Search Results

Search found 8942 results on 358 pages for 'print r'.

Page 272/358 | < Previous Page | 268 269 270 271 272 273 274 275 276 277 278 279  | Next Page >

  • Search one element of a list in another list recursively

    - by androidnoob
    I have 2 lists old_name_list = [a-1234, a-1235, a-1236] new_name_list = [(a-1235, a-5321), (a-1236, a-6321), (a-1234, a-4321), ... ] I want to search recursively if the elements in old_name_list exist in new_name_list and returns the associated value with it, for eg. the first element in old_name_list returns a-4321, second element returns a-5321, and so on until old_name_list finishes. I have tried the following and it doesn't work for old_name, new_name in zip(old_name_list, new_name_list): if old_name in new_name[0]: print new_name[1] Is the method I am doing wrong or I have to make some minor changes to it? Thank you in advance.

    Read the article

  • Bash - replacing targeted files with a specific file, whitespace in directory names

    - by Dispelwolf
    I have a large directory tree of files, and am using the following script to list and replace a searched-for name with a specific file. Problem is, I don't know how to write the createList() for-loop correctly to account for whitespace in a directory name. If all directories don't have spaces, it works fine. The output is a list of files, and then a list of "cp" commands, but reports directories with spaces in them as individual dirs. aindex=1 files=( null ) [ $# -eq 0 ] && { echo "Usage: $0 filename" ; exit 500; } createList(){ f=$(find . -iname "search.file" -print) for i in $f do files[$aindex]=$(echo "${i}") aindex=$( expr $aindex + 1 ) done } writeList() { for (( i=1; i<$aindex; i++ )) do echo "#$i : ${files[$i]}" done for (( i=1; i<$aindex; i++ )) do echo "/usr/bin/cp /cygdrive/c/testscript/TheCorrectFile.file ${files[$filenumber]}" done } createList writeList

    Read the article

  • Code compiles etc. but just hangs on run.

    - by Aidan
    Hey guys, My program is meant to parse through a text file, extract relevant data and then save it in a SQL table. I compile it like so.. gcc -o parse parse.c -I/usr/include/mysql -L/usr/lib/mysql -lmysqlclient_r then I run it like so... ./parse > tweets.rss But it just hangs. it doesn't print any printf's I put in to debug. Whats wrong? here is my code... http://pastebin.com/3R45zyMp I'd appreciate any help!

    Read the article

  • In PHP how do i update values in an asssociative array and store the entire array?

    - by amnesia-55
    Here's a code example: $array = array(); $array['master']['slave'] = "foo"; foreach ($array as $key => $value) { foreach ($value as $key2 => $value2) { if (preg_match('/slave/',$key2)) { $value[$key2] = "bar"; print "$value[$key2] => $key2 => $value2\n"; } } } print_r($array); Output: bar => slave => foo Array ( [master] => Array ( [slave] => foo ) ) Rather i would like to have the following as the final array: Array ( [master] => Array ( [slave] => bar ) ) What wrong am i doing here? Thank you!

    Read the article

  • php - How do I get rid of this strange "empty delimiter" message

    - by Steven
    I have some code that uses the stristr function to extract data I need. It works, in that it gives me the results I'm looking for. BUT (you knew there was a but), it gives me this error message for every iteration of the loop: Warning: stristr() [function.stristr]: Empty delimiter in ... line 55 Like I said, the code works apart from this error. Can anyone suggest how i could amend this code to get rid of the message? Thanks in advance $data = stristr("$text", "$key"); $result = string_limit_words($data,2); print "$result<BR>";

    Read the article

  • JSP::Confused with the session objects

    - by Legend
    I just started exploring Java Servlets and JSP and am a little confused about the sessions object. Inside a servlet I have this: public class SampleServlet extends HttpServlet { public void doPost(HttpServletRequest request, HttpServletResponse response) throws IOException { HttpSession session = request.getSession(true); session.setAttribute("_session", "_value"); response.sendRedirect("page2.jsp"); } } Now, inside page2.jsp, there is a session object as well, but when I do this <% out.print(session.getAttribute("_session")) %> it gives me an error. Can someone tell me the right way of doing this? As to what I am trying to do, I want to share some session variables.

