Search Results

Search found 7914 results on 317 pages for 'valid xhtml'.

Page 295/317 | < Previous Page | 291 292 293 294 295 296 297 298 299 300 301 302  | Next Page >

  • How to deal with class composition when components cannot be accessed from the outside?

    - by Chathuranga
    For example if I say I have three classes A, B, and C where B and C have a composition relation ship with A. That means the life of B and C is handled by A, and also B and C cannot access directly from the outside. For some reason my DataService class needs to return objects of B and C as It cant return a object of A as B and C cannot be initialized at the same time. (to be able to initializeC you have to initializeB first). So that I'm returning DataTables from DataService and then inside the class A those data tables are converted to B / C objects. If B and C objects cannot be initialized at the same time is it valid to say that B and C have a composition relationship with A? If its composition is it must to generate A with B and C inside? What is the proper way to handle this sort of a problem? EDIT: Following code explains the way I'm doing it now with DataTables. Example: class A { private List<B> B; private List <C> C; public A() { B= new List<B>(); C= new List<C>(); } public List<B> GetB( DataTable dt) { // Create a B list from dt return B; } } class Presenter { private void Show B() { _View.DataGrid = A.GetB(DataService.GetAListOfB()); } } The actual scenario is I have a class called WageInfo and classes Earning and Deduction having a composition relationship in the design. But for you to generate Deductions first you should Generate earnings and should be saved in a table. Then only you can generate deductions for the earnings to calculate balance wages. Also note that these contained classes have a one to many relationship with the containing class WageInfo. So actually WageInfo has a List<Earnings> and List<Deduction> My initial question was, is it ok if my DataService class returns Deductions / Earnings objects (actually lists) not a WageInfo? Still not clear?

    Read the article

  • Exception showing a erroneous web page in a WPF frame

    - by H4mm3rHead
    I have a small application where i need to navigate to an url, I use this method to get the Frame: public override System.Windows.UIElement GetPage(System.Windows.UIElement container) { XmlDocument doc = new XmlDocument(); doc.Load(Location); string webSiteUrl = doc.SelectSingleNode("website").InnerText; Frame newFrame = new Frame(); if (!webSiteUrl.StartsWith("http://")) { webSiteUrl = "http://" + webSiteUrl; } newFrame.Source = new Uri(webSiteUrl); return newFrame; } My problem is now that the page im trying to show generates a error (or so i think), when i load the page in a browser it never fully loads, keeps saying "loading1 element" in the load bar and the green progress line (IE 8) keeps showing. When i attach my debugger i get this error: System.ArgumentException was unhandled Message="Parameter and value pair is not valid. Expected form is parameter=value." Source="WindowsBase" StackTrace: at MS.Internal.ContentType.ParseParameterAndValue(String parameterAndValue) at MS.Internal.ContentType..ctor(String contentType) at MS.Internal.WpfWebRequestHelper.GetContentType(WebResponse response) at System.Windows.Navigation.NavigationService.GetObjectFromResponse(WebRequest request, WebResponse response, Uri destinationUri, Object navState) at System.Windows.Navigation.NavigationService.HandleWebResponse(IAsyncResult ar) at System.Windows.Navigation.NavigationService.<>c__DisplayClassc.<HandleWebResponseOnRightDispatcher>b__8(Object unused) at System.Windows.Threading.ExceptionWrapper.InternalRealCall(Delegate callback, Object args, Boolean isSingleParameter) at System.Windows.Threading.ExceptionWrapper.TryCatchWhen(Object source, Delegate callback, Object args, Boolean isSingleParameter, Delegate catchHandler) at System.Windows.Threading.DispatcherOperation.InvokeImpl() at System.Threading.ExecutionContext.runTryCode(Object userData) at System.Runtime.CompilerServices.RuntimeHelpers.ExecuteCodeWithGuaranteedCleanup(TryCode code, CleanupCode backoutCode, Object userData) at System.Threading.ExecutionContext.Run(ExecutionContext executionContext, ContextCallback callback, Object state) at System.Windows.Threading.DispatcherOperation.Invoke() at System.Windows.Threading.Dispatcher.ProcessQueue() at System.Windows.Threading.Dispatcher.WndProcHook(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam, Boolean& handled) at MS.Win32.HwndWrapper.WndProc(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam, Boolean& handled) at MS.Win32.HwndSubclass.DispatcherCallbackOperation(Object o) at System.Windows.Threading.ExceptionWrapper.InternalRealCall(Delegate callback, Object args, Boolean isSingleParameter) at System.Windows.Threading.ExceptionWrapper.TryCatchWhen(Object source, Delegate callback, Object args, Boolean isSingleParameter, Delegate catchHandler) ved System.Windows.Threading.Dispatcher.InvokeImpl(DispatcherPriority priority, TimeSpan timeout, Delegate method, Object args, Boolean isSingleParameter) at MS.Win32.HwndSubclass.SubclassWndProc(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam) at MS.Win32.UnsafeNativeMethods.DispatchMessage(MSG& msg) at System.Windows.Threading.Dispatcher.TranslateAndDispatchMessage(MSG& msg) at System.Windows.Threading.Dispatcher.PushFrameImpl(DispatcherFrame frame) at System.Windows.Application.RunInternal(Window window) at GreenWebPlayerWPF.App.Main() i C:\Development\Hvarregaard\GWDS\GreenWeb\GreenWebPlayerWPF\obj\Debug\App.g.cs:linje 0 at System.AppDomain._nExecuteAssembly(Assembly assembly, String[] args) at Microsoft.VisualStudio.HostingProcess.HostProc.RunUsersAssembly() at System.Threading.ExecutionContext.Run(ExecutionContext executionContext, ContextCallback callback, Object state) at System.Threading.ThreadHelper.ThreadStart() InnerException: Anyone? Or any way to capture it and respond to it, tried a try/catch around my code, but its not caught - seems something deep inside the guts of the CLR is failing.

