Search Results

Search found 7634 results on 306 pages for 'preg replace'.

Page 249/306 | < Previous Page | 245 246 247 248 249 250 251 252 253 254 255 256  | Next Page >

  • nServiceBus - Not all commands being received by handler

    - by SimonB
    In a test project based of the nServiceBus pub/sub sample, I've replace the bus.publish with bus.send in the server. The server sends 50 messages with a 1sec wait after each 5 (ie 10 burst of 5 messages). The client does not get all the messages. The soln has 3 projects - Server, Client, and common messages. The server and client are hosted via the nServiceBus generic host. Only a single bus is defined. Both client and server are configured to use StructureMap builder and BinarySerialisation. Server Endpoint: public class EndPointConfig : AsA_Publisher, IConfigureThisEndpoint, IWantCustomInitialization { public void Init() { NServiceBus.Configure.With() .StructureMapBuilder() .BinarySerializer(); } } Server Code : for (var nextId = 1; nextId <= 50; nextId++) { Console.WriteLine("Sending {0}", nextId); IDataMsg msg = new DataMsg { Id = nextId, Body = string.Format("Batch Msg #{0}", nextId) }; _bus.SendLocal(msg); Console.WriteLine(" ...sent {0}", nextId); if ((nextId % 5) == 0) Thread.Sleep(1000); } Client Endpoint: public class EndPointConfig : AsA_Client, IConfigureThisEndpoint, IWantCustomInitialization { public void Init() { NServiceBus.Configure.With() .StructureMapBuilder() .BinarySerializer(); } } Client Clode: public class DataMsgHandler : IMessageHandler<IDataMsg> { public void Handle(IDataMsg msg) { Console.WriteLine("DataMsgHandler.Handle({0}, {1}) - ({2})", msg.Id, msg.Body, Thread.CurrentThread.ManagedThreadId); } } Client and Server App.Config: <MsmqTransportConfig InputQueue="nsbt02a" ErrorQueue="error" NumberOfWorkerThreads="1" MaxRetries="5" /> <UnicastBusConfig DistributorControlAddress="" DistributorDataAddress=""> <MessageEndpointMappings> <add Messages="Test02.Messages" Endpoint="nsbt02a" /> </MessageEndpointMappings> </UnicastBusConfig> All run via VisualStudio 2008. All 50 messages are sent - but after the 1st or 2nd batch. only 1 msg per batch is sent? Any ideas? I'm assuming config or misuse but ....?

    Read the article

  • How do I reference my MainViewController from another class?

    - by todd412
    Hi, I am building an iPhone Utility app that uses UIImageView to display an animation. Within the MainViewController's viewDidLoad() method, I am creating an instance of a CustomClass, and then setting up the animations: - (void)viewDidLoad { [super viewDidLoad]; cc = [CustomClass new]; NSArray * imageArray = [[NSArray alloc] initWithObjects: [UIImage imageNamed:@"image-1-off.jpg"], [UIImage imageNamed:@"image-2-off.jpg"], [UIImage imageNamed:@"image-3-off.jpg"], [UIImage imageNamed:@"image-4-off.jpg"], nil]; offSequence = [[UIImageView alloc] initWithFrame:CGRectMake(0, 0, 320, 480)]; offSequence.animationImages = imageArray; offSequence.animationDuration = .8; offSequence.contentMode = UIViewContentModeBottomLeft; [self.view addSubview:offSequence]; [offSequence startAnimating]; } That works fine. However, I would like to be able to move all the above code that sets up the UIImageView into my CustomClass. The problem is in the second to last line: [self.view addSubview:offSequence]; I basically need to replace 'self' with a reference to the MainControllerView, so I can call addSubview from within my CustomClass. I tried creating an instance var of CustomClass called mvc and a setter method that takes a reference to the MainViewController as an argument as such: - (void) setMainViewController: (MainViewController *) the_mvc { mvc = the_mvc; } And then I called it within MainViewController like so: [cc setMainController:MainViewController:self]; But this yields all sorts of errors which I can post here, but it strikes me that I may be overcomplicating this. Is there an easier way to reference the MainViewController that instanatiated my CustomClass?

