Search Results

Search found 44910 results on 1797 pages for 'breadth first traversal'.

Page 298/1797 | < Previous Page | 294 295 296 297 298 299 300 301 302 303 304 305  | Next Page >

• Shared memory of same DLL in different 32 bit processes is sometimes different in a terminal session

  - by KBrusing

  We have an 32 bit application consisting of some processes. They communicate with shared memory of a DLL used by every process. Shared memory is build with global variables in C++ by "#pragma data_seg ("Shared")". When running this application sometime during starting a new process in addition to an existing (first) process we observe that the shared memory of both processes is not the same. All new started processes cannot communicate with the first process. After stopping all of our processes and restarting the application (with some processes) everything works fine. But sometime or other after successfully starting and finishing new processes the problem occurs again. Running on all other Windows versions or terminal sessions on Windows server 2003 our application never got this problem. Is there any new "feature" on Windows server 2008 that might disturb the hamony of our application?

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• JDBC Pagination

  - by Zeeshan

  Hi, I want to implement pagination using JDBC. The actual thing I want to know is "How can i get first 50 and then next 50 records from database for page 1 and 2 respectively" My Query is Select * from data [data table contains 20,000 rows] For page #1 I get 50 records and for page #2 I want to get next 50 records. How can I implement it efficiently in JDBC? I have searched and found that rs.absolute(row) is the way to skip first page records but it takes some amount of time on large result sets and I don't want to bear this amount of time. Also, I don't want to use rownum and limit + offset in query because these are not good to use in query, I dont know why, still I don't want to use it in query. Can anyone help me how to get limited ResultSet for pagination or is there any way JDBC is giving us?

  Read the article

• SSIS - user variable used in derived column transform is not available - in some cases

  - by soo

  Unfortunately I don't have a repro for my issue, but I thought I would try to describe it in case it sounds familiar to someone... I am using SSIS 2005, SP2. My package has a package-scope user variable - let's call it user_var first step in the control flow is an Execute SQL task which runs a stored procedure. All that SP does is insert a record in a SQL table (with an identity column) and then go back and get the max ID value. The Execute SQL task saves this output into user_var the control flow then has a Data Flow Task - it goes and gets some source data, has a derived column which sets a column called run_id to user_var - and saves the data to a SQL destination In most cases (this template is used for many packages, running every day) this all works great. All of the destination records created get set with a correct run_id. However, in some cases, there is a set of the destination data that does not get run_id equal to user_var, but instead gets a value of 0 (0 is the default value for user_var). I have 2 instances where this has happened, but I can't make it happen. In both cases, it was just less that 10,000 records that have run_id = 0. Since SSIS writes data out in 10,000 record blocks, this really makes me think that, for the first set of data written out, user_var was not yet set. Then, after that first block, for the rest of the data, run_id is set to a correct value. But control passed on to my data flow from the Execute SQL task - it would have seemed reasonable to me that it wouldn't go on until the SP has completed and user_var is set. Maybe it just runs the SP, but doesn't wait for it to complete? In both cases where this has happened there seemed to be a few packages hitting the table to get a new user_var at about the same time. And in both cases lots of data was written (40 million rows, 60 million rows) - my thinking is that that means the writes were happening for a while. Sorry to be both long-winded AND vague. A winning combination! Does this sound familiar to anyone? Thanks.

  Read the article

• Can I have different name and id attributes on a form element?

  - by ewitkows

  Hi all, I have a web form with usual elements (first name, last name, etc). The Postback URL is a different website altogether as the form is intented to post lead information to another website. The site that accepts the lead is expecting First Name to come over as "FName", and Last Name to come over as "LName". Is there any way I can set the ID of a textbox to "txtFName", but submit it over the wire as "FName"? I tried changing the name attribute, but at runtime it sets the name = id.

  Read the article

• null pointer exception in textview of setcontent

  - by kitokid

  I am getting the java.lang.NullPointerException on createTabContent for the following code. There are two tabspecs. When I called and set the tab , changed the tabs for the first time it is ok. But when i called again while I am on the second tab, its hit the null pointer exception for line : NoStudentText.setVisibility(View.VISIBLE); I will show No Student Text if there is no data for the student list. It shows the text for the first time call. But If I do second time call to that tab, got the error. tspecStudent.setContent(new TabContentFactory() { public View createTabContent(String arg0) { if(listStudent != null && listStudent .size() > 0) { //show the student list } else { TextView noStudentText = (TextView)findViewById(R.id.NoStudentText); noStudentText.setVisibility(View.VISIBLE); return noStudentText; } } });

