Search Results

Search found 7634 results on 306 pages for 'preg replace'.

Page 250/306 | < Previous Page | 246 247 248 249 250 251 252 253 254 255 256 257  | Next Page >

  • "rsAccessDenied" error for SSRS 2008

    - by JackLocke
    Hi All, I have been trying to access SSRS Web Service URL hxxp://myServer:80/ReportServer (from Reporting Service Configuration Manager), but my IE always shows "rsAccessDenied" message saying that my account doesn't have privilage required to view. Here are my system specs. Its my laptop with Windows 7 x64, and SQL Server 2008 with SP1 and I am using Mixed Mode Authentication with My account as SysAdmin privilages and this is what I have been trying / tried ... (ofcourse with restarting the service everytime I make any change in configuration), I changed service account from Reporting Service Configuration Manager to make it use My account but nothing happend. I tried running my IE as admin, by RUN AS ADMIN but still same message. Then I read somewhere I have to delete/recreate my encryption keys as well, so I tried again with that, then it was asking me to enter ID/PWD to access server here I am totally blank because it was not accepting my account credentials !!!. Weird thing is I can see my existing reports if I follow this URL hxxp://myServer:80/Reports , for which My guess is solely used to view reports. I have read post here about kind of same problem, but it seems that OP just left forum after asking question... Also, MSDN does have these helps hxxp://msdn.microsoft.com/en-us/library/ms156034.aspx hxxp://msdn.microsoft.com/en-us/library/bb630430.aspx but both of this didn't workout for me. I will really appriciate it if any one can help me out. Jack p.s. I was not allowed to post more than 1 URL because of my "reputation" so I had to change the string a bit. Please replace hxxp wih http in URLs.

    Read the article

  • prototype findElements querySelectorAll error

    - by JD
    i'm call the "down" function but am getting an invalid argument using 1.6.1_rc2 here's the html snippet: <TR id=000000214A class="activeRow searchResultsDisplayOver" conceptID="0000001KIU"> <TD> <DIV class=gridRowWrapper> <SPAN class=SynDesc>Asymmetric breasts</SPAN> <DIV class=buttonWrapper> <SPAN class=btnAddFav title="Add to Favorites">&nbsp;</SPAN> </DIV> </DIV> </TD> </TR> here's the code: var description = row.down('span.SynDesc').innerHTML; row is a dom reference to the element. prototype is appending a # then the id of the element: findElements: function(root) { root = root || document; var e = this.expression, results; switch (this.mode) { case 'selectorsAPI': if (root !== document) { var oldId = root.id, id = $(root).identify(); id = id.replace(/[\.:]/g, "\\$0"); e = "#" + id + " " + e; } results = $A(root.querySelectorAll(e)).map(Element.extend); <-- e = "#000000214A span.SynDesc" root.id = oldId; return results; case 'xpath': return document._getElementsByXPath(this.xpath, root); default: return this.matcher(root); } i get an "invalid argument" error? if i put a breakpoint before the offending line and change e to be equal to "span.SynDesc" it works fine. help. :)

    Read the article

  • What is the minimal licensable source code?

    - by Hernán Eche
    Let's suppose I want to "protect" this code about being used without attribution, patenting it, or through any open source licence... #include<stdio.h> int main (void) { int version=2; printf("\r\n.Hello world, ver:(%d).", version); return 0; } It's a little obvious or just a language definition example.. When a source stop being "trivial, banal, commonplace, obvious", and start to be something that you may claim "rights"? Perhaps it depends on who read it, something that could be great geniality for someone that have never programmed, could be just obvious for an expert. It's easy when watching two sources there are 10000 same lines of code, that's a theft.. but that's not always so obvious. How to measure amount of "ownness", it's about creativity? line numbers? complexity? I can't imagine objetive answers for that, only some patches. For example perhaps the complexity, It's not fair to replace "years of engeneering" with "copy and paste". But is there any objetive index for objetive determination of this subject? (In a funny way I imagine this criterion: If the licence is longer than the code, then there is no owner, just to punish not caring storage space and world resources =P)

