Search Results

Search found 8942 results on 358 pages for 'print r'.

Page 273/358 | < Previous Page | 269 270 271 272 273 274 275 276 277 278 279 280  | Next Page >

• Code compiles etc. but just hangs on run.

  - by Aidan

  Hey guys, My program is meant to parse through a text file, extract relevant data and then save it in a SQL table. I compile it like so.. gcc -o parse parse.c -I/usr/include/mysql -L/usr/lib/mysql -lmysqlclient_r then I run it like so... ./parse > tweets.rss But it just hangs. it doesn't print any printf's I put in to debug. Whats wrong? here is my code... http://pastebin.com/3R45zyMp I'd appreciate any help!

  Read the article

• How to Get the Method/Function Call Trace for a Specific Run?

  - by JackWM

  Given a Java or JavaScript program, after its execution, print out a sequence of calls. The calls are in invocation order. E.g. main() { A(); } A() { B(); C(); } Then the call trace should be: main -> A() -> B() -> C() Is there any tool that can profile and output this kind of information? It seems this is common a need for debugging or performance tuning. I noticed that some profilers can do this, but I prefer a simpler/easy-to-use one. Thanks!

  Read the article

• deleting unaccessed files using python

  - by damon

  My django app parses some files uploaded by the user.It is possible that the file uploaded by the user may remain in the server for a long time ,without it being parsed by the app.This can increase in size if a lot of users upload a lot of files. I need to delete those files not recently parsed by the app -say not accessed for last 24 hours.I tried like this import os import time dirname = MEDIA_ROOT+my_folder filenames = os.listdir(dirname) filenames = [os.path.join(dirname,filename) for filename in filenames] for filename in filenames: last_access = os.stat(filename).st_atime #secs since epoch rtime = time.asctime(time.localtime(last_access)) print filename+'----'+rtime This shows the last accessed times for each file..But I am not sure how I can test if the file access time was within the last 24 hours..Can somebody help me out?

  Read the article

• finding the numbers in a given range?

  - by Jamis

  Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

  Read the article

• How can I insert a line at the beginning of a file with Perl's Tie::File?

  - by thebourneid

  I'm trying to insert/add a line 'COMMENT DUMMY' at the beginnig of a file as a first row if /PATTERN/ not found. I know how to do this with OPEN CLOSE function. Probably after reading the file it should look something like this: open F, ">", $fn or die "could not open file: $!"; ; print F "COMMENT DUMMY\n", @array; close F; But I have a need to implement this with the use of the Tie::File function and don't know how. use strict; use warnings; use Tie::File; my $fn = 'test.txt'; tie my @lines, 'Tie::File', $fn or die "could not tie file: $!"; untie @lines;

  Read the article

• strip version from package name using Bash

  - by cd1

  hi, I'm trying to strip the version out of a package name using only Bash. I have one solution but I don't think that's the best one available, so I'd like to know if there's a better way to do it. by better I mean cleaner, easier to understand. suppose I have the string "my-program-1.0" and I want only "my-program". my current solution is: #!/bin/bash PROGRAM_FULL="my-program-1.0" INDEX_OF_LAST_CHARACTER=`awk '{print match($0, "[A-Za-z0-9]-[0-9]")} <<< $PROGRAM_FULL` PROGRAM_NAME=`cut -c -$INDEX_OF_LAST_CHARACTER <<< $PROGRAM_FULL` actually, the "package name" syntax is an RPM file name, if it matters. thanks!

  Read the article

• Problem while redirecting user after registration

  - by Eternal Learner

  I am creating a simple website . My situation is like this. After registering an user, I want to redirect the user after say 3 seconds to a main page(if the registration succeeds) . The code I have now is as below $query = "INSERT INTO Privileges VALUES('$user','$password1','$role')"; $result = mysql_query($query, $dbcon) or die('Registration Failed: ' . mysql_error()); print 'Thanks for Registering , You will be redirected shortly'; ob_start(); echo "Test"; header("Location: http://www.php.net"); ob_flush() I get the error message Warning: Cannot modify header information - headers already sent by (output started at/home/srinivasa/public_html/ThanksForRegistering.php:27) in /home/srinivasa /public_html/ThanksForRegistering.php on line 35. What do I need to do now ?

