Search Results

Search found 9062 results on 363 pages for 'big empin'.

Page 278/363 | < Previous Page | 274 275 276 277 278 279 280 281 282 283 284 285  | Next Page >

• detecting pauses in a spoken word audio file using pymad, pcm, vad, etc

  - by james

  First I am going to broadly state what I'm trying to do and ask for advice. Then I will explain my current approach and ask for answers to my current problems. Problem I have an MP3 file of a person speaking. I'd like to split it up into segments roughly corresponding to a sentence or phrase. (I'd do it manually, but we are talking hours of data.) If you have advice on how to do this programatically or for some existing utilities, I'd love to hear it. (I'm aware of voice activity detection and I've looked into it a bit, but I didn't see any freely available utilities.) Current Approach I thought the simplest thing would be to scan the MP3 at certain intervals and identify places where the average volume was below some threshold. Then I would use some existing utility to cut up the mp3 at those locations. I've been playing around with pymad and I believe that I've successfully extracted the PCM (pulse code modulation) data for each frame of the mp3. Now I am stuck because I can't really seem to wrap my head around how the PCM data translates to relative volume. I'm also aware of other complicating factors like multiple channels, big endian vs little, etc. Advice on how to map a group of pcm samples to relative volume would be key. Thanks!

  Read the article

• Multimedia files written over WAN are getting truncated

  - by Dean

  I use the windows Multimedia API to create .wav files. 1. Open file with mmsioOpen 2. Creates WAVE,frm and data chunks using mmioCreateChunk 3. Write audio data using mmioWrite 4. Ascend out of the chunks using mmioAscend 5. Close file using mmioClose The file is being written into a temporary location, so after it has been closed it gets copied to another location using the CopyFile. This program is written in C++ and works great until the file it is writing resides over a WAN in a different city or country. The end result is a wav file that should be 20-30 seconds long ends up being 4 secodns long. It is always the last bit that is missing, so when you play it back it just stops before then of the recording. I initially thought that maybe I was copying the file too soon so as a test I put in a pause of 30 seconds after closing the file using Sleep(30000), but this made no difference to either it being truncated or by how much. I have modified the program to write to a file in parrallel using CreateFile and WriteFile, and the result is the same, so it is not an issue specifically with the mmio API's. Does anyone have any ideas why this is happening and if there is a work-around to it? I suspect that I may end up having the temporary location on the local drive, but this is quite a big change to the application as well as existing deployments. thanks for everyones time Dean

  Read the article

• Where are tables in Mnesia located?

  - by Sanoj

  I try to compare Mnesia with more traditional databases. As I understand it tables in Mnesia can be located to: ram_copies - tables are stored in RAM only, so no durability as in ACID. disc_copies - tables are located on disc and a copy is located in RAM, so the table can not be bigger than the available memory? disc_only_copies - tables are located to disc only, so no caching in memory and worse performance? And the size of the table are limited to the size of dets or the table has to be fragmented. So if I want the performance of doing reads from RAM and the durability of writes to disc, then the size of the tables are very limited compared to a traditional RDBMS like MySQL or PostgreSQL. I know that Mnesia aren't meant to replace traditional RDBMS:s, but can it be used as a big RDBMS or do I have to look for another database? The server I will use is a VPS with limited amount of memory, around 512MB, but I want good database performance. Are disc_copies and the other types of tables in Mnesia so limited as I have understood?

  Read the article

• Alternative to array_shift function

  - by SoLoGHoST

  Ok, I need keys to be preserved within this array and I just want to shift the 1st element from this array. Actually I know that the first key of this array will always be 1 when I do this: // Sort it by 1st group and 1st layout. ksort($disabled_sections); foreach($disabled_sections as &$grouplayout) ksort($grouplayout); Basically I'd rather not have to ksort it in order to grab this array where the key = 1. And, honestly, I'm not a big fan of array_shift, it just takes to long IMO. Is there another way. Perhaps a way to extract the entire array where $disabled_sections[1] is found without having to do a foreach and sorting it, and array_shift. I just wanna add $disabled[1] to a different array and remove it from this array altogether. While keeping both arrays keys structured the way they are. Technically, it would even be fine to do this: $array = array(); $array = $disabled_sections[1]; But it needs to remove it from $disabled_sections. Can I use something like this approach... $array = array(); $array = $disabled_sections[1]; $disabled_sections -= $disabled_sections[1]; Is something like the above even possible?? Thanks.