    Read the article

  • using ini file in vb6, problem with path to file

    - by DrPut
    I have read many articles about how to use an INI file within my VB6 project. I don't have a problem with the methods, my problem is how to make the EXE file find the INI file. I don't want to hard code the path in the program. I simply want the EXE to expect the INI file to be present in the same folder the EXE is executed from. When I run the program from inside VB6 IDE, the INI is found and processed. When I compile the program and run the EXE, nothing is found. My code looks like: gServer = sGetINI(sINIFile, "TOOLBOM", "ServerName", "?") where TOOLBOM is the [Section] and "ServerName" is the key for the value. I obtained the following code for the API: Rem API DECLARATIONS Declare Function GetPrivateProfileString Lib "kernel32" Alias _ "GetPrivateProfileStringA" (ByVal lpApplicationName _ As String, ByVal lpKeyName As Any, ByVal lpDefault _ As String, ByVal lpReturnedString As String, ByVal _ nSize As Long, ByVal lpFileName As String) As Long Declare Function WritePrivateProfileString Lib "kernel32" Alias _ "WritePrivateProfileStringA" (ByVal lpApplicationName _ As String, ByVal lpKeyName As Any, ByVal lpString As Any, _ ByVal lpFileName As String) As Long Public Function sGetINI(sINIFile As String, sSection As String, sKey _ As String, sDefault As String) As String Dim sTemp As String * 256 Dim nLength As Integer sTemp = Space$(256) nLength = GetPrivateProfileString(sSection, sKey, sDefault, sTemp, _ 255, sINIFile) sGetINI = Left$(sTemp, nLength) End Function Public Sub writeINI(sINIFile As String, sSection As String, sKey _ As String, sValue As String) Dim n As Integer Dim sTemp As String sTemp = sValue Rem Replace any CR/LF characters with spaces For n = 1 To Len(sValue) If Mid$(sValue, n, 1) = vbCr Or Mid$(sValue, n, 1) = vbLf _ Then Mid$(sValue, n) = " " Next n n = WritePrivateProfileString(sSection, sKey, sTemp, sINIFile) End Sub

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Updating Android Tab Icons

    - by lnediger
    I have an activity which has a TabHost containing a set of TabSpecs each with a listview containing the items to be displayed by the tab. When each TabSpec is created, I set an icon to be displayed in the tab header. The TabSpecs are created in this way within a setupTabs() method which loops to create the appropriate number of tabs: TabSpec ts = mTabs.newTabSpec("tab"); ts.setIndicator("TabTitle", iconResource); ts.setContent(new TabHost.TabContentFactory( { public View createTabContent(String tag) { ... } }); mTabs.addTab(ts); There are a couple instances where I want to be able to change the icon which is displayed in each tab during the execution of my program. Currently I am deleting all the tabs, and calling the above code again to re-create them. mTabs.getTabWidget().removeAllViews(); mTabs.clearAllTabs(true); setupTabs(); Is there a way to replace the icon that is being displayed without deleting and re-creating all of the tabs?

    Read the article

  • Exporting emails from outlook programtically with vba

    - by David
    I'm using this script to export email from outlook. My question is how do I export the body of the email without the html formatting ? Sub SaveItemsToExcel() On Error GoTo ErrorHandlerExit Dim oNameSpace As Outlook.NameSpace Dim oFolder As Outlook.MAPIFolder Dim objFS As Scripting.FileSystemObject Dim objOutputFile As Scripting.TextStream Set objFS = New Scripting.FileSystemObject Set objOutputFile = objFS.OpenTextFile("C:\Temp\Export.csv", ForWriting, True) Set oNameSpace = Application.GetNamespace("MAPI") Set oFolder = oNameSpace.PickFolder If oFolder Is Nothing Then GoTo ErrorHandlerExit End If If oFolder.DefaultItemType <> olMailItem Then MsgBox "Folder does not contain mail messages" GoTo ErrorHandlerExit End If objOutputFile.WriteLine "From,Subject,Recived, Body" ProcessFolderItems oFolder, objOutputFile objOutputFile.Close Set oFolder = Nothing Set oNameSpace = Nothing Set objOutputFile = Nothing Set objFS = Nothing ErrorHandlerExit: Exit Sub End Sub Sub ProcessFolderItems(oParentFolder As Outlook.MAPIFolder, ByRef objOutputFile As Scripting.TextStream) Dim oCount As Integer Dim oMail As Outlook.MailItem Dim oFolder As Outlook.MAPIFolder oCount = oParentFolder.Items.Count For Each oMail In oParentFolder.Items If oMail.Class = olMail Then objOutputFile.WriteLine oMail.SenderEmailAddress & "," & Replace(oMail.Subject, ",", "") & "," & oMail.ReceivedTime End If Next oMail Set oMail = Nothing If (oParentFolder.Folders.Count > 0) Then For Each oFolder In oParentFolder.Folders ProcessFolderItems oFolder, objOutputFile Next End If End Sub