  Read the article

• Regex for template tag with attributes

  - by Funkmyer

  Hi, I haven't found my answer after reading through all of these posts, so I'm hoping one of you heavy hitter regex folks can help me out. I'm trying to isolate the tag name and any attributes from the following string format: {TAG:TYPE attr1="foo" attr2="bar" attr3="zing" attr4="zang" attr5="zoom" ...} NOTE: in the above example, TAG will always be the same and TYPE will be one of several preset strings (e.g. share,print,display etc...). TAG and TYPE are uppercased only for the example but will not be case sensitive for real.

  Read the article

• Double # showing 0 on android

  - by Dave

  I'm embarrassed to ask this question, but after 45 minutes of not finding a solution I will resort to public humiliation. I have a number that is being divided by another number and I'm storing that number in a double variable. The numbers are randomly generated, but debugging the app shows that both numbers are in fact being generated. Lets just say the numbers are 476 & 733. I then take the numbers and divide them to get the percentage 476/733 = .64 I then print out the variable and it's always set to 0. I've tried using DecimalFormat and NumberFormat. No matter what I try though it always says the variable is 0. I know there is something simple that I'm missing, I just can't find it =/.

  Read the article

• If statement in MySQL query with PHP

  - by user1104854

  Is it possible to use an if statement in a MySQL query in a similar what I'm showing? I want to grab some information for upcoming events(not ones with previous dates). ini_set('date.timezone', 'America/New_York'); $timestamp = date('m/d/Y'); $sql = "select eventID,eventTitle,eventDate from events where eventLocationID = $locationID ORDER BY eventDate DESC IF(eventDate > $timestamp) "; I really want to avoid doing post-query if statements that will only print if it's after today's date because I run it through a pagination function, and I'd really prefer to avoid tinkering with that.

  Read the article

• c++ Mixing printf, cout with wprintf, wcout

  - by Bo Jensen

  I know you should not mix printing with printf,cout and wprintf,wcout, but have a hard time finding a good answer why and if it is possible to get round it. The problem is I use a external library that prints with printf and my own uses wcout. If I do a simple example it works fine, but from my full application it simply does not print the printf statements. If this is really a limitation, then there would be many libraries out there which can not work together with wide printing applications. Any insight on this is more than welcome.

  Read the article

• Generate switch cases in php from an array?

  - by mopsyd

  Is it possible to generate the cases for a switch in php using an array? Something like: $x=array( 0 => 'foo', 1 => 'bar', 2 => 'foobar' ); $y='foobar' switch($y) { foreach($x as $i) { case $x: print 'Variable $y tripped switch: '.$i.'<br>'; break; } } I would like to be able to pull the case values from a database and loop through them with a while() loop.

  Read the article

• Create a basic matrix in C (input by user !)

  - by DM

  Hi there, Im trying to ask the user to enter the number of columns and rows they want in a matrix, and then enter the values in the matrix...Im going to let them insert numbers one row at a time. How can I create such function ? #include<stdio.h> main(){ int mat[10][10],i,j; for(i=0;i<2;i++) for(j=0;j<2;j++){ scanf("%d",&mat[i][j]); } for(i=0;i<2;i++) for(j=0;j<2;j++) printf("%d",mat[i][j]); } This works for inputting the numbers, but it displays them all in one line... The issue here is that I dont know how many columns or rows the user wants, so I cant print out %d %d %d in a matrix form .. Any thoughts ? Thanks :)

  Read the article

• Python Class Variables Question

  - by zyq524

  I have some doubt about python's class variables. As my understanding, if I define a class variable, which is declared outside the init() function, this variable will create only once as a static variable in C++. This seems right for some python types, for instance, dict and list type, but for those base type, e.g. int,float, is not the same. For example: class A: dict1={} list1=list() int1=3 def add_stuff(self, k, v): self.dict1[k]=v self.list1.append(k) self.int1=k def print_stuff(self): print self.dict1,self.list1,self.int1 a1 = A() a1.add_stuff(1, 2) a1.print_stuff() a2=A() a2.print_stuff() The output is: {1: 2} [1] 1 {1: 2} [1] 3 I understand the results of dict1 and list1, but why does int1 behavior different?