  Read the article

• What are the best open-source software non-profits for making financial contributions and/or facilitating useful work?

  - by Jason S

  I'm not a great programmer myself (my main job is more electrical engineering) and have never really helped out with any open source projects, but I've benefited greatly from free and/or open-source software (MySQL, OpenOffice, Firefox, Apache, PHP, Java, etc.) and at some point would like to make some modest financial contributions to help keep this stuff going. I'm wondering, what are the best non-profits to make financial contributions? I'm aware of: Open Source Initiative (founded 10 years ago by several prominent figures including programmer and "The Cathedral and the Bazaar" author Eric S. Raymond) Free Software Foundation Mozilla Foundation Apache Foundation Anyone have a particular favorite? Ideally I'd like to give money to a non-profit that would foster some of the smaller but promising open-source and/or free software projects. The big projects like Firefox and Apache are already well-established. There are a few small individual shareware programs I've already paid for directly. But it's those middle-ground projects that I would really like my contributions to support. (one that comes to mind is a good GUI for Subversion or Mercurial.) It's one thing for a single person to donate a little $$ to a small project. It's another for a foundation or something to give larger grants to projects that give a good bang for the buck. Conservation organizations like The Nature Conservancy, or the Trust for Public Lands, have really honed this approach, but I'm not really sure if there's an equivalent model in software-land.

  Read the article

• Cannot install XML::LibXML module on Windows

  - by Deepak Konidena

  I am trying to use XPath to extract some HTML tags and data and for that I need to use XML::LibXML module. I tried installing it from CPAN shell but it doesn't install. I followed the instructions from CPAN site about the installation, that we need to install libxml2, iconv and zlib wrappers before installing XML::LibXML and it didn't work out. Also, if there is any other simpler module that gets my task done, please let me know. The task at hand: I am searching for a specific <dd> tag on a html page which is really big ( around 5000 - 10000) <dd> and <dt> tags. So, I am writing a script which matches the content within <dd> tag and fetches the content within the corresponding (next) <dt> tag. I wish i could i have been a little more clearer. Any help is greatly appreciated.

  Read the article

• Frame Showing Problem

  - by Nitz

  Hey Guys I have made one project which is showing the inventory of the stock of one store. In that inventory the software should store data of the products with their images. There is one problem... Bcz of the lots of stock, the screen on which is image is loading taking a lot of time. So, i thought i should give the frame in which there will be on label which will show the "Loading Software". But now when i am setting visible = true for that frame, but bcz of that images screen class loading problem my frame is not showing correctly. I have put screen shot, now my code. JFrame f; try{ f = new JFrame("This is a test"); f.setSize(300, 300); Container content = f.getContentPane(); content.setBackground(Color.white); content.setLayout(new FlowLayout()); JLabel jl = new JLabel(); jl.setText("Loading Please Wait...."); content.add(jl); f.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); f.setVisible(true); }catch(Exception e){ e.printStackTrace(); } initComponents(); try { addInverntory = new AddInventoryScreen(); showstock = new showStock(); // this class will take big time. mf = new mainForm(); f.setVisible(false); }catch (Exception ex) { ex.printStackTrace(); } How Can show some message that, other class is loading or "Loading Software" kind of thing in this situation. Just For the know....this class is not screen on which the image will load.

  Read the article

• Persisting complex data between postbacks in ASP.NET MVC

  - by Robert Wagner

  I'm developing an ASP.NET MVC 2 application that connects to some services to do data retrieval and update. The services require that I provide the original entity along with the updated entity when updating data. This is so it can do change tracking and optimistic concurrency. The services cannot be changed. My problem is that I need to somehow store the original entity between postbacks. In WebForms, I would have used ViewState, but from what I have read, that is out for MVC. The original values do not have to be tamper proof as the services treat them as untrusted. The entities would be (max) 1k and it is an intranet app. The options I have come up are: Session - Ruled out - Store the entity in the Session, but I don't like this idea as there are no plans to share session between URL - Ruled out - Data is too big HiddenField - Store the serialized entity in a hidden field, perhaps with encryption/encoding HiddenVersion - The entities have a (SQL) version field on them, which I could put into a hidden field. Then on a save I get "original" entity from the services and compare the versions, doing my own optimistic concurrency. Cookies - Like 3 or 4, but using a cookie instead of a hidden field I'm leaning towards option 4, although 3 would be simpler. Are these valid options or am I going down the wrong track? Is there a better way of doing this?

