Search Results

Search found 8942 results on 358 pages for 'print r'.

Page 273/358 | < Previous Page | 269 270 271 272 273 274 275 276 277 278 279 280  | Next Page >

• Mail php function does'nt send the email

  - by Mamadou

  Hello everybody, I have the following code wich work on some server and does not work in an other: $Name = "myname"; //senders name $email_sender = "[email protected]"; //senders e-mail adress $recipient = $email; //recipient $mail_body = "The text for the mail..."; //mail body $subject = "Subject for reviever"; //subject $header = "From: ". $Name . " <" . $email_sender . ">\r\n"; $status = mail($recipient, $subject, $mail_body, $header); print('ENVOI '. $status); the $status variable is true but i dont see any email.

  Read the article

• Choosing randomly all the elements in the the list just once

  - by Dalek

  How is it possible to randomly choose a number from a list with n elements, n time without picking the same element of the list twice. I wrote a code to choose the sequence number of the elements in the list but it is slow: >>>redshift=np.array([0.92,0.17,0.51,1.33,....,0.41,0.82]) >>>redshift.shape (1225,) exclude=[] k=0 ng=1225 while (k < ng): flag1=0 sq=random.randint(0, ng) while (flag1<1): if sq in exclude: flag1=1 sq=random.randint(0, ng) else: print sq exclude.append(sq) flag1=0 z=redshift[sq] k+=1 It doesn't choose all the sequence number of elements in the list.

  Read the article

• Bash - replacing targeted files with a specific file, whitespace in directory names

  - by Dispelwolf

  I have a large directory tree of files, and am using the following script to list and replace a searched-for name with a specific file. Problem is, I don't know how to write the createList() for-loop correctly to account for whitespace in a directory name. If all directories don't have spaces, it works fine. The output is a list of files, and then a list of "cp" commands, but reports directories with spaces in them as individual dirs. aindex=1 files=( null ) [ $# -eq 0 ] && { echo "Usage: $0 filename" ; exit 500; } createList(){ f=$(find . -iname "search.file" -print) for i in $f do files[$aindex]=$(echo "${i}") aindex=$( expr $aindex + 1 ) done } writeList() { for (( i=1; i<$aindex; i++ )) do echo "#$i : ${files[$i]}" done for (( i=1; i<$aindex; i++ )) do echo "/usr/bin/cp /cygdrive/c/testscript/TheCorrectFile.file ${files[$filenumber]}" done } createList writeList

  Read the article

• Python Class Variables Question

  - by zyq524

  I have some doubt about python's class variables. As my understanding, if I define a class variable, which is declared outside the init() function, this variable will create only once as a static variable in C++. This seems right for some python types, for instance, dict and list type, but for those base type, e.g. int,float, is not the same. For example: class A: dict1={} list1=list() int1=3 def add_stuff(self, k, v): self.dict1[k]=v self.list1.append(k) self.int1=k def print_stuff(self): print self.dict1,self.list1,self.int1 a1 = A() a1.add_stuff(1, 2) a1.print_stuff() a2=A() a2.print_stuff() The output is: {1: 2} [1] 1 {1: 2} [1] 3 I understand the results of dict1 and list1, but why does int1 behavior different?

  Read the article

• finding the numbers in a given range?

  - by Jamis

  Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

  Read the article

• Double # showing 0 on android

  - by Dave

  I'm embarrassed to ask this question, but after 45 minutes of not finding a solution I will resort to public humiliation. I have a number that is being divided by another number and I'm storing that number in a double variable. The numbers are randomly generated, but debugging the app shows that both numbers are in fact being generated. Lets just say the numbers are 476 & 733. I then take the numbers and divide them to get the percentage 476/733 = .64 I then print out the variable and it's always set to 0. I've tried using DecimalFormat and NumberFormat. No matter what I try though it always says the variable is 0. I know there is something simple that I'm missing, I just can't find it =/.

  Read the article

• Problem while redirecting user after registration

  - by Eternal Learner

  I am creating a simple website . My situation is like this. After registering an user, I want to redirect the user after say 3 seconds to a main page(if the registration succeeds) . The code I have now is as below $query = "INSERT INTO Privileges VALUES('$user','$password1','$role')"; $result = mysql_query($query, $dbcon) or die('Registration Failed: ' . mysql_error()); print 'Thanks for Registering , You will be redirected shortly'; ob_start(); echo "Test"; header("Location: http://www.php.net"); ob_flush() I get the error message Warning: Cannot modify header information - headers already sent by (output started at/home/srinivasa/public_html/ThanksForRegistering.php:27) in /home/srinivasa /public_html/ThanksForRegistering.php on line 35. What do I need to do now ?