  Read the article

• PHP callback function not being called

  - by Industrial

  Hi everyone, I've got the following code: function _callback_memcache_failure($host, $port) { print "memcache '$host:$port' failed"; } $this->memcache = new Memcache; $this->memcache->addServer('192.168.1.35', '11211', 0, 50, 10, TRUE, _callback_memcache_failure('192.168.1.35','11211')); The server is online and running (verified!), but the Failure callback function is being called at each connection. Why is that? Reference: PHP documentation: Memcache::addServer - failure_callback Allows the user to specify a callback function to run upon encountering an error. The callback is run before failover is attempted. The function takes two parameters, the hostname and port of the failed server .

  Read the article

• Several modules in a package importing one common module

  - by morpheous

  I am writing a python package. I am using the concept of plugins - where each plugin is a specialization of a Worker class. Each plugin is written as a module (script?) and spawned in a separate process. Because of the base commonality between the plugins (e.g. all extend a base class 'Worker'), The plugin module generally looks like this: import commonfuncs def do_work(data): # do customised work for the plugin print 'child1 does work with %s' % data In C/C++, we have include guards, which prevent a header from being included more than once. Do I need something like that in Python, and if yes, how may I make sure that commonfuncs is not 'included' more than once?

  Read the article

• Choosing randomly all the elements in the the list just once

  - by Dalek

  How is it possible to randomly choose a number from a list with n elements, n time without picking the same element of the list twice. I wrote a code to choose the sequence number of the elements in the list but it is slow: >>>redshift=np.array([0.92,0.17,0.51,1.33,....,0.41,0.82]) >>>redshift.shape (1225,) exclude=[] k=0 ng=1225 while (k < ng): flag1=0 sq=random.randint(0, ng) while (flag1<1): if sq in exclude: flag1=1 sq=random.randint(0, ng) else: print sq exclude.append(sq) flag1=0 z=redshift[sq] k+=1 It doesn't choose all the sequence number of elements in the list.

  Read the article

• Any way to assign terminal output to variable with python?

  - by Gordon Fontenot

  I need to grab the duration of a video file via python as part of a larger script. I know I can use ffmpeg to grab the duration, but I need to be able to save that output as a variable back in python. I thought this would work, but it's giving me a value of 0: cmd = 'ffmpeg -i %s 2>&1 | grep "Duration" | cut -d \' \' -f 4 | sed s/,//' % ("Video.mov") duration = os.system(cmd) print duration Am I doing the output redirect wrong? Or is there simply no way to pipe the terminal output back into python?

  Read the article

• python dict.fromkeys() returns empty

  - by slooow

  I wrote the following function. It returns an empty dictionary when it should not. The code works on the command line without function. However I cannot see what is wrong with the function, so I have to appeal to your collective intelligence. def enter_users_into_dict(userlist): newusr = {} newusr.fromkeys(userlist, 0) return newusr ul = ['john', 'mabel'] nd = enter_users_into_dict(ul) print nd It returns an empty dict {} where I would expect {'john': 0, 'mabel': 0}. It is probably very simply but I don't see the solution.

  Read the article

• Why is Zend Framework (Zend_Db_table) rejecting this SQL Query?

  - by Michael T. Smith

  I'm working on a simple JOIN of two tables (urls and companies). I am using this query call: print $this->_db->select()->from(array('u' => 'urls'), array('id', 'url', 'company_id')) ->join(array('c' => 'companies'), 'u.company_id = c.id'); which is out putting this query: SELECT `u`.`id`, `u`.`url`, `u`.`company_id`, `c`.* FROM `urls` AS `u` INNER JOIN `companies` AS `c` ON u.company_id = c.id Now, I'd prefer the c.* to not actually appear, but either way it doesn't matter. ZF dies with this error: SQLSTATE[42000]: Syntax error or access violation: 1064 You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near '' at line 1" but I can run that query perfectly fine in my MySQL CLI. Any ideas how to fix up this query?

