WARNING: This will remove the application data! Please execute 'adb uninstall com.applicationName' in a shell. Launch canceled! Now, I really really don't want to uninstall the application, because I will lose all my data. One solution I found is to Export my application, creating new .apk, and then install it via HTC Sync (probably a different program based on what phone you have). The problem is this takes a long time to do, since I need to enter the password for the keystore each time and then wait for HTC Sync. It's a pain in the ass! So the question is: Is there a way to make Eclipse automatically use my keystore to sign the application (quickly and automatically)? Or perhaps to replace debug keystore with my own? Or perhaps just tell it to remember the password, so I don't have to enter it every time...? Or some other way to solve this problem?

    Read the article

  • How to get the most out of a 3 month intern?

    - by firoso
    We've got a software engineering intern coming in who's fairly competent and shows promise. There's one catch: we have him for 3 months full time and can't count on anything past that. He still has a year of school left, which is why we can't say for sure that we have him past 3 months. We have a specific project we're putting him on. How can we maximize his productivity while still giving him a positive learning experience? He wants to learn about development cycles and real-world software engineering. Anything that you think would be critical that you wish you had learned earlier? Nearly six months later: He's preformed admirably and even I have learned a lot from him. Thank you all for the input. Now I want to provide feedback to YOU! He has benefited most from sitting down and writing code. However, he has had a nasty history of bad software engineering practices which I'm trying to replace with good habits (properly finishing a method before moving on, not hacking code together, proper error channeling, etc). He has also really gained a lot by feeling involved in design decisions, even if most of the time they're related to my own design plans.

    Read the article

  • Creating a three level ASP.NET menu with SiteMap, how do i do it?

    - by user270399
    I want to create a three level menu, I have got a recursive function today that works with three levels. But the thing is how do i output the third lever? Using two repeaters i have managed to get a hold of the first two levels through the ChildNodes property. But that only gives me the second level. What if a want the third level? Example code below. How do i get the third level? :) <asp:Repeater ID="FirstLevel" DataSourceID="SiteMapDataSource" runat="server" EnableViewState="false"> <ItemTemplate> <li class="top"> <a href='/About/<%#Eval("Title")%>.aspx' class="top_link"><span class="down"><%#Eval("Title")%></span><!--[if gte IE 7]><!--></a><!--<![endif]--> <asp:Repeater runat="server" ID="SecondLevel" DataSource='<%#((SiteMapNode)Container.DataItem).ChildNodes%>'> <HeaderTemplate><!--[if lte IE 6]><table><tr><td><![endif]--><ul class="sub"></HeaderTemplate> <ItemTemplate> <li> <a href='<%#((string)Eval("Url")).Replace("~", "")%>' style="text-align: left;"><%#Eval("Title")%></a> Third repeater here? </li> </ItemTemplate> <FooterTemplate></ul><!--[if lte IE 6]></td></tr></table></a><![endif]--></FooterTemplate> </asp:Repeater> </li> </ItemTemplate> </asp:Repeater>

    Read the article

  • Writing csv file in asp.net

    - by Keith
    Hello, I'm trying to export data to a csv file, as there are chinese characters in the data i had to use unicode.. but after adding the preamble for unicode, the commas are not recognized as delimiters and all data are now written to the first column. I'm not sure what is wrong. Below is my code which i wrote in a .ashx file. DataView priceQuery = (DataView)context.Session["priceQuery"]; String fundName = priceQuery.Table.Rows[0][0].ToString().Trim().Replace(' ', '_'); context.Response.Clear(); context.Response.ClearContent(); context.Response.ClearHeaders(); context.Response.ContentType = "text/csv"; context.Response.ContentEncoding = System.Text.Encoding.Unicode; context.Response.AddHeader("Content-Disposition", "attachment; filename=" + fundName + ".csv"); context.Response.BinaryWrite(System.Text.Encoding.Unicode.GetPreamble()); String output = fundName + "\n"; output += "Price, Date" + "\n"; foreach (DataRow row in priceQuery.Table.Rows) { string price = row[2].ToString(); string date = ((DateTime)row[1]).ToString("dd-MMM-yy"); output += price + "," + date + "\n"; } context.Response.Write(output);

    Read the article

  • Asp.Net MVC - Binding of parameter to model value!