    Read the article

  • Improving performance on data pasting 2000 rows with validations

    - by Lohit
    I have N rows (which could be nothing less than 1000) on an excel spreadsheet. And in this sheet our project has 150 columns like this: Now, our application needs data to be copied (using normal Ctrl+C) and pasted (using Ctrl+V) from the excel file sheet on our GUI sheet. Copy pasting 1000 records takes around 5-6 seconds which is okay for our requirement, but the problem is when we need to make sure the data entered is valid. So we have to validate data in each row generate appropriate error messages and format the data as per requirement. So we need to at runtime parse and evaluate data in each row. Now all the formatting of data and validations come from the back-end database and we have it in a data-table (dtValidateAndFormatConditions). The conditions would be around 50. So you can see how slow this whole process becomes since N X 150 X 50 operations are required to complete this whole process. Initially it took approximately 2-3 minutes but now i have reduced it to 20 - 30 seconds. However i have increased the speed by making an expression parser of my own - and not by any algorithm, is there any other way i can improve performance, by using Divide and Conquer or some other mechanism. Currently i am not really sure how to go about this. Here is what part of my code looks like: public virtual void ValidateAndFormatOnCopyPaste(DataTable DtCopied, int CurRow) { foreach (DataRow dRow in dtValidateAndFormatConditions.Rows) { string Condition = dRow["Condition"]; string FormatValue = Value = dRow["Value"]; GetValidatedFormattedData(DtCopied,ref Condition, ref FormatValue ,iRowIndex); Condition = Parse(Condition); dRow["Condition"] = Condition; FormatValue = Parse(FormatValue ); dRow["Value"] = FormatValue; } } The above code gets called row-wise like this: public override void ValidateAndFormat(DataTable dtChangedRecords, CellRange cr) { int iRowStart = cr.Row, iRowEnd = cr.Row + cr.RowCount; for (int iRow = iRowStart; iRow < iRowEnd; iRow++) { ValidateAndFormatOnCopyPaste(dtChangedRecords,iRow); } } Please know my question needs a more algorithmic solution than code optimization, however any answers containing code related optimizations will be appreciated as well. (Tagged Linq because although not seen i have been using linq in some parts of my code).

    Read the article

  • Persistent (purely functional) Red-Black trees on disk performance

    - by Waneck
    I'm studying the best data structures to implement a simple open-source object temporal database, and currently I'm very fond of using Persistent Red-Black trees to do it. My main reasons for using persistent data structures is first of all to minimize the use of locks, so the database can be as parallel as possible. Also it will be easier to implement ACID transactions and even being able to abstract the database to work in parallel on a cluster of some kind. The great thing of this approach is that it makes possible implementing temporal databases almost for free. And this is something quite nice to have, specially for web and for data analysis (e.g. trends). All of this is very cool, but I'm a little suspicious about the overall performance of using a persistent data structure on disk. Even though there are some very fast disks available today, and all writes can be done asynchronously, so a response is always immediate, I don't want to build all application under a false premise, only to realize it isn't really a good way to do it. Here's my line of thought: - Since all writes are done asynchronously, and using a persistent data structure will enable not to invalidate the previous - and currently valid - structure, the write time isn't really a bottleneck. - There are some literature on structures like this that are exactly for disk usage. But it seems to me that these techniques will add more read overhead to achieve faster writes. But I think that exactly the opposite is preferable. Also many of these techniques really do end up with a multi-versioned trees, but they aren't strictly immutable, which is something very crucial to justify the persistent overhead. - I know there still will have to be some kind of locking when appending values to the database, and I also know there should be a good garbage collecting logic if not all versions are to be maintained (otherwise the file size will surely rise dramatically). Also a delta compression system could be thought about. - Of all search trees structures, I really think Red-Blacks are the most close to what I need, since they offer the least number of rotations. But there are some possible pitfalls along the way: - Asynchronous writes -could- affect applications that need the data in real time. But I don't think that is the case with web applications, most of the time. Also when real-time data is needed, another solutions could be devised, like a check-in/check-out system of specific data that will need to be worked on a more real-time manner. - Also they could lead to some commit conflicts, though I fail to think of a good example of when it could happen. Also commit conflicts can occur in normal RDBMS, if two threads are working with the same data, right? - The overhead of having an immutable interface like this will grow exponentially and everything is doomed to fail soon, so this all is a bad idea. Any thoughts? Thanks! edit: There seems to be a misunderstanding of what a persistent data structure is: http://en.wikipedia.org/wiki/Persistent_data_structure

    Read the article

  • Problem Fetching JSON Result with jQuery in Firefox and Chrome (IE8 Works)

    - by senfo
    I'm attempting to parse JSON using jQuery and I'm running into issues. Using the code below, the data keeps coming back null: <!DOCTYPE html> <html> <head> <title>JSON Test</title> </head> <body> <div id="msg"></div> <script src="http://code.jquery.com/jquery-latest.js"></script> <script> $.ajax({ url: 'http://datawarehouse.hrsa.gov/ReleaseTest/HGDWDataWebService/HGDWDataService.aspx?service=HC&zip=20002&radius=10&filter=8357&format=JSON', type: 'GET', dataType: 'json', success: function(data) { $('#msg').html(data[0].title); // Always null in Firefox/Chrome. Works in IE8. }, error: function(data) { alert(data); } }); </script> </body> </html> The JSON results look like the following: {"title":"HEALTHPOINT TYEE CAMPUS","link":"http://www.healthpointchc.org","id":"tag:datawarehouse.hrsa.gov,2010-04-29:/8357","org":"HEALTHPOINT TYEE CAMPUS","address":{"street-address":"4424 S. 188TH St.","locality":"Seatac","region":"Washington","postal-code":"98188-5028"},"tel":"206-444-7746","category":"Service Delivery Site","location":"47.4344818181818 -122.277672727273","update":"2010-04-28T00:00:00-05:00"} If I replace my URL with the Flickr API URL (http://api.flickr.com/services/feeds/photos_public.gne?tags=cat&tagmode=any&format=json&jsoncallback=?), I get back a valid JSON result that I am able to make use of. I have successfully validated my JSON at JSONLint, so I've run out of ideas as to what I might be doing wrong. Any thoughts? Update: I had the client switch the content type to application/json. Unfortunately, I'm still experiencing the exact same problem. I also updated my HTML and included the live URL I've been working with. Update 2: I just gave this a try in IE8 and it works fine. For some reason, it doesn't work in either Firefox 3.6.3 or Chrome 4.1.249.1064 (45376). I did notice a mistake with the data being returned (the developer is returning a collection of data, even for queries that will always return a single record), but it still baffles me why it doesn't work in other browsers. It might be important to note that I am working from an HTML file on my local file system. I thought it might be a XSS issue, but that doesn't explain why Flickr works.