    Read the article

  • sql server mdf file database attachment

    - by jnsohnumr
    hello all i'm having a bear of a time getting visual studio 2010 (ultimate i think) to properly attach to my database. it was moved from original spot to #MYAPP#/#MYAPP#.Web/App_Data/#MDF_FILE#.mdf. I have three instances of sql server running on this machine. i have tried to replace the old mdf file with my new one and cannot get the connectionstring right for it. what i'm really wanting to do is to just open some DB instance, run a DB create script. Then I can have a DB that was generated via my edmx (generate database from model) in silverlight business application (c#) right now, when i go to server explorer in VS, choose add new connection, choose MS SQL Server Database FIle (SqlClient), choose my file location (app_data directory), use windows authentication, and hit the Test Connection button I get the following error: Unable to open the physical file "". Operating system error 5: "5(Access Denied.)". An attempt to attach to an auto-named database for file"" failed. A database with the same name exists, or specified file cannot be opened, or it is located on UNC share. The mdf file was created on the same machine by connecting to (local) on the sql server management studio, getting a new query, pasting in the SQL from the generated ddl file, adding a CREATE DATABASE [NcrCarDatabase]; GO before the pasted SQL, and executing the query. I then disconnected from the DB in management studio, closed management studio, navigated to the DATA directory for that instance, and copying the mdf and ldf files to my application's app_data folder. I am then trying to connect to the same file inside visual studio. I hope that gives more clarity to my problems :). Connection string is: Data Source=.\SQLEXPRESS;AttachDbFilename=C:\SourceCode\NcrCarDatabase\NcrCarDatabase.Web\App_Data\NcrCarDatabase.mdf;Integrated Security=True;Connect Timeout=30;User Instance=True

    Read the article

  • How to paginate Django with other get variables?

    - by vagabond
    I am having problems using pagination in Django. Take the URL below as an example: http://127.0.0.1:8000/users/?sort=first_name On this page I sort a list of users by their first_name. Without a sort GET variable it defaults to sort by id. Now if I click the next link I expect the following URL: http://127.0.0.1:8000/users/?sort=first_name&page=2 Instead I lose all get variables and end up with http://127.0.0.1:8000/users/?page=2 This is a problem because the second page is sorted by id instead of first_name. If I use request.get_full_path I will eventually end up with an ugly URL: http://127.0.0.1:8000/users/?sort=first_name&page=2&page=3&page=4 What is the solution? Is there a way to access the GET variables on the template and replace the value for the page? I am using pagination as described in Django's documentation and my preference is to keep using it. The template code I am using is similar to this: {% if contacts.has_next %} <a href="?page={{ contacts.next_page_number }}">next</a> {% endif %}

    Read the article

  • Is there a FAST way to export and install an app on my phone, while signing it with my own keystore?