  Read the article

• Perl XML SAX parser emulating XML::Simple record for record

  - by DVK

  Short Q summary: I am looking a fast XML parser (most likely a wrapper around some standard SAX parser) which will produce per-record data structure 100% identical to those produced by XML::Simple. Details: We have a large code infrastructure which depends on processing records one-by-one and expects the record to be a data structure in a format produced by XML::Simple since it always used XML::Simple since early Jurassic era. An example simple XML is: <root> <rec><f1>v1</f1><f2>v2</f2></rec> <rec><f1>v1b</f1><f2>v2b</f2></rec> <rec><f1>v1c</f1><f2>v2c</f2></rec> </root> And example rough code is: sub process_record { my ($obj, $record_hash) = @_; # do_stuff } my $records = XML::Simple->XMLin(@args)->{root}; foreach my $record (@$records) { $obj->process_record($record) }; As everyone knows XML::Simple is, well, simple. And more importantly, it is very slow and a memory hog - due to being a DOM parser and needing to build/store 100% of data in memory. So, it's not the best tool for parsing an XML file consisting of large amount of small records record-by-record. However, re-writing the entire code (which consist of large amount of "process_record"-like methods) to work with standard SAX parser seems like an big task not worth the resources, even at the cost of living with XML::Simple. What I'm looking for is an existing module which will probably be based on a SAX parser (or anything fast with small memory footprint) which can be used to produce $record hashrefs one by one based on the XML pictured above that can be passed to $obj->process_record($record) and be 100% identical to what XML::Simple's hashrefs would have been.

  Read the article

• Where's the Win32 resource for the mouse cursor for dragging splitters?

  - by Luther Baker

  I am building a custom win32 control/widget and would like to change the cursor to a horizontal "splitter" symbol when hovering over a particular vertical line in the control. IE: I want to drag this vertical line (splitter bar) left and right (WEST and EAST). Of the the system cursors (OCR_*), the only cursor that makes sense is the OCR_SIZEWE. Unfortunately, that is the big, awkward cursor the system uses when resizing a window. Instead, I am looking for the cursor that is about 20 pixels tall and around 3 or 4 pixel wide with two small arrows pointing left and right. I can easily draw this and include it as a resource in my application but the cursor itself is so prevalent that I wanted to be sure it wasn't missing something. For example: when you use the COM drag and drop mechanism (CLSID_DragDropHelper, IDropTarget, etc) you implicitly have access to the "drag" icon (little box under the pointer). I didn't see an explicit OCR_* constant for this guy ... so likewise, if I can't find this splitter cursor outright, I am wondering if it is part of a COM object or something else in the win32 lib.

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• Creative ways to punish (or just curb) laziness in coworkers

  - by FerretallicA

  Like the subject suggests, what are some creative ways to curb laziness in co-workers? By laziness I'm talking about things like using variable names like "inttheemplrcd" instead of "intEmployerCode" or not keeping their projects synced with SVN, not just people who use the last of the sugar in the coffee room and don't refill the jar. So far the two most effective things I've done both involve the core library my company uses. Since most of our programs are in VB.net the lack of case sensitivity is abused a lot. I've got certain features of the library using Reflection to access data in the client apps, which has a negligible performance hit and introduces case sensitivity in a lot places where it is used. In instances where we have an agreed standard which is compromised by blatant laziness I take it a step further, like the DatabaseController class which will blatantly reject any DataTable passed to it which isn't named dtSomething (ie- must begin with dt and third letter must be capitalised). It's frustrating to have to resort to things like this but it has also gradually helped drill more attention to detail into their heads. Another is adding some code to the library's initialisation function to display a big and potentially embarrassing (only if seen by a client) message advising that the program is running in debug mode. We have had many instances where projects are sent to clients built in debug mode which has a lot of implications for us (especially with regard to error recovery) and doing that has made sure they always build to release before distributing. Any other creative (ie- not StyleCop etc) approaches like this?