  Read the article

• Finding Most Recent Order for a Particular Item

  - by visitor

  I'm trying to write a SQL Query for DB2 Version 8 which retrieves the most recent order of a specific part for a list of users. The query receives a parameter which contains a list of customerId numbers and the partId number. For example, Order Table OrderID PartID CustomerID OrderTime I initially wanted to try: Select * from Order where OrderId = ( Select orderId from Order where partId = #requestedPartId# and customerId = #customerId# Order by orderTime desc fetch first 1 rows only ); The problem with the above query is that it only works for a single user and my query needs to include multiple users. Does anyone have a suggestion about how I could expand the above query to work for multiple users? If I remove my "fetch first 1 rows only," then it will return all rows instead of the most recent. I also tried using Max(OrderTime), but I couldn't find a way to return the OrderId from the sub-select. Thanks! Note: DB2 Version 8 does not support the SQL "TOP" function.

  Read the article

• Strange Locking Behaviour in SQL Server 2005

  - by SQL Learner

  Can anyone please tell me why does the following statement inside a given stored procedure returns repeated results even with locks on the rows used by the first SELECT statement? BEGIN TRANSACTION DECLARE @Temp TABLE ( ID INT ) INSERT INTO @Temp SELECT ID FROM SomeTable WITH (ROWLOCK, UPDLOCK, READPAST) WHERE SomeValue <= 10 INSERT INTO @Temp SELECT ID FROM SomeTable WITH (ROWLOCK, UPDLOCK, READPAST) WHERE SomeValue >= 5 SELECT * FROM @Temp COMMIT TRANSACTION Any values in SomeTable for which SomeValue is between 5 and 10 will be returned twice, even though they were locked in the first SELECT. I thought that locks were in place for the whole transaction, and so I wasn't expecting the query to return repeated results. Why is this happening?

  Read the article

• Shall I optimize or let compiler to do that?

  - by Knowing me knowing you

  What is the preferred method of writing loops according to efficiency: Way a) /*here I'm hoping that compiler will optimize this code and won't be calling size every time it iterates through this loop*/ for (unsigned i = firstString.size(); i < anotherString.size(), ++i) { //do something } or maybe should I do it this way: Way b) unsigned first = firstString.size(); unsigned second = anotherString.size(); and now I can write: for (unsigned i = first; i < second, ++i) { //do something } the second way seems to me like worse option for two reasons: scope polluting and verbosity but it has the advantage of being sure that size() will be invoked once for each object. Looking forward to your answers.

  Read the article

• How does the #! work?

  - by mocybin

  In a script you must include a #! on the first line followed by the path to the program that will execute the script (e.g.: sh, perl). As far as I know though, the # character denotes the start of a comment and that line is supposed to be ignored by the program executing the script. It would seem though, that this first line is at some point read by something in order for the script to be executed by the proper program. Could somebody please shed more light on the workings of the #! ? Edit: I'm really curious about this, so the more in-depth the answer the better.

  Read the article

• Using the same cookie in two logins

  - by cer9ss

  Hi everyone, I need your help I've a MVC project that uses Jquery, where I've implemented a mechanism of "Remember Me" using cookies to save, clear and retrieve the login and password. I also have two screens where the user does the login. I want that both logins manipulate the same cookie. I've got to implement it, but I've realized that each one has a different behaviour. I mean, the cookie's value I save in the first login is not the same than the value that retrieves the second login (when I open it). In other words, if I mark "remind me" on the first login, it isn't reflected on the second login and viceversa. What can I do to make that both of them manipulate and read the same values from the same cookie? Is it possible? PS: For this situations I'm using the same web navigator: Firefox or IE. Thanks in advance

  Read the article

• Linux File Permissions & Access Control Query

  - by Jason

  Hi, Lets say I am user: bob & group: users. There is this file: -rw----r-- 1 root users 4 May 8 22:34 testfile First question, why can't bob read the file as it's readable by others? Is it simply that if you are denied by group, then you are auto-blacklisted for others? I always assumed that the final 3 bits too precedence over user/group permission bits, guess I was wrong... Second question, how is this implemented? I suppose it's linked to the first query, but how does this work in relation to Access Control, is it related to how ACLs work / are queried? Just trying to understand how these 9 permission bits are actually implemented/used in Linux. Thanks alot.

  Read the article

• What scripts should not be ported from bash to python?