  Read the article

• Does a CPU assigns a value atomically to memory?

  - by Poni

  Hi! A quick question I've been wondering about for some time; Does the CPU assign values atomically, or, is it bit by bit (say for example a 32bit integer). If it's bit by bit, could another thread accessing this exact location get a "part" of the to-be-assigned value? Think of this: I have two threads and one shared "unsigned int" variable (call it "g_uiVal"). Both threads loop. On is printing "g_uiVal" with printf("%u\n", g_uiVal). The second just increase this number. Will the printing thread ever print something that is totally not or part of "g_uiVal"'s value? In code: unsigned int g_uiVal; void thread_writer() { g_uiVal++; } void thread_reader() { while(1) printf("%u\n", g_uiVal); }

  Read the article

• Why Timer does not work if we do not generate a window?

  - by Roman

  Here is the code: import java.awt.event.ActionEvent; import java.awt.event.ActionListener; import javax.swing.JFrame; import javax.swing.Timer; public class TimerSample { public static void main(String args[]) { new JFrame().setVisible(true); ActionListener actionListener = new ActionListener() { public void actionPerformed(ActionEvent actionEvent) { System.out.println("Hello World Timer"); } }; Timer timer = new Timer(500, actionListener); timer.start(); } } It generates a window and then periodically prints "Hello World Timer" in the terminal (Command Prompt). If I comment this line new JFrame().setVisible(true); the application do not print anything to the command line. Why?

  Read the article

• Having trouble getting GET variables from url.

  - by mchl

  Hey everyone, I'm having trouble with this algorithm to extract the get variables from a url and print them each on a new line like: x=y z=hello etc. but instead it prints a seemingly random section of the url with no newlines to the file. There must be a logic error of some kind but i just can't spot it. for(i_m=0;i_m<len_m;i_m++) { if(var_m[i_m]=='&') { fwrite(var_m+offset_m, 1, amp_m, echo_out); fputc('\n',echo_out); offset_m+=amp_m; amp_m=0; } amp_m++; } any help appreciated.

  Read the article

• Can't subtract in a for loop in C/Objective-C

  - by user1612935

  I'm going through the Big Nerd Ranch book on Objective-C, which takes you through some early C stuff. I've played with C before, and am pretty experienced in PHP. Anyhow, I'm doing the challenges and this one is not working the way I think it should. It's pretty simple - start at 99, loop through and subtract three until you get to zero, and every time you get a number that is divisible by 5 print "Found one." Pretty straightforward. However, subtracting by three in the for loop is not working #include <stdio.h> int main (int argc, const char * argv[]) { int i; for(i = 99; i > 0; i-3){ printf("%d\n", i); if(i % 5 == 0) { printf("Found one!\n"); } } return 0; } It creates and endless loop at 99, and I'm not sure why.

  Read the article

• Perl, FastCGI and writing uploaded files

  - by ibogdanov

  My upload function looks like: sub Upload_File{ my ($file, $mime, $description) = @_; my $file_name = param('filename'); my $data; $file = UnTaint($file); if ($mime =~ /text/) { sysopen(VAULT, "$path/$file", O_RDWR | O_EXCL | O_CREAT | O_TEXT) or die "couldn't create $file for R/W: $!\n"; } else { sysopen(VAULT, "$path/$file", O_RDWR | O_EXCL | O_CREAT | O_BINARY) or die "couldn't create $file for R/W: $!\n"; } my $upfh = \*VAULT; flock $upfh, 2; seek $upfh, 0, 0; select((select($upfh), $| = 1)[0]); while( sysread($file_name, $data, 8192) ) { syswrite($upfh, $data, 8192) or die "couldn't write $upfh: $!\n"; } close $upfh; } When I am using read and print with FastCGI upload script, files uploaded with corruptions (including simple text files), this is because perl uses buffered I/O. But when I use syswrite and sysread i.e. non-buffered I/O, as a result I get good text files, but binary files are corrupted anyway.

  Read the article

< Previous Page | 269 270 271 272 273 274 275 276 277 278 279 280  | Next Page >