    Read the article

  • Design patterns and interview question

    - by user160758
    When I was learning to code, I read up on the design patterns like a good boy. Long after this, I started to actually understand them. Design discussions such as those on this site constantly try to make the rules more and more general, which is good. But there is a line, over which it becomes over-analysis starts to feed off itself and as such I think begins to obfuscate the original point - for example the "What's Alternative to Singleton" post and the links contained therein. http://stackoverflow.com/questions/1300655/whats-alternative-to-singleton I say this having been asked in both interviews I’ve had over the last 2 weeks what a singleton is and what criticisms I have of it. I have used it a few times for items such as user data (simple key-value eg. last file opened by this user) and logging (very common i'm sure). I've never ever used it just to have what is essentially global application data, as this is clearly stupid. In the first interview, I reply that I have no criticisms of it. He seemed disappointed by this but as the job wasn’t really for me, I forgot about it. In the next one, I was asked again and, as I wanted this job, I thought about it on the spot and made some objections, similar to those contained in the post linked to above (I suggested use of a factory or dependency injection instead). He seemed happy with this. But my problem is that I have used the singleton without ever using it in this kind of stupid way, which I had to describe on the spot. Using it for global data and the like isn’t something I did then realised was stupid, or read was stupid so didn’t do, it was just something I knew was stupid from the start. Essentially I’m supposed to be able to think of ways of how to misuse a pattern in the interview? Which class of programmers can best answer this question? The best ones? The medium ones? I'm not sure.... And these were both bright guys. I read more than enough to get better at my job but had never actually bothered to seek out criticisms of the most simple of the design patterns like this one. Do people think such questions are valid and that I ought to know the objections off by heart? Or that it is reasonable to be able to work out what other people who are missing the point would do on the fly? Or do you think I’m at least partially right that the question is too unsubtle and that the questions ought to be better thought out in order to make sure only good candidates can answer. PS. Please don’t think I’m saying that I’m just so clever that I know everything automatically - I’ve learnt the hard way like everyone else. But avoiding global data is hardly revolutionary.

    Read the article

  • IPhone Development Profile Expired

    - by theiphoneguy
    I really combed this site and others. I read and re-read the related links here and the Apple docs. I'm sorry, but either I am obviously missing something right under my nose, or this Apple profile/certificate stuff is a bit convoluted. Here it is: I have a product in the App Store. I have updated it several times and users like it. My development profile recently expired just when I was improving the app for its next release. I can run the app in the simulator. I can compile and put the distribution build on my iPhone just fine. I went to the Apple portal and renewed the development profile. I downloaded it and installed it in Xcode. I see it in the Organize window. I see it on my iPhone. I CANNOT put the debug build on my iPhone to debug or run with Instruments. The message is that either there is not a valid signed profile or it is untrusted. I subsequently tried to download and install the certificate to my Mac's keychain. Still no success. I checked the code signing section of Project settings and also for the target and the root. All appears to indicate that it is using the expected development profile for debug. Yes, I had deleted the old profile from my iPhone, from the Organizer. I cleaned the Xcode cache and all targets. I have done all of this several times and in varying sequences to try to cover every possibility. I am ready to do anything to be able to debug with Instruments in order to check for leaks or high memory usage. Even though the distribution compile runs fine on my iPhone and plays well with other running processes, I will not release anything without a leaks/memory test. Any ideas will be appreciated. If I missed something obvious, please forgive me - it was not due to just posting a question without searching for similar postings. Thanks!

    Read the article

  • Javascript AJAX function not working in IE?

    - by Sam152
    I have this code: function render_message(id) { var xmlHttp; xmlHttp=new XMLHttpRequest(); xmlHttp.onreadystatechange=function() { if(xmlHttp.readyState==4) { document.getElementById('message').innerHTML=xmlHttp.responseText; document.getElementById('message').style.display=''; } } var url="include/javascript/message.php"; url=url+"?q="+id; xmlHttp.open("GET",url,true); xmlHttp.send(null); } For some reason it does not work in IE and an error is being reported on this line "document.getElementById('message').innerHTML=xmlHttp.responseText;" with an "Unknown Runtime Error". Can anyone help? Edit: The code being added to the div is valid code ect. Here is the response: <div style="margin-left:auto;margin-right:auto;width:400px;"> <img src="/forum/img/avatars/2.gif" width="90" height="89" style="float:left;"> <div style="margin-left:100px;"> <span style="font-size:16pt;">Sam152</a></span><br> <span style="font-size:10pt;text-transform:uppercase;font-weight:bold;">From Sam152</span><br> <span style="font-size:10pt;font-weight:bold;">Recieved April 17, 2009, 9:44 am</span><br> <br><br> </div> </div> <div style="margin-left:auto;margin-right:auto;width:400px;"> asd</div> <div style="margin-left:auto;margin-right:auto;width:400px;text-align:right;padding-top:10px;"> <span onClick="requestPage('http://www.gametard.com/include/scripts/delete_message.php?id=14');document.getElementById('message14').style.display='none';document.getElementById('message').style.display='none';" class="button">Delete</span> <span onClick="document.getElementById('message').style.display='none';" class="button">Close</span> <span onClick="document.getElementById('to').value ='Sam152';document.getElementById('to').style.color ='#000';document.getElementById('newmessage').style.display='';" class="button">Reply</span> </div>

    Read the article

  • What is fastest way to convert bool to byte?

    - by Amir Rezaei
    What is fastest way to convert bool to byte? I want this mapping: False=0, True=1 Note: I don't want to use any if statement. Update: I don't want to use conditional statement. I don't want the CPU to halt or guess next statement. I want to optimize this code: private static string ByteArrayToHex(byte[] barray) { char[] c = new char[barray.Length * 2]; byte k; for (int i = 0; i < barray.Length; ++i) { k = ((byte)(barray[i] >> 4)); c[i * 2] = (char)(k > 9 ? k + 0x37 : k + 0x30); k = ((byte)(barray[i] & 0xF)); c[i * 2 + 1] = (char)(k > 9 ? k + 0x37 : k + 0x30); } return new string(c); } Update: The length of the array is very large, it's in terabyte order! Therefore I need to do optimization if possible. I shouldn't need to explain my self. The question is still valid. Update: I'm working on a project and looking at others code. That's why I didn't provide with the function at first place. I didn't want to spend time on explaining for people when they have opinion about the code. I shouldn’y need to provide in my question the background of my work, and a function that is not written by me. I have started to optimize it part by part. If I needed help with the whole function I would asked that in another question. That is why I asked this very simple at the beginning. Unfortunately people couldn’t keep themselves to the question. So please if you want to help answer the question. Update: For dose who want to see the point of this question. This example shows how two if statement are reduced from the code. byte A = k > 9 ; //If it was possible (k>9) == 0 || 1 c[i * 2] = A * (k + 0x30) - (A - 1) * (k + 0x30);