    Read the article

  • jQuery dynamic css loading weired behavior

    - by jimpsr
    The app I am working on requires dynamic loading of css and js, right now the solution is as follows: myapp.loadCss = function(css){ $("head").append("<link>"); cssDom = $("head").children(":last"); cssDom.attr({rel: "stylesheet", type: "text/css", href: css }); } myapp.loadJs = funciton(js){ ... //$.ajax call is used in synchronized mode to make sure the js is fully loaded } } When some widgets need to be load, the usual call with be myapp.loadCss('/widgets/widget1/css/example.css'); myapp.loadJs('/wiggets/widget1/js/example.js'); The weired thing is that once a while (1 out of 10 or 20), the newly created dom elements from example.js will not be able to get its css from example.css, it seems however my loadCss method does not load the css in a synchronized mode? I have tried to replace my loadCss with the the following code: myapp.loadCss(css){ $('<link href="' + css + '" rel="stylesheet" type="text/css" />').appendTo($('head')); } It seems to be OK then (I refreshed the webpage a hundred times for verification :-( ) But unfortunately this method failed in IE(IE7, not tested in IE6, 8) Is there any better solution for this?

    Read the article

  • Regular expression to match HTML table row ( <tr> ) NOT containing a specific value

    - by user1821136
    I'm using Notepad++ to clean up a long and messy HTML table. I'm trying to use regular expressions even if I'm a total noob. :) I need to remove all the table rows that doesn't contain a specific value (may I call that substring?). After having all the file contents unwrapped, I've been able to use the following regular expression to select, one by one, every table row with all its contents: <tr>.+?</tr> How can I improve the regular expression in order to select and replace only table rows containing, somewhere inside a part of them, that defined substring? I don't know if this does matter but the structure of every table row is the following (I've put there every HTML tag, the dots stand for standard content/values) <tr> <td> ... </td> <td> ... </td> <td> <a sfref="..." href="...">!! SUBSTRING I HAVE TO MATCH HERE !!</a> </td> <td> <img /> </td> <td> ... </td> <td> ... </td> <td> ... </td> <td> ... </td> </tr> Thanks in advance for your help!

    Read the article

  • jQuery click event on image only fires once

    - by stephenreece@
    I created a view of thumbnails. When the user clicks, I want the real image to pop-up in a dialog. That works the first time, but once the jQuery 'click' fires on an thumbnail it never fires again unless I reload the entire page. I've tried rebinding the click events on the dialog close that that does not help. Here is my code: function LoadGalleryView() { $('img.gallery').each(function(){ BindImage($(this)); }); } function BindImage(image) { var src= image.attr('src'); var id= image.attr('id'); var popurl = src.replace("thumbs/", ""); image.hover(function(){ image.attr('style', 'height: 100%; width: 100%;'); }, function(){ image.removeAttr('style'); }); $('#'+id).live('click', function() { PopUpImage(popurl); }); } function CheckImage(img,html) { if ( img.complete ) { $('#galleryProgress').html(''); var imgwidth = img.width+35; var imgheight = img.height+65; $('<div id="viewImage" title="View"></div>').html(html).dialog( { bgiframe: true, autoOpen: true, modal: true, width: imgwidth, height: imgheight, position: 'center', closeOnEscape: true }); } else { $('#galleryProgress').html('<img src="images/ajax-loader.gif" /><br /><br />'); setTimeout(function(){CheckImage(img,html);},10); } } function PopUpImage(url) { var html = '<img src="'+url+'" />'; var img = new Image(); img.src = url; if ( ! img.complete ) { setTimeout(function(){CheckImage(img,html);},10); } } PopUpImage() only executes the first time an image is clicked and I cannot figure out how to rebind.