  Read the article

• django shopping cart as a beginner

  - by Jacques Knie

  Hi, i'm quite new to django and trying to add a shopping cart to a simple webshop. What I need is a simple cart that can be filled and presents its content, which is then sent to the vendor via email. So Satchmo might be too big for this task. Therefore i chose django-cart (http://code.google.com/p/django-cart/) which causes some problems now. 1. Is django-cart the right thing? Or are there any better approaches to this task? 2. As I am a beginner even django-cart makes me struggle. I used the view and the template of the django-cart-website, but writing a form that can be used to add products to the cart took me hours. I probably need help in understanding the general layout of a shopping cart and its integration into a website. 3. Two more specific questions: Is it possible to dynamically populate a formfield in a template (e.g. with {{ object.id }})? Is django-cart able to change (update) the contents of a cart? I hope it's not too many questions at once. Thanks in advance Jacques

  Read the article

• java.net.SocketException: Software caused connection abort: recv failed; Causes and cures?

  - by IVR Avenger

  Hi, all. I've got an application running on Apache Tomcat 5.5 on a Win2k3 VM. The application serves up XML to be consumed by some telephony appliances as part of our IVR infrastructure. The application, in turn, receives its information from a handful of SOAP services. This morning, the SOAP services were timing out intermittently, causing all sorts of Exceptions. Once these stopped, I noticed that our application was still performing very slowly, in that it took it a long time to render and deliver pages. This sluggishness was noticed both on the appliances that consume the Tomcat output, and from a simple test of requesting some static documents from my web browser. Restarting Tomcat immediately resolved the issue. Cracking open the localhost log, I see a ton of these errors, right up until I restarted Tomcat: WARNING: Exception thrown whilst processing POSTed parameters java.net.SocketException: Software caused connection abort: recv failed After a big of Googling, my working theory is that the SOAP issue caused my users to get errors, which caused them to make more requests, which put an increased load on the application. This caused it to run out of available sockets to handle incoming requests. So, here's my quandary: 1. Is this a valid hypothesis, or am I just in over my head with HTTP and Tomcat? 2. If this is a valid hypothesis, is there a way to increase the size of the "socket queue", so that this doesn't happen in the future? Thanks! IVR Avenger

  Read the article

• PHP/SQL/Wordpress: Group a user list by alphabet

  - by rayne

  I want to create a (fairly big) Wordpress user index with the users categorized alphabetically, like this: A Amy Adam B Bernard Bianca and so on. I've created a custom Wordpress query which works fine for this, except for one problem: It also displays "empty" letters, letters where there aren't any users whose name begins with that letter. I'd be glad if you could help me fix this code so that it only displays the letter if there's actually a user with a name of that letter :) I've tried my luck by checking how many results there are for that letter, but somehow that's not working. (FYI, I use the user photo plugin and only want to show users in the list who have an approved picture, hence the stuff in the SQL query). <?php $alphabet = range('A', 'Z'); foreach ($alphabet as $letter) { $user_count = $wpdb->get_results("SELECT COUNT(*) FROM wp_users WHERE display_name LIKE '".$letter."%' ORDER BY display_name ASC"); if ($user_count > 0) { $user_row = $wpdb->get_results("SELECT wp_users.user_login, wp_users.display_name FROM wp_users, wp_usermeta WHERE wp_users.display_name LIKE '".$letter."%' AND wp_usermeta.meta_key = 'userphoto_approvalstatus' AND wp_usermeta.meta_value = '2' AND wp_usermeta.user_id = wp_users.ID ORDER BY wp_users.display_name ASC"); echo '<li class="letter">'.$letter.''; echo '<ul>'; foreach ($user_row as $user) { echo '<li><a href="/author/'.$user->user_login.'">'.$user->display_name.'</a></li>'; } echo '</ul></li>'; } } ?> Thanks in advance!

  Read the article

• What are the limitations of the .NET Assembly format?