    Read the article

  • dynamic module creation

    - by intuited
    I'd like to dynamically create a module from a dictionary, and I'm wondering if adding an element to sys.modules is really the best way to do this. EG context = { a: 1, b: 2 } import types test_context_module = types.ModuleType('TestContext', 'Module created to provide a context for tests') test_context_module.__dict__.update(context) import sys sys.modules['TestContext'] = test_context_module My immediate goal in this regard is to be able to provide a context for timing test execution: import timeit timeit.Timer('a + b', 'from TestContext import *') It seems that there are other ways to do this, since the Timer constructor takes objects as well as strings. I'm still interested in learning how to do this though, since a) it has other potential applications; and b) I'm not sure exactly how to use objects with the Timer constructor; doing so may prove to be less appropriate than this approach in some circumstances. EDITS/REVELATIONS/PHOOEYS/EUREKAE: I've realized that the example code relating to running timing tests won't actually work, because import * only works at the module level, and the context in which that statement is executed is that of a function in the testit module. In other words, the globals dictionary used when executing that code is that of main, since that's where I was when I wrote the code in the interactive shell. So that rationale for figuring this out is a bit botched, but it's still a valid question. I've discovered that the code run in the first set of examples has the undesirable effect that the namespace in which the newly created module's code executes is that of the module in which it was declared, not its own module. This is like way weird, and could lead to all sorts of unexpected rattlesnakeic sketchiness. So I'm pretty sure that this is not how this sort of thing is meant to be done, if it is in fact something that the Guido doth shine upon. The similar-but-subtly-different case of dynamically loading a module from a file that is not in python's include path is quite easily accomplished using imp.load_source('NewModuleName', 'path/to/module/module_to_load.py'). This does load the module into sys.modules. However this doesn't really answer my question, because really, what if you're running python on an embedded platform with no filesystem? I'm battling a considerable case of information overload at the moment, so I could be mistaken, but there doesn't seem to be anything in the imp module that's capable of this. But the question, essentially, at this point is how to set the global (ie module) context for an object. Maybe I should ask that more specifically? And at a larger scope, how to get Python to do this while shoehorning objects into a given module?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • What to Expect in Rails 4

    - by mikhailov
    Rails 4 is nearly there, we should be ready before it released. Most developers are trying hard to keep their application on the edge. Must see resources: 1) @sikachu talk: What to Expect in Rails 4.0 - YouTube 2) Rails Guides release notes: http://edgeguides.rubyonrails.org/4_0_release_notes.html There is a mix of all major changes down here: ActionMailer changes excerpt: Asynchronously send messages via the Rails Raise an ActionView::MissingTemplate exception when no implicit template could be found ActionPack changes excerpt Added controller-level etag additions that will be part of the action etag computation Add automatic template digests to all CacheHelper#cache calls (originally spiked in the cache_digests plugin) Add Routing Concerns to declare common routes that can be reused inside others resources and routes Added ActionController::Live. Mix it in to your controller and you can stream data to the client live truncate now always returns an escaped HTML-safe string. The option :escape can be used as false to not escape the result Added ActionDispatch::SSL middleware that when included force all the requests to be under HTTPS protocol ActiveModel changes excerpt AM::Validation#validates ability to pass custom exception to :strict option Changed `AM::Serializers::JSON.include_root_in_json' default value to false. Now, AM Serializers and AR objects have the same default behaviour Added ActiveModel::Model, a mixin to make Ruby objects work with AP out of box Trim down Active Model API by removing valid? and errors.full_messages ActiveRecord changes excerpt Use native mysqldump command instead of structure_dump method when dumping the database structure to a sql file. Attribute predicate methods, such as article.title?, will now raise ActiveModel::MissingAttributeError if the attribute being queried for truthiness was not read from the database, instead of just returning false ActiveRecord::SessionStore has been extracted from Active Record as activerecord-session_store gem. Please read the README.md file on the gem for the usage Fix reset_counters when there are multiple belongs_to association with the same foreign key and one of them have a counter cache Raise ArgumentError if list of attributes to change is empty in update_all Add Relation#load. This method explicitly loads the records and then returns self Deprecated most of the 'dynamic finder' methods. All dynamic methods except for find_by_... and find_by_...! are deprecated Added ability to ActiveRecord::Relation#from to accept other ActiveRecord::Relation objects Remove IdentityMap ActiveSupport changes excerpt ERB::Util.html_escape now escapes single quotes ActiveSupport::Callbacks: deprecate monkey patch of object callbacks Replace deprecated memcache-client gem with dalli in ActiveSupport::Cache::MemCacheStore Object#try will now return nil instead of raise a NoMethodError if the receiving object does not implement the method, but you can still get the old behavior by using the new Object#try! Object#try can't call private methods Add ActiveSupport::Deprecations.behavior = :silence to completely ignore Rails runtime deprecations What are the most important changes for you?

    Read the article

  • DB Design Pattern - Many to many classification / categorised tagging.

    - by Robin Day
    I have an existing database design that stores Job Vacancies. The "Vacancy" table has a number of fixed fields across all clients, such as "Title", "Description", "Salary range". There is an EAV design for "Custom" fields that the Clients can setup themselves, such as, "Manager Name", "Working Hours". The field names are stored in a "ClientText" table and the data stored in a "VacancyClientText" table with VacancyId, ClientTextId and Value. Lastly there is a many to many EAV design for custom tagging / categorising the vacancies with things such as Locations/Offices the vacancy is in, a list of skills required. This is stored as a "ClientCategory" table listing the types of tag, "Locations, Skills", a "ClientCategoryItem" table listing the valid values for each Category, e.g., "London,Paris,New York,Rome", "C#,VB,PHP,Python". Finally there is a "VacancyClientCategoryItem" table with VacancyId and ClientCategoryItemId for each of the selected items for the vacancy. There are no limits to the number of custom fields or custom categories that the client can add. I am now designing a new system that is very similar to the existing system, however, I have the ability to restrict the number of custom fields a Client can have and it's being built from scratch so I have no legacy issues to deal with. For the Custom Fields my solution is simple, I have 5 additional columns on the Vacancy Table called CustomField1-5. This removes one of the EAV designs. It is with the tagging / categorising design that I am struggling. If I limit a client to having 5 categories / types of tag. Should I create 5 tables listing the possible values "CustomCategoryItems1-5" and then an additional 5 many to many tables "VacancyCustomCategoryItem1-5" This would result in 10 tables performing the same storage as the three tables in the existing system. Also, should (heaven forbid) the requirements change in that I need 6 custom categories rather than 5 then this will result in a lot of code change. Therefore, can anyone suggest any DB Design Patterns that would be more suitable to storing such data. I'm happy to stick with the EAV approach, however, the existing system has come across all the usual performance issues and complex queries associated with such a design. Any advice / suggestions are much appreciated. The DBMS system used is SQL Server 2005, however, 2008 is an option if required for any particular pattern.