    Read the article

  • Generate syntax tree for simple math operations

    - by M28
    I am trying to generate a syntax tree, for a given string with simple math operators (+, -, *, /, and parenthesis). Given the string "1 + 2 * 3": It should return an array like this: ["+", [1, ["*", [2,3] ] ] ] I made a function to transform "1 + 2 * 3" in [1,"+",2,"*",3]. The problem is: I have no idea to give priority to certain operations. My code is: function isNumber(ch){ switch (ch) { case '0': case '1': case '2': case '3': case '4': case '5': case '6': case '7': case '8': case '9': case '.': return true; break; default: return false; break; } } function generateSyntaxTree(text){ if (typeof text != 'string') return []; var code = text.replace(new RegExp("[ \t\r\n\v\f]", "gm"), ""); var codeArray = []; var syntaxTree = []; // Put it in its on scope (function(){ var lastPos = 0; var wasNum = false; for (var i = 0; i < code.length; i++) { var cChar = code[i]; if (isNumber(cChar)) { if (!wasNum) { if (i != 0) { codeArray.push(code.slice(lastPos, i)); } lastPos = i; wasNum = true; } } else { if (wasNum) { var n = Number(code.slice(lastPos, i)); if (isNaN(n)) { throw new Error("Invalid Number"); return []; } else { codeArray.push(n); } wasNum = false; lastPos = i; } } } if (wasNum) { var n = Number(code.slice(lastPos, code.length)); if (isNaN(n)) { throw new Error("Invalid Number"); return []; } else { codeArray.push(n); } } })(); // At this moment, codeArray = [1,"+",2,"*",3] return syntaxTree; } alert('Returned: ' + generateSyntaxTree("1 + 2 * 3"));

    Read the article

  • Word wrap in multiline textbox after 35 characters

    - by Kanavi
    <asp:TextBox CssClass="txt" ID="TextBox1" runat="server" onkeyup="CountChars(this);" Rows="20" Columns="35" TextMode="MultiLine" Wrap="true"> </asp:TextBox> I need to implement word-wrapping in a multi-line textbox. I cannot allow users to write more then 35 chars a line. I am using the following code, which breaks at precisely the specified character on every line, cutting words in half. Can we fix this so that if there's not enough space left for a word on the current line, we move the whole word to the next line? function CountChars(ID) { var IntermediateText = ''; var FinalText = ''; var SubText = ''; var text = document.getElementById(ID.id).value; var lines = text.split("\n"); for (var i = 0; i < lines.length; i++) { IntermediateText = lines[i]; if (IntermediateText.length <= 50) { if (lines.length - 1 == i) FinalText += IntermediateText; else FinalText += IntermediateText + "\n"; } else { while (IntermediateText.length > 50) { SubText = IntermediateText.substring(0, 50); FinalText += SubText + "\n"; IntermediateText = IntermediateText.replace(SubText, ''); } if (IntermediateText != '') { if (lines.length - 1 == i) FinalText += IntermediateText; else FinalText += IntermediateText + "\n"; } } } document.getElementById(ID.id).value = FinalText; $('#' + ID.id).scrollTop($('#' + ID.id)[0].scrollHeight); } Edit - 1 I have to show total max 35 characters in line without specific word break and need to keep margin of two characters from the right. Again, the restriction should be for 35 characters but need space for total 37 (Just for the Visibility issue.)

    Read the article

  • What does it mean to double license?