  - by McKAMEY

  We just ran into an interesting issue that I've not experienced before. We have a large scale production ASP.NET 3.5 SP1 Web App Project in Visual Studio 2008 SP1 which gets compiled and deployed using a Website Deployment Project. Everything has worked fine for the last year, until after a check-in yesterday the app started critically failing with BadImageFormatException. The check-in in question doesn't change anything particularly special and the errors are coming from areas of the app not even changed. Using Reflector we inspected the offending methods to find that there were garbage strings in the code (which Reflector humorously interpreted as Chinese characters). We have consistently reproduced this on several machines so it does not appear to be hardware related. Further inspection showed that those garbage strings did not exist in the Assemblies used as inputs to aspnet_merge.exe during deployment. Web Deployment Project Output Assemblies Properties: Merge all outputs to a single assembly Merge each individual folder output to its own assembly Merge all pages and control outputs to a single assembly Create a separate assembly for each page and control output In the web deployment project properties if we set the merge options to the first option ("Merge all outputs to a single assembly") we experience the issue, yet all of the other options work perfectly! So my question: does anyone know why this is happening? Is there a size-limit to aspnet_merge.exe's capabilities (the resulting merged DLL is around 19.3 MB)? Are there any other known issues with merging the output of WAPs? I would love it if any Assembly format / aspnet_merge gurus know about any such limitations like this. Seems to me like a 25MB Assembly, while big, isn't outrageous. Less disk to hit if it is all pregen'd stuff.

  Read the article

• Read a buffer of unknown size (Console input)

  - by Sanarothe

  Hi. I'm a little behind in my X86 Asm class, and the book is making me want to shoot myself in the face. The examples in the book are insufficient and, honestly, very frustrating because of their massive dependencies upon the author's link library, which I hate. I wanted to learn ASM, not how to call his freaking library, which calls more of his library. Anyway, I'm stuck on a lab that requires console input and output. So far, I've got this for my input: input PROC INVOKE ReadConsole, inputHandle, ADDR buffer, Buf - 2, ADDR bytesRead, 0 mov eax,OFFSET buffer Ret input EndP I need to use the input and output procedures multiple times, so I'm trying to make it abstract. I'm just not sure how to use the data that is set to eax here. My initial idea was to take that string array and manually crawl through it by adding 8 to the offset for each possible digit (Input is integer, and there's a little bit of processing) but this doesn't work out because I don't know how big the input actually is. So, how would you swap the string array into an integer that could be used? Full code: (Haven't done the integer logic or the instruction string output because I'm stuck here.) include c:/irvine/irvine32.inc .data inputHandle HANDLE ? outputHandle HANDLE ? buffer BYTE BufSize DUP(?),0,0 bytesRead DWORD ? str1 BYTE "Enter an integer:",0Dh, 0Ah str2 BYTE "Enter another integer:",0Dh, 0Ah str3 BYTE "The higher of the two integers is: " int1 WORD ? int2 WORD ? int3 WORD ? Buf = 80 .code main PROC call handle push str1 call output call input push str2 call output call input push str3 call output call input main EndP larger PROC Ret larger EndP output PROC INVOKE WriteConsole Ret output EndP handle PROC USES eax INVOKE GetStdHandle, STD_INPUT_HANDLE mov inputHandle,eax INVOKE GetStdHandle, STD_INPUT_HANDLE mov outputHandle,eax Ret handle EndP input PROC INVOKE ReadConsole, inputHandle, ADDR buffer, Buf - 2, ADDR bytesRead, 0 mov eax,OFFSET buffer Ret input EndP END main

  Read the article

• SIMPLE PHP MVC Framework!

  - by Allen

  I need a simple and basic MVC example to get me started. I dont want to use any of the available packaged frameworks. I am in need of a simple example of a simple PHP MVC framework that would allow, at most, the basic creation of a simple multi-page site. I am asking for a simple example because I learn best from simple real world examples. Big popular frameworks (such as code ignighter) are to much for me to even try to understand and any other "simple" example I have found are not well explained or seem a little sketchy in general. I should add that most examples of simple MVC frameworks I see use mod_rewrite (for URL routing) or some other Apache-only method. I run PHP on IIS. I need to be able to understand a basic MVC framework, so that I could develop my own that would allow me to easily extend functionality with classes. I am at the point where I understand basic design patterns and MVC pretty well. I understand them in theory, but when it comes down to actually building a real world, simple, well designed MVC framework in PHP, i'm stuck. I would really appreciate some help! Edit: I just want to note that I am looking for a simple example that an experienced programmer could whip up in under an hour. I mean simple as in bare bones simple. I dont want to use any huge frameworks, I am trying to roll my own. I need a decent SIMPLE example to get me going.