    Read the article

  • Help with IF THEN breaking when comparing results from MYSQL query.

    - by roydukkey
    I'm have a problem with an invite system. The if statement seems to break. It shows the message "Fail" but the UPDATE statement still executes. Why do both the THEN and the ELSE excute? $dbConn = new dbConn(); // Check if POST user_username and user_hash are matching and valid; both are hidden for fields $sql = "SELECT user_username " . "FROM table_users " . "WHERE user_id=".mysql_real_escape_string($_POST["user_id"])." " . "AND user_hash='".mysql_real_escape_string($_POST["user_hash"])."' " . "AND user_enabled=0;"; $objUser = $dbConn->query($sql); // If result contains 1 or more rows if( mysql_num_rows($objUser) != NULL ){ $objUser = mysql_fetch_assoc($objUser); $ssnUser->login( $objUser["user_username"] ); $sql = "UPDATE table_users SET " . "user_enabled=1, " . "user_first_name='".mysql_real_escape_string($_POST["user_first_name"])."', " . "user_last_name='".mysql_real_escape_string($_POST["user_last_name"])."', " . "user_password='".mysql_real_escape_string( md5($_POST["user_password"]) )."' " . "WHERE user_id=".mysql_real_escape_string($_POST["user_id"]).";"; $dbConn->query($sql); echo "Success"; header( "Refresh: 5; url=/account/?action=domains" ); } else { echo "Fail"; } This dbConn Class is as follows: class dbConn{ var $username = "xxxx_admin"; var $password = "xxxxxxxx"; var $server = "localhost"; var $database = "xxxx"; var $objConn; function __construct(){ $conn = mysql_connect( $this->server, $this->username, $this->password, true ); if( !$conn ){ die("Could not connect: ".mysql_error() ); } else { $this->objConn = $conn; } unset($conn); } function __destruct(){ mysql_close( $this->objConn ); unset( $this ); } function query( $query, $db = false ){ mysql_select_db( $db != false ? $db : $this->database, $this->objConn ); $result = mysql_query( $query ); unset($query,$db); return $result; } }

    Read the article

  • disable dates using jquery inside gridview control

    - by bladerunner
    Hi there, I have a gridview which contains a textbox control. I need to show the calendar for the user to pick the date and certain dates are to be disabled using jquery. I found a post on stackoverflow that talked about how to disable certain dates. I am done with that part, except not sure how to pass the textbox control to this jquery function. Here is the code. <script type="text/javascript" language="javascript"> function pageLoad(sender, args) { var enabledDays = ['09/21/2011', '10/05/2011', '10/19/2011', '11/02/2011', '11/16/2011']; /* utility functions */ function editDays(date) { for (var i = 0; i < enabledDays.length; i++) { if (new Date(enabledDays[i]).toString() == date.toString()) { return [true]; } } return [false]; } /* create datepicker */ $(document).ready(function() { $('#<%= txtInHomeDate.ClientID %>').datepicker({ beforeShow: springDate, beforeShowDay: editDays, dateFormat: 'mm/dd/yy', buttonImage: 'images/cal.gif', buttonText: 'Choose date', firstDay: 1, buttonImageOnly: true, showOn: 'both', showAnim: 'fadeIn', onSelect: function() { $(this).trigger("onchange", null); } }); function springDate() { var defaultMin = new Date(); var defaultMax = new Date(); var Min = defaultMin; var Max = defaultMax; // make valid date from hiddenfied value format is MM/dd/yyyy dateMin = $('#<%= hfStDate.ClientID %>').val(); dateMin = new Date(dateMin); dateMax = $('#<%= hfEndDate.ClientID %>').val(); dateMax = new Date(dateMax); if (dateMin && dateMax) { Min = new Date(dateMin.getFullYear(), dateMin.getMonth(), dateMin.getDate()); Max = new Date(dateMax.getFullYear(), dateMax.getMonth(), dateMax.getDate()); } return { minDate: Min, maxDate: Max }; } }); } <.... <asp:TemplateField HeaderText="In-Home Date"> <ItemStyle HorizontalAlign="Center" /> <ItemTemplate> <asp:HiddenField ID="hfStDate" runat="server" Value="09/01/2011" /> <asp:HiddenField ID="hfEndDate" runat="server" Value="11/30/2011" /> <asp:TextBox ID="txtInHomeDate" runat="server" /> </ItemTemplate> </asp:TemplateField> Currently, it errors out since the jquery function won't find the txtInHomeDate. Could I get some help as I am pretty close to get this done? Thanks!!

    Read the article

  • git: setting a single tracking remote from a public repo.

    - by Gauthier
    I am confused with remote branches. My local repo: (local) ---A---B---C-master My remote repo (called int): (int) ---A---B---C---D---E-master What I want to do is to setup the local repo's master branch to follow that of int. Local repo: (local) ---A---B---C---D---E-master-remotes/int/master So that when int changes to: (int) ---A---B---C---D---E---F-master I can run git pull from the local repo's master and get (local) ---A---B---C---D---E---F-master-remotes/int/master Here's what I have tried: git fetch int gets me all the branches of int into remote branches. This can get messy since int might have hundreds of branches. git fetch int master gets me the commits, but no ref to it, only FETCH_HEAD. No remote branch either. git fetch int master:new_master works but I don't want a new name every time I update, and no remote branch is setup. git pull int master does what I want, but there is still no remote branch setup. I feel that it is ok to do so (that's the best I have now), but I read here and there that with the remote setup it is enough with git pull. git branch --track new_master int/master, as per http://www.gitready.com/beginner/2009/03/09/remote-tracking-branches.html . I get "not a valid object name: int/master". git remote -v does show me that int is defined and points at the correct location (1. worked). What I miss is the int/master branch, which is precisely what I want to get. git fetch in master:int/master. Well, int/master is created, but is no remote. So to summarize, I've tried some stuff with no luck. I would expect 2 to give me the remote branch to master in the repo int. The solution I use now is option 3. I read somewhere that you could change some config file by hand, but isn't that a bit cumbersome? The "cumbersome" way of editting the config file did work: [branch "master"] remote = int merge = master It can be done from command line: $ git config branch.master.remote int $ git config branch.master.merge master Any reason why option 2 above wouldn't do that automatically? Even in that case, git pull fetches all branches from the remote.