    - by Adrian Panasiuk
    What does it mean to double license code? I can't just put both licenses in the source files. That would mean that I mandate users to follow the rules of both of them, but the licenses will probably be contradictory (otherwise there'd be no reason to double license). I guess this is something like in cryptographic chaining, cipher = crypt_2(crypt_1(clear)) (generally) means, that cipher is neither the output of crypt_2 on clear nor the output of crypt_1 on clear. It's the output of the composition. Likewise, in double-licensing, in reality my code has one license, it's just that this new license says please follow all of the rules of license1, or all of the rules of license2, and you are hereby granted the right to redistribute this application under this "double" license, license1 or license2, or any license under which license1 or license2 allow you to redistribute this software, in which case you shall replace the relevant licensing information in this application with that of the new license. (Does this mean that before someone may use the app under license1, he has to perform the operation of redistributing to self? How would he document the fact that he did that operation?) Am I correct. What LICENSE file and what text to put in the source files would I need if I wanted to double license on, for the sake of example, Apachev2 and GPLv3 ?

    Read the article

  • Alternative or succesor to GDBM

    - by Anon Guy
    We a have a GDBM key-value database as the backend to a load-balanced web-facing application that is in implemented in C++. The data served by the application has grown very large, so our admins have moved the GDBM files from "local" storage (on the webservers, or very close by) to a large, shared, remote, NFS-mounted filesystem. This has affected performance. Our performance tests (in a test environment) show page load times jumping from hundreds of milliseconds (for local disk) to several seconds (over NFS, local network), and sometimes getting as high as 30 seconds. I believe a large part of the problem is that the application makes lots of random reads from the GDBM files, and that these are slow over NFS, and this will be even worse in production (where the front-end and back-end have even more network hardware between them) and as our database gets even bigger. While this is not a critical application, I would like to improve performance, and have some resources available, including the application developer time and Unix admins. My main constraint is time only have the resources for a few weeks. As I see it, my options are: Improve NFS performance by tuning parameters. My instinct is we wont get much out of this, but I have been wrong before, and I don't really know very much about NFS tuning. Move to a different key-value database, such as memcachedb or Tokyo Cabinet. Replace NFS with some other protocol (iSCSI has been mentioned, but i am not familiar with it). How should I approach this problem?

    Read the article

  • Changing where a resource is pulled during runtime?

    - by Brandon
    I have a website that goes out to multiple clients. Sometimes a client will insist on minor changes. For reasons beyond my control, I have to comply no matter how minor the request. Usually this isn't a problem, I would just create a client specific version of the user control or page and overwrite the default one during build time or make a configuration setting to handle it. Now that I am localizing the site, I'm curious about the best way to go about making minor wording changes. Lets say I have a resource file called Resources.resx that has 300 resources in it. It has a resource called Continue. English value is "Continue", the French value is "Continuez". Now one client, for whatever reason, wants it to say "Next" and "Après" and the others want to keep it the same. What is the best way to accomodate a request like this? (This is just a simple example). The only two ways I can think of is to Create another Resources.resx specific to the client, and replace the .dll during build time. Since I'd be completely replacing the dll, the new resource file would have to contain all 300 strings. The obvious problem being that I now have 2 resource files, each with 300 strings to maintain. Create a custom user control/page and change it to use a custom resource file. e.g. SignIn.ascx would be replaced during the build and it would pull its resources from ClientName.resx instead of Resources.resx. Are there any other things I could try? Is there any way to change it so that the application will always look in a ClientResources.resx file for the overridden values before actually look at the specified resource file?

    Read the article

  • Given a typical Rails 3 environment, why am I unable to execute any tests?