    - by Alexei Andreev
    So, I've downloaded my own application from the market and installed it on my phone. Now, I am trying to install a temporary new version from Eclipse, but here is the message I get: Re-installation failed due to different application signatures. You must perform a full uninstall of the application. WARNING: This will remove the application data! Please execute 'adb uninstall com.applicationName' in a shell. Launch canceled! Now, I really really don't want to uninstall the application, because I will lose all my data. One solution I found is to Export my application, creating new .apk, and then install it via HTC Sync (probably a different program based on what phone you have). The problem is this takes a long time to do, since I need to enter the password for the keystore each time and then wait for HTC Sync. It's a pain in the ass! So the question is: Is there a way to make Eclipse automatically use my keystore to sign the application (quickly and automatically)? Or perhaps to replace debug keystore with my own? Or perhaps just tell it to remember the password, so I don't have to enter it every time...? Or some other way to solve this problem?

    Read the article

  • Syntax Error? When parsing XML value

    - by Ace Munim
    I don't know if I'm having a syntax error but the compiler is giving me TypeError: 'undefined' is not an object (evaluating 'xmlDoc.getElementsByTagName("icon")[i].childNodes') Its me giving me this problem when im parsing the XML from my server, my actual javascript code is like this var xmlDoc = Obj.responseXML; var count = 0; if(xmlDoc){ while(count <= xmlDoc.getElementsByTagName("item").length){ document.getElementById("flow").innerHTML += "<div class='item'><img class='content' src='" + xmlDoc.getElementsByTagName("icon")[i].childNodes[0].nodeValue.replace(/\s+$/g,' ') +"' /></div>"; count++; } }else{ alert("Unable to parse!"); } and my XML goes like this. <feed> <item> <title>Given Title</title> <icon> http://i178.photobucket.com/albums/w255/ace003_album/Logo-ETC-RGB-e1353503652739.jpg </icon> </item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> </feed> i just want to parse the image link and to show it.

    Read the article

  • PostgreSQL: return select count(*) from old_ids;

    - by Alexander Farber
    Hello, please help me with 1 more PL/pgSQL question. I have a PHP-script run as daily cronjob and deleting old records from 1 main table and few further tables referencing its "id" column: create or replace function quincytrack_clean() returns integer as $BODY$ begin create temp table old_ids (id varchar(20)) on commit drop; insert into old_ids select id from quincytrack where age(QDATETIME) > interval '30 days'; delete from hide_id where id in (select id from old_ids); delete from related_mks where id in (select id from old_ids); delete from related_cl where id in (select id from old_ids); delete from related_comment where id in (select id from old_ids); delete from quincytrack where id in (select id from old_ids); return select count(*) from old_ids; end; $BODY$ language plpgsql; And here is how I call it from the PHP script: $sth = $pg->prepare('select quincytrack_clean()'); $sth->execute(); if ($row = $sth->fetch(PDO::FETCH_ASSOC)) printf("removed %u old rows\n", $row['count']); Why do I get the following error? SQLSTATE[42601]: Syntax error: 7 ERROR: syntax error at or near "select" at character 9 QUERY: SELECT select count(*) from old_ids CONTEXT: SQL statement in PL/PgSQL function "quincytrack_clean" near line 23 Thank you! Alex

    Read the article

  • Trying to use jquery ui in google chrome extension in the content level

    - by user135697
    The problem is that the scope of the content script is on the web page that your plugin is suppose to be used at. So the css background:url(images/ui-bg_inset-hard_100_fcfdfd_1x100.png) becomes url('http://webpageforplugin/images/ui-bg_inset-hard_100_fcfdfd_1x100.png') in order for this to work as far as i understood i need to have it to point to: url('chrome-extension://extensionId/images/ui-bg_inset-hard_100_fcfdfd_1x100.png') So i tried to haxorz the document.styleSheets var ss = document.styleSheets; for (var i=0; i<ss.length; i++) { var found=-1, x,i; var rules = ss[i].cssRules || ss[i].rules; for (var j=0; j<rules.length; j++) { if ('.ui-helper-hidden'==rules[j].selectorText){ found=i; break; } } if (found>-1){ for (var j=0; j<rules.length; j++) { if (x=rules[j].style.background){ if ((i=x.indexOf('url'))!=-1) rules[j].style.background = x.replace('http://page/images/','chrome-extension://extensionId/images/'); } } break; } }; I feel that i'm missing the obvious. That there must be an easier way. Even if i manage to change this how will i get the extension id to build the string. Btw this doesn't work, the icons are not properly fetched. (I hardcoded the extension id) Any ideas?