    Read the article

  • check if directory exists c#

    - by Ant
    I am trying to see if a directory exists based on an input field from the user. When the user types in the path, I want to check if the path actually exists. I have some c# code already. It returns 1 for any local path, but always returns 0 when I am checking a network path. static string checkValidPath(string path) { //Insert your code that runs under the security context of the authenticating user here. using (ImpersonateUser user = new ImpersonateUser(user, "", password)) { //DirectoryInfo d = new DirectoryInfo(quotelessPath); bool doesExist = Directory.Exists(path); //if (d.Exists) if(doesExist) { user.Dispose(); return "1"; } else { user.Dispose(); return "0"; } } } public class ImpersonateUser : IDisposable { [DllImport("advapi32.dll", SetLastError = true)] private static extern bool LogonUser(string lpszUsername, string lpszDomain, string lpszPassword, int dwLogonType, int dwLogonProvider, out IntPtr phToken); [DllImport("kernel32", SetLastError = true)] private static extern bool CloseHandle(IntPtr hObject); private IntPtr userHandle = IntPtr.Zero; private WindowsImpersonationContext impersonationContext; public ImpersonateUser(string user, string domain, string password) { if (!string.IsNullOrEmpty(user)) { // Call LogonUser to get a token for the user bool loggedOn = LogonUser(user, domain, password, 9 /*(int)LogonType.LOGON32_LOGON_NEW_CREDENTIALS*/, 3 /*(int)LogonProvider.LOGON32_PROVIDER_WINNT50*/, out userHandle); if (!loggedOn) throw new Win32Exception(Marshal.GetLastWin32Error()); // Begin impersonating the user impersonationContext = WindowsIdentity.Impersonate(userHandle); } } public void Dispose() { if (userHandle != IntPtr.Zero) CloseHandle(userHandle); if (impersonationContext != null) impersonationContext.Undo(); } } Any help is appreciated. Thanks! EDIT 3: updated code to use BrokenGlass's impersonation functions. However, I need to initialize "password" to something... EDIT 2: I updated the code to try and use impersonation as suggested below. It still fails everytime. I assume I am using impersonation improperly... EDIT: As requested by ChrisF, here is the function that calls the checkValidPath function. Frontend aspx file... $.get('processor.ashx', { a: '7', path: x }, function(o) { alert(o); if (o=="0") { $("#outputPathDivValid").dialog({ title: 'Output Path is not valid! Please enter a path that exists!', width: 500, modal: true, resizable: false, buttons: { 'Close': function() { $(this).dialog('close'); } } }); } }); Backend ashx file... public void ProcessRequest (HttpContext context) { context.Response.Cache.SetExpires(DateTime.Now); string sSid = context.Request["sid"]; switch (context.Request["a"]) {//a bunch of case statements here... case "7": context.Response.Write(checkValidPath(context.Request["path"].ToString())); break;

    Read the article

  • Need some help synch'ing outer loop counter with dialog.onconfirm()

    - by Chris Barnhill
    I am writing a game for Facebook. IN the following code, I have a problem. I have a for loop executing, and in that loop, I call a dialog and implement 'onconfirm' for the dialog. The problem is that I need to access th e loop counter inside of the onconfirm function. But because the onconfirm is called outside of the scope of the for loop, the counter value is no longer valid because it's been incremented. I need some way to pass the counter value to the dialog onconfirm as it was at the time the dialog was displayed, not after the loop has finished. Or maybe someone has a better solution. Any help would be appreciated. Thanks. function unloadCargo() { //debugger; var actionPrompt = document.getElementById('action-prompt'); actionPrompt.setTextValue('Unloading cargo...'); var ajax = new Ajax(); ajax.responseType = Ajax.JSON; ajax.ondone = function(data) { debugger; if(data.unloadableCargo.length == 0) { loadCargo(); } else { //console.log('unloadable cargo='+dump(data.unloadableCargo)); var i = 0; var j = 0; var ucCount = data.unloadableCargo.length; for(i = 0; i < ucCount; i++) { cargoDialog = new Dialog(); cargoDialog.showChoice('Unload Cargo', 'Unload ' + data.unloadableCargo[i].goods_name + ' at ' + data.unloadableCargo[i].city_name + ' for ' + data.unloadableCargo[i].payoff + 'M euros?'); cargoDialog.onconfirm = function() { //console.log('unloadable cargo onconfirm='+dump(data.unloadableCargo)); var ajax = new Ajax(); var param = {"city_id": data.unloadableCargo[i].city_id, "goods_id": data.unloadableCargo[i].goods_id, "payoff": data.unloadableCargo[i].payoff}; ajax.ondone = function(demandData) { var demands = document.getElementById('demands'); var innerXhtml = '<span>'; for(var j = 0; j < demandData.demands.length; j++) { innerXhtml = innerXhtml + ' <div class="demand-item"><div class="demand-city">' + demandData.demands[j].city + '</div><div class="demand-pay">' + demandData.demands[j].cost + '</div><div class="demand-goods">' + demandData.demands[j].goods + '</div></div>'; } innerXtml = innerXhtml + ' </span>'; demands.setInnerXHTML(innerXhtml); // update balance loadCargo(); } ajax.post(baseURL + "/turn/do-unload-cargo", param); } cargoDialog.oncancel = function() { loadCargo(); } } //loadCargo(); } } ajax.post(baseURL + '/turn/unload-cargo'); }

    Read the article

  • How to get a physics engine like Nape working?

    - by Glacius
    Introduction: I think Nape is a relatively new engine so some of you may not know it. It's supposedly faster than box2d and I like that there is decent documentation. Here's the site: http://code.google.com/p/nape/ I'm relatively new to programming. I am decent at AS3's basic functionality, but every time I try to implement some kind of engine or framework I can't even seem to get it to work. With Nape I feel I got a little further than before but I still got stuck. My problem: I'm using Adobe CS5, I managed to import the SWC file like described here. Next I tried to copy the source of one of the demo's like this one and get it to work but I keep getting errors. I made a new class file, copied the demo source to it, and tried to add it to the stage. My stage code basically looks like this: import flash.Boot; // these 2 lines are as described in the tutorial new Boot(); var demo = new Main(); // these 2 are me guessing what I'm supposed to do addChild(demo); Well, it seems the source code is not even being recognized by flash as a valid class file. I tried editing it, but even if I get it recognized (give a package name and add curly brackets) but I still get a bunch of errors. Is it psuedo code or something? What is going on? My goal: I can imagine I'm going about this the wrong way. So let me explain what I'm trying to achieve. I basically want to learn how to use the engine by starting from a simple basic example that I can edit and mess around with. If I can't even get a working example then I'm unable to learn anything. Preferably I don't want to start using something like FlashDevelop (as I'd have to learn how to use the program) but if it can't be helped then I can give it a try. Thank you.