    - by Tom
    I'm working on writing simple unit tests for a Rails 3 project, but I'm unable to actually execute any tests. Case in point, attempting to run the test auto-generated by Rails fails: require 'test_helper' class UserTest < ActiveSupport::TestCase # Replace this with your real tests. test "the truth" do assert true end end Results in the following error: <internal:lib/rubygems/custom_require>:29:in `require': no such file to load -- test_helper (LoadError) from <internal:lib/rubygems/custom_require>:29:in `require' from user_test.rb:1:in `<main>' Commenting out the require 'test_helper' line and attempting to run the test results in this error: user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) The action pack gems appear to be properly installed and up to date: actionmailer (3.0.3, 2.3.5) actionpack (3.0.3, 2.3.5) activemodel (3.0.3) activerecord (3.0.3, 2.3.5) activeresource (3.0.3, 2.3.5) activesupport (3.0.3, 2.3.5) Ruby is at 1.9.2p0 and Rails is at 3.0.3. The sample dump of my test directory is as follows: /fixtures /functional /integration /performance /unit -- /helpers -- user_helper_test.rb -- user_test.rb test_helper.rb I've never seen this problem before - I've run the typical rake tasks for preparing the test environment. I have nothing out of the ordinary in my application or environment configuration files, nor have I installed any unusual gems that would interfere with the test environment. Edit Xavier Holt's suggestion, explicitly specifying the path to the test_helper worked; however, this revealed an issue with ActiveSupport. Now when I attempt to run the test, I receive the following error message (as also listed above): user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) But as you can see above, Action Pack is all installed and update to date.

    Read the article

  • Changing default compiler in Linux, using SCons

    - by ereOn
    On my Linux platform, I have several versions of gcc. Under usr/bin I have: gcc34 gcc44 gcc Here are some outputs: $ gcc --version gcc (GCC) 4.1.2 20080704 (Red Hat 4.1.2-48) $ gcc44 --version gcc44 (GCC) 4.4.0 20090514 (Red Hat 4.4.0-6) I need to use the 4.4 version of gcc however the default seems to the 4.1 one. I there a way to replace /usr/bin/gcc and make gcc44 the default compiler not using a symlink to /usr/bin/gcc44 ? The reason why I can't use a symlink is because my code will have to be shipped in a RPM package using mock. mock creates a minimal linux installation from scratch and just install the specified dependencies before compiling my code in it. I cannot customize this "minimal installation". Ideally, the perfect solution would be to install an official RPM package that replaces gcc with gcc44 as the default compiler. Is there such a package ? Is this even possible/good ? Additional information I have to use SCons (a make alternative) and it doesn't let me specify the binary to use for gcc. I will also accept any answer that will tell me how to specify the gcc binary in my SConstruct file.

    Read the article

  • Different standard streams per POSIX thread

    - by Roman Nikitchenko
    Is there any possibility to achieve different redirections for standard output like printf(3) for different POSIX thread? What about standard input? I have lot of code based on standard input/output and I only can separate this code into different POSIX thread, not process. Linux operation system, C standard library. I know I can refactor code to replace printf() to fprintf() and further in this style. But in this case I need to provide some kind of context which old code doesn't have. So doesn't anybody have better idea (look into code below)? #include <pthread.h> #include <stdio.h> void* different_thread(void*) { // Something to redirect standard output which doesn't affect main thread. // ... // printf() shall go to different stream. printf("subthread test\n"); return NULL; } int main() { pthread_t id; pthread_create(&id, NULL, different_thread, NULL); // In main thread things should be printed normally... printf("main thread test\n"); pthread_join(id, NULL); return 0; }

    Read the article

  • jQuery cycle floats on top of other content

    - by Angie Dubis
    I tried to replace my Flash video with a jQuery cycle. The cycle works, but the images will not stay in the editable region I placed them in. Instead they are floating on top of other content. Any ideas? This is happening on the home page of massageeducator.com There are 2 cycles on the page. “Slideshow1” and “slideshow2”. “slideshow1” works perfectly. The only thing I did differently was set up “slideshow2” as a library item since it will appear on every page, but added function code manually. I tried adding code and images via the template and had the same issue. I also tried adding both the function code and slideshow to each page instead of library item - same problem. I have both slide shows pointing to the same jquery.cycle.lite.1.0.js. Should I rename this .js file and have each cycle point to a different file? I am new to jQuery so any help is appreciated. I can't seem to post my code due to the spam filters in here!

    Read the article

  • Which languages support class replacement?