  Read the article

• AppEngine: Can I write a Dynamic property (db.Expando) with a name chosen at runtime?

  - by MarcoB

  If I have an entity derived from db.Expando I can write Dynamic property by just assigning a value to a new property, e.g. "y" in this example: class MyEntity(db.Expando): x = db.IntegerProperty() my_entity = MyEntity(x=1) my_entity.y = 2 But suppose I have the name of the dynamic property in a variable... how can I (1) read and write to it, and (2) check if the Dynamic variable exists in the entity's instance? e.g. class MyEntity(db.Expando): x = db.IntegerProperty() my_entity = MyEntity(x=1) # choose a var name: var_name = "z" # assign a value to the Dynamic variable whose name is in var_name: my_entity.property_by_name[var_name] = 2 # also, check if such a property esists if my_entity.property_exists(var_name): # read the value of the Dynamic property whose name is in var_name print my_entity.property_by_name[var_name] Thanks...

  Read the article

• PHP callback function not being called

  - by Industrial

  Hi everyone, I've got the following code: function _callback_memcache_failure($host, $port) { print "memcache '$host:$port' failed"; } $this->memcache = new Memcache; $this->memcache->addServer('192.168.1.35', '11211', 0, 50, 10, TRUE, _callback_memcache_failure('192.168.1.35','11211')); The server is online and running (verified!), but the Failure callback function is being called at each connection. Why is that? Reference: PHP documentation: Memcache::addServer - failure_callback Allows the user to specify a callback function to run upon encountering an error. The callback is run before failover is attempted. The function takes two parameters, the hostname and port of the failed server .

  Read the article

• Array of an array (Database)

  - by Anne Mah Li'en

  I am trying to print out an array of an array from database Below are my codes. I am able to retrieve all the values from the first array. But error occurs when I am trying to retrieve the 2nd array from database. <% ArrayList<Questionnaire> allCategories =QuestionnaireController.getQuestionnaireByCategoryAll(); for(int i=0;i<allCategories.size();i++){ Questionnaire allCategoriesQuestionnaire=allCategories.get(i); out.println("<div class=\"silverheader\">" + "<a href= \"\">" + allCategoriesQuestionnaire.getCategory() + "</a>" + "</div>" + "<div class=\"submenu\">" + "ArrayList<Questionnaire> CategoriesSustainability =QuestionnaireController.getQuestionnaireByCategorySustainability();" + out.println(CategoriesSustainability.get(0).getCategory()); + "<br />" + "</div>"); } %>

  Read the article

• program to determine number of duplicates in a sentence

  - by bhavna raghuvanshi

  public class duplicate { public static void main(String[] args)throws IOException { System.out.println("Enter words separated by spaces ('.' to quit):"); Set<String> s = new HashSet<String>(); Scanner input = new Scanner(System.in); while (true) { String token = input.next(); if (".".equals(token)) break; if (!s.add(token)) System.out.println("Duplicate detected: " + token); } System.out.println(s.size() + " distinct words:\n" + s); } } my program detects and prints duplicate words but i need to print the number of duplicate words also. pls help me do it.

  Read the article

• strip version from package name using Bash

  - by cd1

  hi, I'm trying to strip the version out of a package name using only Bash. I have one solution but I don't think that's the best one available, so I'd like to know if there's a better way to do it. by better I mean cleaner, easier to understand. suppose I have the string "my-program-1.0" and I want only "my-program". my current solution is: #!/bin/bash PROGRAM_FULL="my-program-1.0" INDEX_OF_LAST_CHARACTER=`awk '{print match($0, "[A-Za-z0-9]-[0-9]")} <<< $PROGRAM_FULL` PROGRAM_NAME=`cut -c -$INDEX_OF_LAST_CHARACTER <<< $PROGRAM_FULL` actually, the "package name" syntax is an RPM file name, if it matters. thanks!