    Read the article

  • using a Singleton to pass credentials in a multi-tenant application a code smell?

    - by Hans Gruber
    Currently working on a multi-tenant application that employs Shared DB/Shared Schema approach. IOW, we enforce tenant data segregation by defining a TenantID column on all tables. By convention, all SQL reads/writes must include a Where TenantID = '?' clause. Not an ideal solution, but hindsight is 20/20. Anyway, since virtually every page/workflow in our app must display tenant specific data, I made the (poor) decision at the project's outset to employ a Singleton to encapsulate the current user credentials (i.e. TenantID and UserID). My thinking at the time was that I didn't want to add a TenantID parameter to each and every method signature in my Data layer. Here's what the basic pseudo-code looks like: public class UserIdentity { public UserIdentity(int tenantID, int userID) { TenantID = tenantID; UserID = userID; } public int TenantID { get; private set; } public int UserID { get; private set; } } public class AuthenticationModule : IHttpModule { public void Init(HttpApplication context) { context.AuthenticateRequest += new EventHandler(context_AuthenticateRequest); } private void context_AuthenticateRequest(object sender, EventArgs e) { var userIdentity = _authenticationService.AuthenticateUser(sender); if (userIdentity == null) { //authentication failed, so redirect to login page, etc } else { //put the userIdentity into the HttpContext object so that //its only valid for the lifetime of a single request HttpContext.Current.Items["UserIdentity"] = userIdentity; } } } public static class CurrentUser { public static UserIdentity Instance { get { return HttpContext.Current.Items["UserIdentity"]; } } } public class WidgetRepository: IWidgetRepository{ public IEnumerable<Widget> ListWidgets(){ var tenantId = CurrentUser.Instance.TenantID; //call sproc with tenantId parameter } } As you can see, there are several code smells here. This is a singleton, so it's already not unit test friendly. On top of that you have a very tight-coupling between CurrentUser and the HttpContext object. By extension, this also means that I have a reference to System.Web in my Data layer (shudder). I want to pay down some technical debt this sprint by getting rid of this singleton for the reasons mentioned above. I have a few thoughts on what an better implementation might be, but if anyone has any guidance or lessons learned they could share, I would be much obliged.

    Read the article

  • Remove never-run call to templated function, get allocation error on run-time

    - by Narfanator
    First off, I'm a bit at a loss as to how to ask this question. So I'm going to try throwing lots of information at the problem. Ok, so, I went to completely redesign my test project for my experimental core library thingy. I use a lot of template shenanigans in the library. When I removed the "user" code, the tests gave me a memory allocation error. After quite a bit of experimenting, I narrowed it down to this bit of code (out of a couple hundred lines): void VOODOO(components::switchBoard &board){ board.addComponent<using_allegro::keyInputs<'w'> >(); } Fundementally, what's weirding me out is that it appears that the act of compiling this function (and the template function it then uses, and the template functions those then use...), makes this bug not appear. This code is not being run. Similar code (the same, but for different key vals) occurs elsewhere, but is within Boost TDD code. I realize I certainly haven't given enough information for you to solve it for me; I tried, but it more-or-less spirals into most of the code base. I think I'm most looking for "here's what the problem could be", "here's where to look", etc. There's something that's happening during compile because of this line, but I don't know enough about that step to begin looking. Sooo, how can a (presumably) compilied, but never actually run, bit of templated code, when removed, cause another part of code to fail? Error: Unhandled exceptionat 0x6fe731ea (msvcr90d.dll) in Switchboard.exe: 0xC0000005: Access violation reading location 0xcdcdcdc1. Callstack: operator delete(void * pUser Data) allocator< class name related to key inputs callbacks ::deallocate vector< same class ::_Insert_n(...) vector< " " ::insert(...) vector<" "::push_back(...) It looks like maybe the vector isn't valid, because _MyFirst and similar data members are showing values of 0xcdcdcdcd in the debugger. But the vector is a member variable...

    Read the article

  • A standard event messaging system with AJAX?

    - by Gutzofter
    Is there any standards or messaging framework for AJAX? Right now I have a single page that loads content using Ajax. Because I had a complex form for data entry as part of my content, I need to validate certain events that can occur in my form. So after some adjustments driven by my tests: asyncShould("search customer list click", 3, function() { stop(1000); $('#content').show(); var forCustomerList = newCustomerListRequest(); var forShipAndCharge = newShipAndChargeRequest(forCustomerList); forCustomerList.page = '../../vt/' + forCustomerList.page; forShipAndCharge.page = 'helpers/helper.php'; forShipAndCharge.data = { 'action': 'shipAndCharge', 'DB': '11001' }; var originalComplete = forShipAndCharge.complete; forShipAndCharge.complete = function(xhr, status) { originalComplete(xhr, status); ok($('#customer_edit').is(":visible"), 'Shows customer editor'); $('#search').click(); ok($('#customer_list').is(":visible"), 'Shows customer list'); ok($('#customer_edit').is(":hidden"), 'Does not show customer editor'); start(); }; testController.getContent(forShipAndCharge); }); Here is the controller for getting content: getContent: function (request) { $.ajax({ type: 'GET', url: request.page, dataType: 'json', data: request.data, async: request.async, success: request.success, complete: request.complete }); }, And here is the request event: function newShipAndChargeRequest(serverRequest) { var that = { serverRequest: serverRequest, page: 'nodes/orders/sc.php', data: 'customer_id=-1', complete: errorHandler, success: function(msg) { shipAndChargeHandler(msg); initWhenCustomer(that.serverRequest); }, async: true }; return that; } And here is a success handler: function shipAndChargeHandler(msg) { $('.contentContainer').html(msg.html); if (msg.status == 'flash') { flash(msg.flash); } } And on my server side I end up with a JSON structure that looks like this: $message['status'] = 'success'; $message['data'] = array(); $message['flash'] = ''; $message['html'] = ''; echo json_encode($message); So now loading content consists of two parts: HTML, this is the presentation of the form. DATA, this is any data that needs be loaded for the form FLASH, any validation or server errors STATUS tells client what happened on server. My question is: Is this a valid way to handle event messaging on the client-side or am I going down a path of heartache and pain?