    - by Alix
    Hi, I'm writing my master thesis, which deals with AOP in .NET, among other things, and I mention the lack of support for replacing classes at load time as an important factor in the fact that there are currently no .NET AOP frameworks that perform true dynamic weaving -- not without imposing the requirement that woven classes must extend ContextBoundObject or MarshalByRefObject or expose all their semantics on an interface. You can however do this in Java thanks to ClassFileTransformer: You extend ClassFileTransformer. You subscribe to the class load event. On class load, you rewrite the class and replace it. All this is very well, but my project director has asked me, quite in the last minute, to give him a list of languages that do / do not support class replacement. I really have no time to look for this now: I wouldn't feel comfortable just doing a superficial research and potentially putting erroneous information in my thesis. So I ask you, oh almighty programming community, can you help out? Of course, I'm not asking you to research this yourselves. Simply, if you know for sure that a particular language supports / doesn't support this, leave it as an answer. If you're not sure please don't forget to point it out. Thanks so much!

    Read the article

  • Replacement for Hamachi for SVN access

    - by Piers
    My company has been using Hamachi to access our SVN repository for a number of years. We are a small yet widely distributed development team with each programmer in a different country working from home. The server is hosted by a non-techie in our central office. Hamachi is useful here since it has a GUI and supports remote management. This system worked well for a while, but recently I have moved to a country with poor internet speeds. Hamachi will no longer connect 99% of the time - instead I get a "Probing..." message that doesn't resolve. It's certain to be a latency issue, as the same laptop will connect without problems when I cross the border and connect using a different ISP with better speeds. So I really need to replace Hamachi with some other VPN/protocol that handles latency better. The techie managing the repository is not comfortable installing and configuring Apache or IIS, so it looks like HTTP is out. I tried to convince my boss to go for a web hosting company, but he doesn't trust a 3rd party with our source. Any other recommended options / experiences out there for accessing our SVN repos that would be as simple as Hamachi for setup; but be more tolerant of network latency issues?

    Read the article

  • Manually Trigger or Prevent Javascript Lazy Loading in Website from Bookmarklet

    - by stwhite
    One of the problems with using a bookmarklet for grabbing images on a page is that if a website uses lazy loading, the bookmarklet won't detect the image because it will have a placeholder, e.g. "grey.gif" and not the actual source of the image. Javascript on page load, is run to replace these urls. I'm looking for a solution to retrieve those images that are not being displayed by either triggering or preventing Lazy Loading from running. This bookmarklet isn't limited to one specific domain. So far some ideas I've had are: Ping the domain and retrieve the page html if no images are found the first time around: Problem: this then requires parsing the actual html. Problem: with lazy loading, a few images will always show, just none below the fold. Scroll page to initiate lazy loading when bookmarklet is clicked, then scroll back to top. Trigger Lazy Loading from inside bookmarklet using script. Lazy Loader adds the "original" attribute, potentially could check if attribute exists w/ value. Problem: ???

    Read the article

  • Hibernate 3.5.0 causes extreme performance problems

    - by user303396
    I've recently updated from hibernate 3.3.1.GA to hibernate 3.5.0 and I'm having a lot of performance issues. As a test, I added around 8000 entities to my DB (which in turn cause other entities to be saved). These entities are saved in batches of 20 so that the transactions aren't too large for performance reasons. When using hibernate 3.3.1.GA all 8000 entities get saved in about 3 minutes. When using hibernate 3.5.0 it starts out slower than with hibernate 3.3.1. But it gets slower and slower. At around 4,000 entities, it sometimes takes 5 minutes just to save a batch of 20. If I then go to a mysql console and manually type in an insert statement from the mysql general query log, half of them run perfect in 0.00 seconds. And half of them take a long time (maybe 40 seconds) or timeout with "ERROR 1205 (HY000): Lock wait timeout exceeded; try restarting transaction" from MySQL. Has something changed in hibernate's transaction management in version 3.5.0 that I should be aware of? The ONLY thing I changed to experience these unusable performance issues is replace the following hibernate 3.3.1.GA jar files: com.springsource.org.hibernate-3.3.1.GA.jar, com.springsource.org.hibernate.annotations-3.4.0.GA.jar, com.springsource.org.hibernate.annotations.common-3.3.0.ga.jar, com.springsource.javassist-3.3.0.ga.jar with the new hibernate 3.5.0 release hibernate3.jar and javassist-3.9.0.GA.jar. Thanks.