    Read the article

  • How do I make custom functions chain-able with jQuery's?

    - by sergio
    I need a "callfront" or "precall" (the opposite of "callback" ¿?) to add in MANY places before an animation occurs in an existing plugin, To be used like e.g. $(some_unpredictable_obj).preFunct().animate(… The problem is, as I said they are MANY places, and all of them are different animations, on different objects. I can TELL where all of them occur, but I don't want to add over and over the same code. I actually have to add both a function before and after those animations, but I think I can use the callback for all of them. In a perfect world, I'd like to replace every animate(property, duration) by preFunct().animate(property,duration).postFunct() preFunct and postFunct don't need parameters, since they are always the same action, on the same object. This could be an amazing addition to "jQuery" (an easy way to jQuerize custom functions to be added to the normal chain (without messing with queues) I found this example but it will act on the applied element, and I don't want that because, as I said above, all the original animations to be added to are on different elements. I also found jQuery.timing, but it looks cooler the chain-able function :) Thanks.

    Read the article

  • Problem using the find function in MATLAB

    - by Peter Etchells
    I have two arrays of data that I'm trying to amalgamate. One contains actual latencies from an experiment in the first column (e.g. 0.345, 0.455... never more than 3 decimal places), along with other data from that experiment. The other contains what is effectively a 'look up' list of latencies ranging from 0.001 to 0.500 in 0.001 increments, along with other pieces of data. Both data sets are X-by-Y doubles. What I'm trying to do is something like... for i = 1:length(actual_latency) row = find(predicted_data(:,1) == actual_latency(i)) full_set(i,1:4) = [actual_latency(i) other_info(i) predicted_info(row,2) ... predicted_info(row,3)]; end ...in order to find the relevant row in predicted_data where the look up latency corresponds to the actual latency. I then use this to created an amalgamated data set, full_set. I figured this would be really simple, but the find function keeps failing by throwing up an empty matrix when looking for an actual latency that I know is in predicted_data(:,1) (as I've double-checked during debugging). Moreover, if I replace find with a for loop to do the same job, I get a similar error. It doesn't appear to be systematic - using different participant data sets throws it up in different places. Furthermore, during debugging mode, if I use find to try and find a hard-coded value of actual_latency, it doesn't always work. Sometimes yes, sometimes no. I'm really scratching my head over this, so if anyone has any ideas about what might be going on, I'd be really grateful.

    Read the article

  • Creating a three level ASP.NET menu with SiteMap, how do i do it?

    - by user270399
    I want to create a three level menu, I have got a recursive function today that works with three levels. But the thing is how do i output the third lever? Using two repeaters i have managed to get a hold of the first two levels through the ChildNodes property. But that only gives me the second level. What if a want the third level? Example code below. How do i get the third level? :) <asp:Repeater ID="FirstLevel" DataSourceID="SiteMapDataSource" runat="server" EnableViewState="false"> <ItemTemplate> <li class="top"> <a href='/About/<%#Eval("Title")%>.aspx' class="top_link"><span class="down"><%#Eval("Title")%></span><!--[if gte IE 7]><!--></a><!--<![endif]--> <asp:Repeater runat="server" ID="SecondLevel" DataSource='<%#((SiteMapNode)Container.DataItem).ChildNodes%>'> <HeaderTemplate><!--[if lte IE 6]><table><tr><td><![endif]--><ul class="sub"></HeaderTemplate> <ItemTemplate> <li> <a href='<%#((string)Eval("Url")).Replace("~", "")%>' style="text-align: left;"><%#Eval("Title")%></a> Third repeater here? </li> </ItemTemplate> <FooterTemplate></ul><!--[if lte IE 6]></td></tr></table></a><![endif]--></FooterTemplate> </asp:Repeater> </li> </ItemTemplate> </asp:Repeater>