    Read the article

  • Write a recursive function in C that converts a number into a string

    - by user3501779
    I'm studying software engineering, and came across this exercise: it asks to write a recursive function in C language that receives a positive integer and an empty string, and "translates" the number into a string. Meaning that after calling the function, the string we sent would contain the number but as a string of its digits. I wrote this function, but when I tried printing the string, it did print the number I sent, but in reverse. This is the function: void strnum(int n, char *str) { if(n) { strnum(n/10, str+1); *str = n%10 + '0'; } } For example, I sent the number 123 on function call, and the output was 321 instead of 123. I also tried exchanging the two lines within the if statement, and it still does the same. I can't figure out what I did wrong. Can someone help please? NOTE: Use of while and for loop statements is not allowed for the exercise.

    Read the article

  • Mail php function does'nt send the email

    - by Mamadou
    Hello everybody, I have the following code wich work on some server and does not work in an other: $Name = "myname"; //senders name $email_sender = "[email protected]"; //senders e-mail adress $recipient = $email; //recipient $mail_body = "The text for the mail..."; //mail body $subject = "Subject for reviever"; //subject $header = "From: ". $Name . " <" . $email_sender . ">\r\n"; $status = mail($recipient, $subject, $mail_body, $header); print('ENVOI '. $status); the $status variable is true but i dont see any email.

    Read the article

  • PHP, login to pop3-server

    - by Ockonal
    Hi guys, I have another one problem with pop3. Here is connection to pop3-server: $pop3Server = '62.113.86.215'; // mail.roller.ru $pop3User = 'mail-robot%roller.ru'; $pop_conn = fsockopen($pop3Server, 110, $errno, $errstr, 30); echo fgets($pop_conn, 1024); It returns OK. The next step is login: fputs($pop_conn, 'USER '.$pop3User.'\r\n'); //stream_set_timeout($pop_conn, 3); print fgets($pop_conn, 1024); And I get time-out. Why? p.s. Here is full code: http://pastie.org/934170

    Read the article

  • AppEngine: Can I write a Dynamic property (db.Expando) with a name chosen at runtime?

    - by MarcoB
    If I have an entity derived from db.Expando I can write Dynamic property by just assigning a value to a new property, e.g. "y" in this example: class MyEntity(db.Expando): x = db.IntegerProperty() my_entity = MyEntity(x=1) my_entity.y = 2 But suppose I have the name of the dynamic property in a variable... how can I (1) read and write to it, and (2) check if the Dynamic variable exists in the entity's instance? e.g. class MyEntity(db.Expando): x = db.IntegerProperty() my_entity = MyEntity(x=1) # choose a var name: var_name = "z" # assign a value to the Dynamic variable whose name is in var_name: my_entity.property_by_name[var_name] = 2 # also, check if such a property esists if my_entity.property_exists(var_name): # read the value of the Dynamic property whose name is in var_name print my_entity.property_by_name[var_name] Thanks...

    Read the article

  • Why doesn't the C++ default destructor destroy my objects?

    - by Oszkar
    The C++ specification says the default destructor deletes all non-static members. Nevertheless, I can't manage to achieve that. I have this: class N { public: ~N() { std::cout << "Destroying object of type N"; } }; class M { public: M() { n = new N; } // ~M() { //this should happen by default // delete n; // } private: N* n; }; Then this should print the given message, but it doesn't: M* m = new M(); delete m; //this should invoke the default destructor

    Read the article

  • dreferencing 2 d array

    - by ashish-sangwan
    Please look at this peice of code :- #include<stdio.h> int main() { int arr[2][2]={1,2,3,4}; printf("%d %u %u",**arr,*arr,arr); return 0; } When i compiled and executed this program i got same value for arr and *arr which is the starting address of the 2 d array. For example:- 1 3214506 3214506 My question is why does dereferencing arr ( *arr ) does not print the value stored at the address contained in arr ?