    Read the article

  • Matlab GUI - How to get the previous value entered from a callback function?

    - by Graham
    Hi, I know that this is probably a simple problem but I am new to Matlab GUI's and basically want to get the old value which used to be stored in the text box to replace the value which has just been entered. E.g. Text box contains a valid string, User enters invalid string, Callback func, validates input and realises new input is an error and reverts to the old previous value. How should this be implemented or done? Atm I am just using the get and set property values. Below is some sample code: function sampledist_Callback(hObject, eventdata, handles) % hObject handle to sampledist (see GCBO) % eventdata reserved - to be defined in a future version of MATLAB % handles structure with handles and user data (see GUIDATA) % Hints: get(hObject,'String') returns contents of sampledist as text % str2double(get(hObject,'String')) returns contents of sampledist as a double input = str2double(get(hObject,'String')); if(input < 0 || input > 500) errordlg('Sampled Dist. must be > 0 and < 500','Sample Dist - Input Error'); set(handles.sampledist,'String',['10']); %<--- I would like this value 10 to be the previous entry! guidata(hObject,handles); else set(handles.sampledist,'String',['',input]); guidata(hObject,handles); end

    Read the article

  • Syntax Error? When parsing XML value

    - by Ace Munim
    I don't know if I'm having a syntax error but the compiler is giving me TypeError: 'undefined' is not an object (evaluating 'xmlDoc.getElementsByTagName("icon")[i].childNodes') Its me giving me this problem when im parsing the XML from my server, my actual javascript code is like this var xmlDoc = Obj.responseXML; var count = 0; if(xmlDoc){ while(count <= xmlDoc.getElementsByTagName("item").length){ document.getElementById("flow").innerHTML += "<div class='item'><img class='content' src='" + xmlDoc.getElementsByTagName("icon")[i].childNodes[0].nodeValue.replace(/\s+$/g,' ') +"' /></div>"; count++; } }else{ alert("Unable to parse!"); } and my XML goes like this. <feed> <item> <title>Given Title</title> <icon> http://i178.photobucket.com/albums/w255/ace003_album/Logo-ETC-RGB-e1353503652739.jpg </icon> </item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> </feed> i just want to parse the image link and to show it.

    Read the article

  • Is it possible to refer to metadata of the target from within the target implementation in MSBuild?

    - by mark
    Dear ladies and sirs. My msbuild targets file contains the following section: <ItemGroup> <Targets Include="T1"> <Project>A\B.sln"</Project> <DependsOnTargets>The targets T1 depends on</DependsOnTargets> </Targets> <Targets Include="T2"> <Project>C\D.csproj"</Project> <DependsOnTargets>The targets T2 depends on</DependsOnTargets> </Targets> ... </ItemGroup> <Target Name="T1" DependsOnTargets="The targets T1 depends on"> <MSBuild Projects="A\B.sln" Properties="Configuration=$(Configuration)" /> </Target> <Target Name="T2" DependsOnTargets="The targets T2 depends on"> <MSBuild Projects="C\D.csproj" Properties="Configuration=$(Configuration)" /> </Target> As you can see, A\B.sln appears twice: As Project metadata of T1 in the ItemGroup section. In the Target statement itself passed to the MSBuild task. I am wondering whether I can remove the second instance and replace it with the reference to the Project metadata of the target, which name is given to the Target task? Exactly the same question is asked for the (Targets.DependsOnTargets) metadata. It is mentioned twice much like the %(Targets.Project) metadata. Thanks. EDIT: I should probably describe the constraints, which must be satisfied by the solution: I want to be able to build individual projects with ease. Today I can simply execute msbuild file.proj /t:T1 to build the T1 target and I wish to keep this ability. I wish to emphasize, that some projects depend on others, so the DependsOnTargets attribute is really necessary for them.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • prototype findElements querySelectorAll error