    Read the article

  • Streaming content to JSF UI

    - by Mark Lewis
    Hello, I was quite happy with my JSF app which read the contents of MQ messages received and supplied them to the UI like this: <rich:panel> <snip> <rich:panelMenuItem label="mylabel" action="#{MyBacking.updateCurrent}"> <f:param name="current" value="mylog.log" /> </rich:panelMenuItem> </snip> </rich:panel> <rich:panel> <a4j:outputPanel ajaxRendered="true"> <rich:insert content="#{MyBacking.log}" highlight="groovy" /> </a4j:outputPanel> </rich:panel> and in MyBacking.java private String logFile = null; ... public String updateCurrent() { FacesContext context=FacesContext.getCurrentInstance(); setCurrent((String)context.getExternalContext().getRequestParameterMap().get("current")); setLog(getCurrent()); return null; } public void setLog(String log) { sendMsg(log); msgBody = receiveMsg(moreargs); logFile = msgBody; } public String getLog() { return logFile; } until the contents of one of the messages was too big and tomcat fell over. Obviously, I thought, I need to change the way it works so that I return some form of stream so that no one object grows so big that the container dies and the content returned by successive messages is streamed to the UI as it comes in. Am I right in thinking that I can replace the work I'm doing now on a String object with a BufferedOutputStream object ie no change to the JSF code and something like this changing at the back end: private BufferedOutputStream logFile = null; public void setLog(String log) { sendMsg(args); logFile = (BufferedOutputStream) receiveMsg(moreargs); } public String getLog() { return logFile; }

    Read the article

  • Java function changing input

    - by Doodle
    I would like to go from one number to another. For example if I started at 6 and my goal was 10 I want a function that on every pass would bring me from 6 towards 10 or if I had the number 14 and my goal was 9 it would count down from 14 towards 9.So far I have (this is written in Processing a Java Api but there is essentially no difference from regualr Java, draw is just a continuous loop) int x=100; void draw(){ x=towards(x,10); println(x); } int towards(int current ,int target){ if(current!=target){ if (current <target){ current=current+1; } else { current=current-1; } } return current; } this gives me the results I would like but I would like to have everything in side of the towards() function. When I replace X with a variable it of course resets it self to the static variable. To sum it up how can I pass a variable to a function and have that variable thats been passed change on every subsequent pass. I have looked into recursion as a solution but that of just brings me to a final solution. I can pass the count to an array but wouldn't like to do that either.

    Read the article

  • jquery events on input submit fields

    - by dfilkovi
    I have a problem with jquery submit button onclick and default event. What I want to do is replace an click event on submit button if it has one, and get an dialog box to show up, on clicking yes the dialog should start that default onclick event if submit button has one defined, if it hasn't than the default event should happen (button submits form), .submit() function does not work for me in any case cause I need to send this button also through a form and if button wasn't clicked .submit() sends form data without submit data. Bellow code has a problem, alert('xxx') is always called and it shouldn't, and on clicking yes button alert and dialog creation is called again, also if I remove alert button, I cannot call default submit button event (form submitting with a button). $('input.confirm').each(function() { var input = this; var dialog = document.createElement("div"); $(dialog).html('<p>AREYOUSHURE</p>'); $(input).click(function(event) { event.preventDefault(); var buttons = {}; buttons['NO'] = function() { $(this).dialog("close"); }; buttons['YES'] = function() { $(input).trigger('click'); $(this).dialog("close"); }; $(dialog).dialog( { autoOpen: false, width: 200, modal: true, resizable: false, buttons: buttons }); $(dialog).dialog('open'); return false; }); }); <form method="post" action=""> <input type="hidden" value="1" name="eventId" /> <input type="submit" value="Check" name="checkEvent" class="confirm" onclick="alert('xxx');" /> </form>