    Read the article

  • Extend argparse to write set names in the help text for optional argument choices and define those sets once at the end

    - by Kent
    Example of the problem If I have a list of valid option strings which is shared between several arguments, the list is written in multiple places in the help string. Making it harder to read: def main(): elements = ['a', 'b', 'c', 'd', 'e', 'f'] parser = argparse.ArgumentParser() parser.add_argument( '-i', nargs='*', choices=elements, default=elements, help='Space separated list of case sensitive element names.') parser.add_argument( '-e', nargs='*', choices=elements, default=[], help='Space separated list of case sensitive element names to ' 'exclude from processing') parser.parse_args() When running the above function with the command line argument --help it shows: usage: arguments.py [-h] [-i [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]]] [-e [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]]] optional arguments: -h, --help show this help message and exit -i [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]] Space separated list of case sensitive element names. -e [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]] Space separated list of case sensitive element names to exclude from processing What would be nice It would be nice if one could define an option list name, and in the help output write the option list name in multiple places and define it last of all. In theory it would work like this: def main_optionlist(): elements = ['a', 'b', 'c', 'd', 'e', 'f'] # Two instances of OptionList are equal if and only if they # have the same name (ALFA in this case) ol = OptionList('ALFA', elements) parser = argparse.ArgumentParser() parser.add_argument( '-i', nargs='*', choices=ol, default=ol, help='Space separated list of case sensitive element names.') parser.add_argument( '-e', nargs='*', choices=ol, default=[], help='Space separated list of case sensitive element names to ' 'exclude from processing') parser.parse_args() And when running the above function with the command line argument --help it would show something similar to: usage: arguments.py [-h] [-i [ALFA [ALFA ...]]] [-e [ALFA [ALFA ...]]] optional arguments: -h, --help show this help message and exit -i [ALFA [ALFA ...]] Space separated list of case sensitive element names. -e [ALFA [ALFA ...]] Space separated list of case sensitive element names to exclude from processing sets in optional arguments: ALFA {a,b,c,d,e,f} Question I need to: Replace the {'l', 'i', 's', 't', 's'} shown with the option name, in the optional arguments. At the end of the help text show a section explaining which elements each option name consists of. So I ask: Is this possible using argparse? Which classes would I have to inherit from and which methods would I need to override? I have tried looking at the source for argparse, but as this modification feels pretty advanced I don´t know how to get going.

    Read the article

  • Losing session after Login - Java

    - by Patrick Villela
    I'm building an application that needs to login to a certain page and make a navigation. I can login, provided that the response contains a string that identifies it. But, when I navigate to the second page, I can't see the page as a logged user, only as anonymous. I'll provide my code. import java.net.*; import java.security.*; import java.security.cert.*; import javax.net.ssl.*; import java.io.*; import java.util.*; public class PostTest { static HttpsURLConnection conn = null; private static class DefaultTrustManager implements X509TrustManager { @Override public void checkClientTrusted(X509Certificate[] arg0, String arg1) throws CertificateException {} @Override public void checkServerTrusted(X509Certificate[] arg0, String arg1) throws CertificateException {} @Override public X509Certificate[] getAcceptedIssuers() { return null; } } public static void main(String[] args) { try { SSLContext ctx = SSLContext.getInstance("TLS"); ctx.init(new KeyManager[0], new TrustManager[] {new DefaultTrustManager()}, new SecureRandom()); SSLContext.setDefault(ctx); String data = URLEncoder.encode("txtUserName", "UTF-8") + "=" + URLEncoder.encode(/*username*/, "UTF-8"); data += "&" + URLEncoder.encode("txtPassword", "UTF-8") + "=" + URLEncoder.encode(/*password*/", "UTF-8"); data += "&" + URLEncoder.encode("envia", "UTF-8") + "=" + URLEncoder.encode("1", "UTF-8"); connectToSSL(/*login url*/); conn.setDoOutput(true); OutputStreamWriter wr = new OutputStreamWriter(conn.getOutputStream()); wr.write(data); wr.flush(); BufferedReader rd = new BufferedReader(new InputStreamReader(conn.getInputStream())); String line; String resposta = ""; while((line = rd.readLine()) != null) { resposta += line + "\n"; } System.out.println("valid login -> " + resposta.contains(/*string that assures me I'm looged in*/)); connectToSSL(/*first navigation page*/); rd = new BufferedReader(new InputStreamReader(conn.getInputStream())); while((line = rd.readLine()) != null) { System.out.println(line); } } catch(Exception e) { e.printStackTrace(); } } private static void connectToSSL(String address) { try { URL url = new URL(address); conn = (HttpsURLConnection) url.openConnection(); conn.setHostnameVerifier(new HostnameVerifier() { @Override public boolean verify(String arg0, SSLSession arg1) { return true; } }); } catch(Exception ex) { ex.printStackTrace(); } } } Any further information, just ask. Thanks in advance.

    Read the article

  • Circular database relationships. Good, Bad, Exceptions?

    - by jim
    I have been putting off developing this part of my app for sometime purely because I want to do this in a circular way but get the feeling its a bad idea from what I remember my lecturers telling me back in school. I have a design for an order system, ignoring the everything that doesn't pertain to this example I'm left with: CreditCard Customer Order I want it so that, Customers can have credit cards (0-n) Customers have orders (1-n) Orders have one customer(1-1) Orders have one credit card(1-1) Credit cards can have one customer(1-1) (unique ids so we can ignore uniqueness of cc number, husband/wife may share cc instances ect) Basically the last part is where the issue shows up, sometimes credit cards are declined and they wish to use a different one, this needs to update which their 'current' card is but this can only change the current card used for that order, not the other orders the customer may have on disk. Effectively this creates a circular design between the three tables. Possible solutions: Either Create the circular design, give references: cc ref to order, customer ref to cc customer ref to order or customer ref to cc customer ref to order create new table that references all three table ids and put unique on the order so that only one cc may be current to that order at any time Essentially both model the same design but translate differently, I am liking the latter option best at this point in time because it seems less circular and more central. (If that even makes sense) My questions are, What if any are the pros and cons of each? What is the pitfalls of circular relationships/dependancies? Is this a valid exception to the rule? Is there any reason I should pick the former over the latter? Thanks and let me know if there is anything you need clarified/explained. --Update/Edit-- I have noticed an error in the requirements I stated. Basically dropped the ball when trying to simplify things for SO. There is another table there for Payments which adds another layer. The catch, Orders can have multiple payments, with the possibility of using different credit cards. (if you really want to know even other forms of payment). Stating this here because I think the underlying issue is still the same and this only really adds another layer of complexity.

    Read the article

< Previous Page | 291 292 293 294 295 296 297 298 299 300 301 302  | Next Page >