    - by JD
    i'm call the "down" function but am getting an invalid argument using 1.6.1_rc2 here's the html snippet: <TR id=000000214A class="activeRow searchResultsDisplayOver" conceptID="0000001KIU"> <TD> <DIV class=gridRowWrapper> <SPAN class=SynDesc>Asymmetric breasts</SPAN> <DIV class=buttonWrapper> <SPAN class=btnAddFav title="Add to Favorites">&nbsp;</SPAN> </DIV> </DIV> </TD> </TR> here's the code: var description = row.down('span.SynDesc').innerHTML; row is a dom reference to the element. prototype is appending a # then the id of the element: findElements: function(root) { root = root || document; var e = this.expression, results; switch (this.mode) { case 'selectorsAPI': if (root !== document) { var oldId = root.id, id = $(root).identify(); id = id.replace(/[\.:]/g, "\\$0"); e = "#" + id + " " + e; } results = $A(root.querySelectorAll(e)).map(Element.extend); <-- e = "#000000214A span.SynDesc" root.id = oldId; return results; case 'xpath': return document._getElementsByXPath(this.xpath, root); default: return this.matcher(root); } i get an "invalid argument" error? if i put a breakpoint before the offending line and change e to be equal to "span.SynDesc" it works fine. help. :)

    Read the article

  • Add an item to the Finder/Save dialog sidebar

    - by Clinton Blackmore
    I'm working on a script where a user logs into a guest account on OS and is prompted for their network credentials in order to mount their network home folder (while they benefit from working on a local user folder). As the guest folder is deleted when users log out, I want to discourage them from saving anything there. I would like to replace the items on the Finder and Open/Save sidebar lists (such as "Desktop", username, "Documents", etc) with ones that would save into their network home folder. It is possible to do this using AppleScript or Cocoa APIs, or do I need to modify a plist and restart the Finder? [Ack. Looking into ~/Library/Preferences/com.apple.sidebars.plist, it isn't at all clear how I'd populate it.] Similar Questions: AppleScript: adding mounted folder to Finder Sidebar? suggests using fstab; this code will most likely run as a user and really, automounting at that point would be too late. How do you programmatically put folder icons on the Finder sidebar, given that you have to use a custom icon for the folder? Says there is no Cocoa API, but that you can use a carbon-style LSSharedFileList API that is only documented in a single header file. Does anyone know of some example code to add an item to the Finder sidebar?

    Read the article

  • using jquery selector to change attribute in variable returned from ajax request

    - by Blake
    I'm trying to pull in a filename.txt (contains html) using ajax and change the src path in the data variable before I load it into the target div. If I first load it into the div the browser first requests the broken image and I don't want this so I would like to do my processing before I load anything onto the page. I can pull the src values fine but I can't change them. In this example the src values aren't changed. Is there a way to do this with selectors or can they only modify DOM elements? Otherwise I may have to do some regex replace but using a selector will be more convenient if possible. $.ajax( { url: getDate+'/'+name+'.txt', success: function(data) { $('img', data).attr('src', 'new_test_src'); $('#'+target).fadeOut('slow', function(){ $('#'+target).html(data); $('#'+target).fadeIn('slow'); }); } }); My reason is I'm building a fully standalone javascript template system for a newsletter and since images and other things are upload via a drupal web file manager I want the content creators to keep their paths very short and simple and I can then modify them before I load in the content. This will also be distributed on a CD so I can need to change the paths for that so they still work.

    Read the article

< Previous Page | 245 246 247 248 249 250 251 252 253 254 255 256  | Next Page >