  Read the article

• Several modules in a package importing one common module

  - by morpheous

  I am writing a python package. I am using the concept of plugins - where each plugin is a specialization of a Worker class. Each plugin is written as a module (script?) and spawned in a separate process. Because of the base commonality between the plugins (e.g. all extend a base class 'Worker'), The plugin module generally looks like this: import commonfuncs def do_work(data): # do customised work for the plugin print 'child1 does work with %s' % data In C/C++, we have include guards, which prevent a header from being included more than once. Do I need something like that in Python, and if yes, how may I make sure that commonfuncs is not 'included' more than once?

  Read the article

• python dict.fromkeys() returns empty

  - by slooow

  I wrote the following function. It returns an empty dictionary when it should not. The code works on the command line without function. However I cannot see what is wrong with the function, so I have to appeal to your collective intelligence. def enter_users_into_dict(userlist): newusr = {} newusr.fromkeys(userlist, 0) return newusr ul = ['john', 'mabel'] nd = enter_users_into_dict(ul) print nd It returns an empty dict {} where I would expect {'john': 0, 'mabel': 0}. It is probably very simply but I don't see the solution.

  Read the article

• Why do I have to give an identifier?

  - by Knowing me knowing you

  In code: try { System.out.print(fromClient.readLine()); } catch(IOException )//LINE 1 { System.err.println("Error while trying to read from Client"); } In code line marked as LINE 1 compiler forces me to give an identifier even though I'm not using it. Why this unnatural constrain? And then if I type an identifier I'm getting warning that identifier isn't used. It just doesn't make sense to me, forcing a programmer to do something unnecesarry and surplus. And after me someone will revise this code and will be wondering if I didn't use this variable on purpouse or I just forgot. So in order to avoid that I have to write additional comment explaining why I do not use variable which is unnecessary in my code. Thanks

  Read the article

• Can't subtract in a for loop in C/Objective-C

  - by user1612935

  I'm going through the Big Nerd Ranch book on Objective-C, which takes you through some early C stuff. I've played with C before, and am pretty experienced in PHP. Anyhow, I'm doing the challenges and this one is not working the way I think it should. It's pretty simple - start at 99, loop through and subtract three until you get to zero, and every time you get a number that is divisible by 5 print "Found one." Pretty straightforward. However, subtracting by three in the for loop is not working #include <stdio.h> int main (int argc, const char * argv[]) { int i; for(i = 99; i > 0; i-3){ printf("%d\n", i); if(i % 5 == 0) { printf("Found one!\n"); } } return 0; } It creates and endless loop at 99, and I'm not sure why.

  Read the article

• String Manipulation in Bash

  - by user348000

  Hello- I am a newbie in Bash and I am doing some string manipulation. I have the following file among other files in my directory: jdk-6u20-solaris-i586.sh I am doing the following to get jdk-6u20 in my script: myvar=`ls -la | awk '{print $9}' | egrep "i586" | cut -c1-8` echo $myvar but now I want to convert jdk-6u20 to jdk1.6.0_20. I can't seem to figure out how to do it. It must be as generic as possible. For example if I had jdk-6u25, I should be able to convert it at the same way to jdk1.6.0_25 so on and so forth Any suggestions?

  Read the article

• Using popen() to invoke a shell command?

  - by Anvar

  When running the following code through xcode I get inconsistent behavior. Sometimes it prints the git version correctly, other times it doesn't print anything. The return code from the shell command is always 0 though. Any ideas on why this might be? What am I doing wrong? #define BUFFER_SIZE 256 int main (int argc, const char * argv[]) { FILE *fpipe; char *command="/opt/local/bin/git --version"; char line[BUFFER_SIZE]; if ( !(fpipe = (FILE*)popen(command, "r")) ) { // If fpipe is NULL perror("Problems with pipe"); exit(1); } while ( fgets( line, sizeof(char) * BUFFER_SIZE, fpipe)) { // Inconsistent (happens sometimes) printf("READING LINE"); printf("%s", line); } int status = pclose(fpipe); if (status != 0) { // Never happens printf("Strange error code: %d", status); } return 0; }

  Read the article

• how to get values sent by location.replace(URL)

  - by kawtousse

  hi everyone, In my javascript function I do livke this in order to redirect parameters to servlet: var ids1=document.getElementById("projet").value; document.location.href("http://localhost:8080/Opc_Web_App/ServletAffectation?ids1="+ids1); and in the servlet I do the following to get Value: String idprojet= request.getParameter("projet"); System.out.println("le projet selectionné est :" +idprojet); the problem that i didnt have the result of System.out.print in my screen; so in other terms the servlet didn't get the parameter. I can not see the problemn untill now. Please help. Thank you.