  Read the article

• structured vs. unstructured data in db

  - by Igor

  the question is one of design. i'm gathering a big chunk of performance data with lots of key-value pairs. pretty much everything in /proc/cpuinfo, /proc/meminfo/, /proc/loadavg, plus a bunch of other stuff, from several hundred hosts. right now, i just need to display the latest chunk of data in my UI. i will probably end up doing some analysis of the data gathered to figure out performance problems down the road, but this is a new application so i'm not sure what exactly i'm looking for performance-wise just yet. i could structure the data in the db -- have a column for each key i'm gathering. the table would end up being O(100) columns wide, it would be a pain to put into the db, i would have to add new columns if i start gathering a new stat. but it would be easy to sort/analyze the data just using SQL. or i could just dump my unstructured data blob into the table. maybe three columns -- host id, timestamp, and a serialized version of my array, probably using JSON in a TEXT field. which should I do? am i going to be sorry if i go with the unstructured approach? when doing analysis, should i just convert the fields i'm interested in and create a new, more structured table? what are the trade-offs i'm missing here?

  Read the article

• CQRS - The query side

  - by mattcodes

  A lot of the blogsphere articles related to CQRS (command query repsonsibility) seperation seem to imply that all screens/viewmodels are flat. e.g. Name, Age, Location Of Birth etc.. and thus the suggestion that implementation wise we stick them into fast read source etc.. single table per view mySQL etc.. and pull them out with something like primitive SqlDataReader, kick that nasty nhibernate ORM etc.. However, whilst I agree that domain models dont mapped well to most screens, many of the screens that I work with are more dimensional, and Im sure this is pretty common in LOB apps. So my question is how are people handling screen where by for example it displays a summary of customer details and then a list of their orders with a [more detail] link etc.... I thought about keeping with the straight forward SQL query to the Query Database breaking off the outer join so can build a suitable ViewModel to View but it seems like overkill? Alternatively (this is starting to feel yuck) in CustomerSummaryView table have a text/big (whatever the type is in your DB) column called Orders, and the columns for the Order summary screen grid are seperated by , and rows by |. Even with XML datatype it still feeel dirty. Any thoughts on an optimal practice?

  Read the article

• rails best practices where to place unobtrusive javascript

  - by nathanvda

  Hi there, my rails applications (all 2.3.5) use a total mix of inline javascript, rjs, prototype and jquery. Let's call it learning or growing pains. Lately i have been more and more infatuated with unobtrusive javascript. It makes your html clean, in the same way css cleaned it up. But most examples i have seen are small examples, and they put all javascript(jquery) inside application.js Now i have a pretty big application, and i am thinking up ways to structure my js. I like somehow that my script is still close to the view, so i am thinking something like orders.html.erb orders.js where orders.js contains the unobtrusive javascript specific to that view. But maybe that's just me being too conservative :) I have read some posts by Yehuda Katz about this very problem here and here, where he tackles this problem. It will go through your js-files and only load those relevant to your view. But alas i can't find a current implementation. So my questions: how do you best structure your unobtrusive javascript; manage your code, how do you make sure that it is obvious from the html what something is supposed to do. I guess good class names go a long way :) how do you arrange your files, load them all in? just a few? do you use content_for :script or javascript_include_tag in your view to load the relevant scripts. Or ... ? do you write very generic functions (like a delete), with parameters (add extra attributes?), or do you write very specific functions (DRY?). I know in Rails 3 there is a standard set, and everything is unobtrusive there. But how to start in Rails 2.3.5? In short: what are the best practices for doing unobtrusive javascript in rails? :)