    - by Pino
    This seems like the model binding is causing me issues. Essentially I have a model called ProductOption and for the purpose of this question it has 2 fields ID (Int) PK ProductID (Int) FK I have a standard route set-up context.MapRoute( "Product_default", "Product/{controller}/{action}/{id}", new { controller = "Product", action = "Index", id = UrlParameter.Optional } ); and if the user wants to add an option the URL is, /Product/Options/Add/1 in the above URL 1 is the ProductID, I have the following code to return a blank model the the view, [HttpGet] public ActionResult Add(int id) { return View("Manage", new ProductOptionModel() { ProductID = id }); } Now in my view I keep a hidden field <%= Html.HiddenFor(x=>x.ID) %> This is used to determine (on submit) if we are editing or adding a new option. However the Model binder in .net seems to replace .ID (Which was 0 when leaving the above get actionresult) with 1 (or the value of the id parameter in the URL) How can I stop or work around this? ViewModel public class ProductExtraModel { //Database public int ID { get; set; } public string Name { get; set; } public int ProductID { get; set; } public ProductModel Product { get; set; } }

    Read the article

  • using jquery selector to change attribute in variable returned from ajax request

    - by Blake
    I'm trying to pull in a filename.txt (contains html) using ajax and change the src path in the data variable before I load it into the target div. If I first load it into the div the browser first requests the broken image and I don't want this so I would like to do my processing before I load anything onto the page. I can pull the src values fine but I can't change them. In this example the src values aren't changed. Is there a way to do this with selectors or can they only modify DOM elements? Otherwise I may have to do some regex replace but using a selector will be more convenient if possible. $.ajax( { url: getDate+'/'+name+'.txt', success: function(data) { $('img', data).attr('src', 'new_test_src'); $('#'+target).fadeOut('slow', function(){ $('#'+target).html(data); $('#'+target).fadeIn('slow'); }); } }); My reason is I'm building a fully standalone javascript template system for a newsletter and since images and other things are upload via a drupal web file manager I want the content creators to keep their paths very short and simple and I can then modify them before I load in the content. This will also be distributed on a CD so I can need to change the paths for that so they still work.

    Read the article

  • Django + jquery : getting 301

    - by llazzaro
    Hello, I have tabs that calls via javascript urls of django to complete the "container" But i am getting 301, any idea why this is happening? Server misconfiguration? urls.py urlpatterns = patterns('', (r'^admin/', include(admin.site.urls)), (r'^list/', 'carsproj.cars.views.list'), ) view def list(request): if request.is_ajax(): return render_to_response('templates/generic_list.html', { 'items' : Cars.objects.all(), 'name' : 'List - Cars' }, context_instance = RequestContext(request)) javascript the_tabs.click(function(e){ var element = $(this); if(element.find('#overLine').length) return false; var bg = element.attr('class').replace('tab ',''); $('#overLine').remove(); $('<div>',{ id:'overLine', css:{ display:'none', width:element.outerWidth()-2, background:topLineColor[bg] || 'white' }}).appendTo(element).fadeIn('slow'); if(!element.data('cache')) { $('#contentHolder').html('<img src="/media/img/ajax_preloader.gif" width="64" height="64" class="preloader" />'); $.get(element.data('page'),function(msg){ $('#contentHolder').html(msg); element.data('cache',msg); }); } else $('#contentHolder').html(element.data('cache')); e.preventDefault(); }) Please tell me what more information you need, js code? template? url.py? I WILL EDIT THIS POST FOR ADD MORE DATA

    Read the article

< Previous Page | 245 246 247 248 249 250 251 252 253 254 255 256  | Next Page >