    Read the article

  • What host do I have to bind a listening socket to?

    - by herrturtur
    I used python's socket module and tried to open a listening socket using import socket import sys def getServerSocket(host, port): for r in socket.getaddrinfo(host, port, socket.AF_UNSPEC, socket.SOCK_STREAM, 0, socket.AI_PASSIVE): af, socktype, proto, canonname, sa = r try: s = socket.socket(af, socktype, proto) except socket.error, msg: s = None continue try: s.bind(sa) s.listen(1) except socket.error, msg: s.close() s = None continue break if s is None: print 'could not open socket' sys.exit(1) return s Where host was None and port was 15000. The program would then accept connections, but only from connections on the same machine. What do I have to do to accept connections from the internet?

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • PHP: HOw to store and retrieve the data entered by a user in a text field from a file?

    - by kishore
    HI all, I want to Store the data entered by user in a file. If a user enters his description in a text field, Then i Have to store the data in a file. All the users data will go to the same file with their user name and description. And I have to retrieve The Data from that file for a particular user. For example if there are two users with their descriptions in the file, Then I have to retrieve a particular users description and print it on the users page. How can I store and retrieve The data from a file?

    Read the article

  • Regex for template tag with attributes

    - by Funkmyer
    Hi, I haven't found my answer after reading through all of these posts, so I'm hoping one of you heavy hitter regex folks can help me out. I'm trying to isolate the tag name and any attributes from the following string format: {TAG:TYPE attr1="foo" attr2="bar" attr3="zing" attr4="zang" attr5="zoom" ...} NOTE: in the above example, TAG will always be the same and TYPE will be one of several preset strings (e.g. share,print,display etc...). TAG and TYPE are uppercased only for the example but will not be case sensitive for real.

    Read the article

  • Creating interruptible process in python

    - by Glycerine
    I'm creating a python script of which parses a large (but simple) CSV. It'll take some time to process. I would like the ability to interrupt the parsing of the CSV so I can continue at a later stage. Currently I have this - of which lives in a larger class: (unfinished) Edit: I have some changed code. But the system will parse over 3 million rows. def parseData(self) reader = csv.reader(open(self.file)) for id, title, disc in reader: print "%-5s %-50s %s" % (id, title, disc) l = LegacyData() l.old_id = int(id) l.name = title l.disc_number = disc l.parsed = False l.save() This is the old code. def parseData(self): #first line start fields = self.data.next() for row in self.data: items = zip(fields, row) item = {} for (name, value) in items: item[name] = value.strip() self.save(item) Thanks guys.

    Read the article

  • How to Get the Method/Function Call Trace for a Specific Run?

    - by JackWM
    Given a Java or JavaScript program, after its execution, print out a sequence of calls. The calls are in invocation order. E.g. main() { A(); } A() { B(); C(); } Then the call trace should be: main -> A() -> B() -> C() Is there any tool that can profile and output this kind of information? It seems this is common a need for debugging or performance tuning. I noticed that some profilers can do this, but I prefer a simpler/easy-to-use one. Thanks!

    Read the article

  • c++ Mixing printf, cout with wprintf, wcout

    - by Bo Jensen
    I know you should not mix printing with printf,cout and wprintf,wcout, but have a hard time finding a good answer why and if it is possible to get round it. The problem is I use a external library that prints with printf and my own uses wcout. If I do a simple example it works fine, but from my full application it simply does not print the printf statements. If this is really a limitation, then there would be many libraries out there which can not work together with wide printing applications. Any insight on this is more than welcome.