  Read the article

• Code compiles etc. but just hangs on run.

  - by Aidan

  Hey guys, My program is meant to parse through a text file, extract relevant data and then save it in a SQL table. I compile it like so.. gcc -o parse parse.c -I/usr/include/mysql -L/usr/lib/mysql -lmysqlclient_r then I run it like so... ./parse > tweets.rss But it just hangs. it doesn't print any printf's I put in to debug. Whats wrong? here is my code... http://pastebin.com/3R45zyMp I'd appreciate any help!

  Read the article

• Any way to assign terminal output to variable with python?

  - by Gordon Fontenot

  I need to grab the duration of a video file via python as part of a larger script. I know I can use ffmpeg to grab the duration, but I need to be able to save that output as a variable back in python. I thought this would work, but it's giving me a value of 0: cmd = 'ffmpeg -i %s 2>&1 | grep "Duration" | cut -d \' \' -f 4 | sed s/,//' % ("Video.mov") duration = os.system(cmd) print duration Am I doing the output redirect wrong? Or is there simply no way to pipe the terminal output back into python?

  Read the article

• Regex for template tag with attributes

  - by Funkmyer

  Hi, I haven't found my answer after reading through all of these posts, so I'm hoping one of you heavy hitter regex folks can help me out. I'm trying to isolate the tag name and any attributes from the following string format: {TAG:TYPE attr1="foo" attr2="bar" attr3="zing" attr4="zang" attr5="zoom" ...} NOTE: in the above example, TAG will always be the same and TYPE will be one of several preset strings (e.g. share,print,display etc...). TAG and TYPE are uppercased only for the example but will not be case sensitive for real.

  Read the article

• Silverlight Windows Phone 7: Load Images From URL

  - by Lennie De Villiers

  Hi, I got the code below that is trying to load an image from the web into an Image control, when I run it I get an error on the given line that no network access is allowed: private void button1_Click(object sender, RoutedEventArgs e) { WebClient webClientImgDownloader = new WebClient(); webClientImgDownloader.OpenReadCompleted += new OpenReadCompletedEventHandler(webClientImgDownloader_OpenReadCompleted); webClientImgDownloader.OpenReadAsync(new Uri("http://dilbert.com/dyn/str_strip/000000000/00000000/0000000/000000/80000/5000/100/85108/85108.strip.print.gif", UriKind.Absolute)); } void webClientImgDownloader_OpenReadCompleted(object sender, OpenReadCompletedEventArgs e) { BitmapImage bitmap = new BitmapImage(); bitmap.SetSource(e.Result); // ERROR HERE! image1.Source = bitmap; } Silverlight for Windows Phone 7

  Read the article

• What host do I have to bind a listening socket to?

  - by herrturtur

  I used python's socket module and tried to open a listening socket using import socket import sys def getServerSocket(host, port): for r in socket.getaddrinfo(host, port, socket.AF_UNSPEC, socket.SOCK_STREAM, 0, socket.AI_PASSIVE): af, socktype, proto, canonname, sa = r try: s = socket.socket(af, socktype, proto) except socket.error, msg: s = None continue try: s.bind(sa) s.listen(1) except socket.error, msg: s.close() s = None continue break if s is None: print 'could not open socket' sys.exit(1) return s Where host was None and port was 15000. The program would then accept connections, but only from connections on the same machine. What do I have to do to accept connections from the internet?

  Read the article

• If statement in MySQL query with PHP

  - by user1104854

  Is it possible to use an if statement in a MySQL query in a similar what I'm showing? I want to grab some information for upcoming events(not ones with previous dates). ini_set('date.timezone', 'America/New_York'); $timestamp = date('m/d/Y'); $sql = "select eventID,eventTitle,eventDate from events where eventLocationID = $locationID ORDER BY eventDate DESC IF(eventDate > $timestamp) "; I really want to avoid doing post-query if statements that will only print if it's after today's date because I run it through a pagination function, and I'd really prefer to avoid tinkering with that.

  Read the article

< Previous Page | 269 270 271 272 273 274 275 276 277 278 279 280  | Next Page >