    Read the article

  • Trouble with building up a string in Clojure

    - by Aki Iskandar
    Hi gang - [this may seem like my problem is with Compojure, but it isn't - it's with Clojure] I've been pulling my hair out on this seemingly simple issue - but am getting nowhere. I am playing with Compojure (a light web framework for Clojure) and I would just like to generate a web page showing showing my list of todos that are in a PostgreSQL database. The code snippets are below (left out the database connection, query, etc - but that part isn't needed because specific issue is that the resulting HTML shows nothing between the <body> and </body> tags). As a test, I tried hard-coding the string in the call to main-layout, like this: (html (main-layout "Aki's Todos" "Haircut<br>Study Clojure<br>Answer a question on Stackoverfolw")) - and it works fine. So the real issue is that I do not believe I know how to build up a string in Clojure. Not the idiomatic way, and not by calling out to Java's StringBuilder either - as I have attempted to do in the code below. A virtual beer, and a big upvote to whoever can solve it! Many thanks! ============================================================= ;The master template (a very simple POC for now, but can expand on it later) (defn main-layout "This is one of the html layouts for the pages assets - just like a master page" [title body] (html [:html [:head [:title title] (include-js "todos.js") (include-css "todos.css")] [:body body]])) (defn show-all-todos "This function will generate the todos HTML table and call the layout function" [] (let [rs (select-all-todos) sbHTML (new StringBuilder)] (for [rec rs] (.append sbHTML (str rec "<br><br>"))) (html (main-layout "Aki's Todos" (.toString sbHTML))))) ============================================================= Again, the result is a web page but with nothing between the body tags. If I replace the code in the for loop with println statements, and direct the code to the repl - forgetting about the web page stuff (ie. the call to main-layout), the resultset gets printed - BUT - the issue is with building up the string. Thanks again. ~Aki

    Read the article

  • Starting Beyond Compare from the Command Line

    - by Logan
    I have Beyond Compare 3 installed at; "C:\Program Files\Beyond Compare 3\BCompare.exe" and Cygwin; "C:\Cygwin\bin\bash.exe" What I would like is to be able to use a command such as; diff <file1> <file2> into the Cygwin shell and to have the shell fork a process opening the two files in beyond compare. I looked at the Beyond Compare Support Page but I'm afraid It was too brief for me. I tried copying the text verbatim (apart from path to executable) to no avail; Instead of using a batch file, create a file named "bc.sh" with the following line: "$(cygpath 'C:\Progra~1\Beyond~1\bcomp.exe')" `cygpath -w "$6"` `cygpath -w "$7"` /title1="$3" /title2="$5" /readonly Was I supposed to replace cygpath? I get a 'Command not found' error when I enter the name of the script on the command line. gavina@whwgavina1 /cygdrive $ "C:\Documents and Settings\gavina\Desktop\bc.sh" bash: C:\Documents and Settings\gavina\Desktop\bc.sh: command not found Does anyone have Beyond Compare working as I have described? Is this even possible in a Windows environment? Thanks in advance!

    Read the article

  • Which frameworks (and associated languages) support class replacement?

    - by Alix
    Hi, I'm writing my master thesis, which deals with AOP in .NET, among other things, and I mention the lack of support for replacing classes at load time as an important factor in the fact that there are currently no .NET AOP frameworks that perform true dynamic weaving -- not without imposing the requirement that woven classes must extend ContextBoundObject or MarshalByRefObject or expose all their semantics on an interface. You can however do this with the JVM thanks to ClassFileTransformer: You extend ClassFileTransformer. You subscribe to the class load event. On class load, you rewrite the class and replace it. All this is very well, but my project director has asked me, quite in the last minute, to give him a list of frameworks (and associated languages) that do / do not support class replacement. I really have no time to look for this now: I wouldn't feel comfortable just doing a superficial research and potentially putting erroneous information in my thesis. So I ask you, oh almighty programming community, can you help out? Of course, I'm not asking you to research this yourselves. Simply, if you know for sure that a particular framework supports / doesn't support this, leave it as an answer. If you're not sure please don't forget to point it out. Thanks so much!

    Read the article

  • How to traverse table in Jquery and add a class?