    Read the article

  • javascript really strange behaviour

    - by teehoo
    I have the following code if (msg.position == 0) //removed for brevity else if (msg.position == txtArea.value.length) //removed for brevity } else { //ERROR: should not reach here. errorDivTag.innerHTML += msg.position + " " + txtArea.value.length; } I'm having some really weird situations where I'm getting the error in the last code block, but the printed positions show that msg.position is in fact equal to the txtArea.value.length. This only happens 1% of the time, almost as if I have some kind of race-condition in my code where the two are NOT equal during the second if statement, but equal when I print in the error message. Any ideas?

    Read the article

  • Project Euler: problem 8

    - by Marijus
    n = # some ridiculously large number, omitted N = [int(i) for i in str(n)] maxProduct = 0 for i in range(0,len(N)-4): newProduct = 1 is_cons = 0 for j in range(i,i+4): if N[j] == N[j+1] - 1: is_cons += 1 if is_cons == 5: for j in range(i,i+5): newProduct *= N[j] if newProduct > maxProduct: maxProduct = newProduct print maxProduct I've been working on this problem for hours now and I can't get this to work. I've tried doing this algorithm on paper and it works just fine.. Could you give me hints what's wrong ?

    Read the article

  • deleting unaccessed files using python

    - by damon
    My django app parses some files uploaded by the user.It is possible that the file uploaded by the user may remain in the server for a long time ,without it being parsed by the app.This can increase in size if a lot of users upload a lot of files. I need to delete those files not recently parsed by the app -say not accessed for last 24 hours.I tried like this import os import time dirname = MEDIA_ROOT+my_folder filenames = os.listdir(dirname) filenames = [os.path.join(dirname,filename) for filename in filenames] for filename in filenames: last_access = os.stat(filename).st_atime #secs since epoch rtime = time.asctime(time.localtime(last_access)) print filename+'----'+rtime This shows the last accessed times for each file..But I am not sure how I can test if the file access time was within the last 24 hours..Can somebody help me out?

    Read the article

  • simple php script

    - by Nerdysyntax
    New to php and taking a class for it. Bought php6 and mysql 6 bible to get started. Of course the hello world script is the first you get and it doesn't show. It just reads part of my script and I'm not sure the problem. Link to test - http://harden6615.com/ I am using a hosted server I bought for class, but I have also check it using MAMP. I figured my script is wrong, but I have copied and pasted and still no Hello World. Any suggestions? What I copied: <?php print("Hello, World<BR />\n"); phpinfo(); ?>

    Read the article

  • Double # showing 0 on android

    - by Dave
    I'm embarrassed to ask this question, but after 45 minutes of not finding a solution I will resort to public humiliation. I have a number that is being divided by another number and I'm storing that number in a double variable. The numbers are randomly generated, but debugging the app shows that both numbers are in fact being generated. Lets just say the numbers are 476 & 733. I then take the numbers and divide them to get the percentage 476/733 = .64 I then print out the variable and it's always set to 0. I've tried using DecimalFormat and NumberFormat. No matter what I try though it always says the variable is 0. I know there is something simple that I'm missing, I just can't find it =/.

    Read the article

  • PHP callback function not being called

    - by Industrial
    Hi everyone, I've got the following code: function _callback_memcache_failure($host, $port) { print "memcache '$host:$port' failed"; } $this->memcache = new Memcache; $this->memcache->addServer('192.168.1.35', '11211', 0, 50, 10, TRUE, _callback_memcache_failure('192.168.1.35','11211')); The server is online and running (verified!), but the Failure callback function is being called at each connection. Why is that? Reference: PHP documentation: Memcache::addServer - failure_callback Allows the user to specify a callback function to run upon encountering an error. The callback is run before failover is attempted. The function takes two parameters, the hostname and port of the failed server .

    Read the article

< Previous Page | 268 269 270 271 272 273 274 275 276 277 278 279  | Next Page >