  Read the article

• LPX-00607 for ora:contains in java but not sqlplus

  - by Windle

  Hey all, I am trying to doing some sql querys out of Oracle 11g and am having issues using ora:contains. I am using spring's jdbc impl and my code generates the sql statement: select * from view_name where column_a = ? and column_b = ? and existsNode(xmltype(clob_column), 'record/name [ora:contains(text(), "name1") 0]', 'xmlns:ora="http://xmlns.oralce.com/xdb"') = 1 I have removed the actual view / column names obviously, but when I copy that into sqlplus and substitute in random values, the select executes properly. When I try to run it in my DAO code I get this stack trace: org.springframework.jdbc.UncatergorizedSQLException: PreparedStatementCallback; uncatergorizedSQLException for SQL [the big select above]; SQL state [99999]; error code [31011]; ORA-31011: XML parsing failed. ORA-19202: Error occured in XML processing LPX-00607: Invalid reference: 'contains' ;nested exception is java.sql.SQLException: ORA-31011: XML parsing failed ORA-19202: Error occured in XML processing LPX-00607: Invalid reference: 'contains' (continues on like this for awhile....) I think it is worth mentioning that I am using maven and it is possible I am missing some dependency that is required for this. Sorry the post is so long, but I wanted to err on the side of too much info. Thanks for taking the time to read this at least =) -Windle

  Read the article

• Android Scaled Drawing to ImageView

  - by user329999

  Newbie question, so there's probably a simple answer to this problem. I'm drawing some simple shapes using canvas.drawCircle(), canvas.drawLine() etc. I originally copied the code from: http://developer.android.com/resources/samples/ApiDemos/src/com/example/android/apis/graphics/DrawPoints.html Which extends a View and draws directly to a canvas. It doesn't load a pre-drawn bitmap because I need my application to turn data into a drawing and the user will enter the data. My changes work, but the drawing is too small (or big) and doesn't fill the screen using all the available screen. Ideally I'd rather use something like an ImageView in .XML like so: If that's possible. The documentation seems to imply that I want to set the scaleType as shown in the above .XML which seems like the simple way to do this. If using an ImageView in .XML is a good idea, then I'm lost on how to draw to the ImageView and could use some guidance on doing that task. If that won't work, then I'll need to do some more thinking about how to get my drawing scaled on the screen and basically I'm lazy and would rather have Android do the work for me. Feel free to suggest some other way that's completely different is this is the wrong solution path. :) Thanks.

  Read the article

• Force creation of query execution plan

  - by Marc

  I have the following situation: .net 3.5 WinForm client app accessing SQL Server 2008 Some queries returning relatively big amount of data are used quite often by a form Users are using local SQL Express and restarting their machines at least daily Other users are working remotely over slow network connections The problem is that after a restart, the first time users open this form the queries are extremely slow and take more or less 15s on a fast machine to execute. Afterwards the same queries take only 3s. Of course this comes from the fact that no data is cached and must be loaded from disk first. My question: Would it be possible to force the loading of the required data in advance into SQL Server cache? Note My first idea was to execute the queries in a background worker when the application starts, so that when the user starts the form the queries will already be cached and execute fast directly. I however don't want to load the result of the queries over to the client as some users are working remotely or have otherwise slow networks. So I thought just executing the queries from a stored procedure and putting the results into temporary tables so that nothing would be returned. Turned out that some of the result sets are using dynamic columns so I couldn't create the corresponding temp tables and thus this isn't a solution. Do you happen to have any other idea?

  Read the article

• Find TableLeyout in a thread (Because of the ProgressDialog)

  - by Shaulian

  Hi all, On my activity, im getting some big data from web, and while getting this data i want to show the user a ProgressDialog with spinning wheel. That i can do only with putting this code into a thread, right ? the problem is that after im getting this data i need to insert it into my tableLayout as TableRows and it seems impossible to access the TableLayout from the thread. What can i do to show this progress dialog and to be able access the table layout from the thread ?? Is there any event that happens on the end of the thread ? My code fails for : _tableLayout.addView(_tableRowVar, new TableLayout.LayoutParams( LayoutParams.FILL_PARENT, LayoutParams.FILL_PARENT)); My full code is : final ProgressDialog dialog = ProgressDialog.show(MyActivity.this, "", "Getting data.\nPlease wait...",true); new Thread() { public void run() { try { TableLayout _tableLayout; _tableLayout = (TableLayout)MyActivity.this.findViewById(R.id.tableLayoutID); List<String> data = getDataFromWeb(); // Get the data and bind it into the table publishTableLayoutWithTableRows(_tableLayout, data ); } catch (Exception e) { new AlertDialog.Builder(MyActivity.this) .setMessage(e.getMessage()) .show(); } dialog.dismiss(); } }.start();

  Read the article

< Previous Page | 274 275 276 277 278 279 280 281 282 283 284 285  | Next Page >