    - by SWL
    I have a simple table of two rows. The first column is required, but the others are not; however, I would like them to be required in pairs. So if the user enters a value for Quantity3, then Size3 should also now be required. As a fiddle: http://jsfiddle.net/NaRts/7/ <tr> <td><input name="qty1[492]" class="qty required" type="text"></td> <td><input name="qty2[492]" class="qty" type="text"></td> <td><input name="qty3[492]" class="qty" type="text"></td> </tr><tr> <td><input name="size1[492]" type="text" class="size required" ></td> <td><input name="size2[492]" type="text" class="size" ></td> <td><input name="size3[492]" type="text" class="size" ></td> </tr> And the simple jQuery I have is: $('.qty').keyup(function() { var s = $(this).attr('name'); // = qty3[418] var qtyID = s.replace(/[^1-9\[\]]/g, ""); // = 3[418] var SizeID = "size" + qtyID; var $sizeInput = $(this).closest('tr').next().find(SizeID); $sizeInput.css('background-color', 'green'); $sizeInput.addClass('required'); //I tried this too but it didn't work //$(this).parent().find(SizeID).addClass('required'); });? ? Any help is much appreciated.

    Read the article

  • Dice Emulation - ImageView

    - by Michelle Harris
    I am trying to emulate dice using ImageView. When I click the button, nothing seems to happen. I have hard coded this example to replace the image with imageView4 for debugging purposes (I was making sure the random wasn't fail). Can anyone point out what I am doing wrong? I am new to Java, Eclipse and Android so I'm sure I've probably made more than one mistake. Java: import java.util.Random; import android.app.Activity; import android.os.Bundle; import android.view.View; import android.widget.ArrayAdapter; import android.widget.ImageView; import android.widget.Spinner; import android.widget.Toast; public class Yahtzee4Activity extends Activity { /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); Spinner s = (Spinner) findViewById(R.id.spinner); ArrayAdapter adapter = ArrayAdapter.createFromResource( this, R.array.score_types, android.R.layout.simple_spinner_dropdown_item); adapter.setDropDownViewResource(android.R.layout.simple_spinner_dropdown_item); s.setAdapter(adapter); } public void onMyButtonClick(View view) { ImageView imageView1 = new ImageView(this); Random rand = new Random(); int rndInt = 4; //rand.nextInt(6) + 1; // n = the number of images, that start at index 1 String imgName = "die" + rndInt; int id = getResources().getIdentifier(imgName, "drawable", getPackageName()); imageView1.setImageResource(id); } } XML for the button: <Button android:id="@+id/button_roll" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/roll" android:onClick="onMyButtonClick" />

    Read the article

  • XML Decryption Bug (referencing issue)

    - by OrangePekoe
    Hi, Needing some explanation of what exactly the decryption is doing, in addition to some help on solving the problem. Currently, when a portion of XML is encrypted, and then decrypted, the DOM appears to work correctly. We can see the element is encrypted and then see it return back once it is decrypted. Our problem lies when a user tries to change data in that same element after decryption has occurred. When a user changes some settings, data in the XML should change. However, if the user attempts to change an XML element that has been decrypted the changes are not reflected in the DOM. We have a reference pointer to the XML element that is used to bind the element to an object. If you encrypt the node and then decrypt it, the reference pointer now points to a valid orphaned XML element that is no longer part of the DOM. After decryption, there will be 2 copies of the XML element. One in the DOM as expected (though will not reflect new changes), and one orphaned element in memory that is still referenced by our pointer. The orphaned element is valid (reflects new changes). We can see that this orphaned element is owned by the DOM, but when we try to return its parent, it returns null. The question is: Where did this orphaned xml element come from? And how can we get it to correctly append (replace old data) to the DOM? The code resembles: public static void Decrypt(XmlDocument Doc, SymmetricAlgorithm Alg) { if (Doc == null) throw new ArgumentNullException("Doc"); if (Alg == null) throw new ArgumentNullException("Alg"); XmlElement encryptedElement = Doc.GetElementsByTagName("EncryptedData")[0] as XmlElement; if (encryptedElement == null) { throw new XmlException("The EncryptedData element was not found."); } EncryptedData edElement = new EncryptedData(); edElement.LoadXml(encryptedElement); EncryptedXml exml = new EncryptedXml(); byte[] rgbOutput = exml.DecryptData(edElement, Alg); exml.ReplaceData(encryptedElement, rgbOutput); }

    Read the article

< Previous Page | 246 247 248 249 250 251 252 253 254 255 256 257  | Next Page >