  - by Jack

  I decided to rewrite all our Bash scripts in Python (there are not so many of them) as my first Python project. The reason for it is that although being quite fluent in Bash I feel it's somewhat archaic language and since our system is in the first stages of its developments I think switching to Python now will be the right thing to do. Are there scripts that should always be written in Bash? For example, we have an init.d daemon script - is it OK to use Python for it? We run CentOS. Thanks.

  Read the article

• jQuery accordion expanded

  - by hajder

  I am trying to create an accordion with jQuery from this example http://docs.jquery.com/UI/Accordion The markup is the same, i.e. <div id="accordion"> <h3><a href="#">First header</a></h3> <div>First content</div> <h3><a href="#">Second header</a></h3> <div>Second content</div> </div> And I have script file enqueued correctly, which has the following content: $ = jQuery; $(document).ready(function() { $("#accordion").accordion(); }); But I get this error in the console output TypeError: 'undefined' is not a function (evaluating '$("#accordion").accordion()') The result being all divs are expanded, i.e not clickable.

  Read the article

• Mootools accordion inside another...

  - by jimbo

  Hi all, This is a funny one... I have created a mootools accordion with tabs, each section appears when clicked. This works fine. Now within the first accordion that shows, I have another accordion that displays more data. This was to keep the area small with the mass of information that is needed on the page. All works fine, the problem come when the information hidden is larger than the area that is worked our for the first tabs accordion, and it wont display. does any-one either understand what i'm trying to say, or have an idea of a fix or workaround? Hope this makes sense!

  Read the article

• How to deal with delegate method calling back the object who send the message ?

  - by olipion

  I have two object: @protocol ObjectADelegate - (void)objectAfirst:(ObjectA *)obj; - (void)objectAsecond:(ObjectA *)obj; @end @interface ObjectA : NSObject { id<ObjectADelegate> delegate; - (void)callSecond { [self.delegate objectAsecond:self]; } @end @interface ObjectB : NSObject <ObjectADelegate>{ ObjectA *myObjectA; } @implementation ObjectB - (void)objectAfirst:(ObjectA *)obj { // First is finished, do second [obj callSecond]; } - (void)objectASecond:(ObjectA *)obj { // Do my stuff } @end As you can see in the code, when ObjectA send the message objectAfirst to its delegate, objectb use again objectA methods that result in objecta calling back objectb. It means that what first fire objectAfirst is not finished but objectA send the objectAsecond message. Could it be a problem ? Any way to let delay message handling in objectB ? for example, something like using [obj performSelector:@selector(callSecond) afterDelay:0.01]; instead of [obj callSecond]; ?

  Read the article

• Having a problem with simple bool

  - by Code

  Hi guys, I've some really simple code that checks if my bool is == YES but it does not ever enter. NSLog(@"boool %d",self.arrayAlreadyPopulated ); if (self.arrayAlreadyPopulated == YES) { Match *aMatch = [appDelegate.matchScoresArray objectAtIndex:(numMatchCounter)]; aMatch.teamName1 = TeamNameHolder; } else { Match *aMatch = [[Match alloc] init]; aMatch.teamName1 = TeamNameHolder; [appDelegate.matchScoresArray addObject:aMatch]; [aMatch release]; } The debug at the top says that the value of self.arrayAlreadyPopulated is 1 on the 2nd pass as it should be. But it never enters the first first part but jumps down to the 'else' I cant see for the life of me what the problem is. -.- Anybody able to clue me in? Thanks -Code EDIT declaration code int theCounterCauseABoolWontWork; @property (nonatomic) int theCounterCauseABoolWontWork; @synthesize theCounterCauseABoolWontWork;

  Read the article

• which one is a faster/better sql practice?

  - by artsince

  Suppose I have a 2 column table (id, flag) and id is sequential. I expect this table to contain a lot of records. I want to periodically select the first row not flagged and update it. Some of the records on the way may have already been flagged, so I want to skip them. Does it make more sense if I store the last id I flagged and use it in my select statement, like select * from mytable where id > my_last_id order by id asc limit 1 or simply get the first unflagged row, like: select * from mytable where flagged = 'F' order by id asc limit 1 Thank you!

  Read the article

• Definition of "lisp form"?

  - by josh

  Hi, What exactly the definition of a "Lisp form"? As far as I know, it's "either an atom or a list that has a symbol as its first element". But then, this (in Scheme) would not be a form: ((lambda () 42)) ;; The answer to Life, the Universe and Everything. Because the first element of the list is itself another list. And after it's evaluated it will be a procedure (not a symbol). I can find several different websites and tutorials talking about Lisp forms, but none which gives a complete and detailed definition. Where can I find one?

  Read the article

• taking and holding input

  - by gcc

  i tried to take input from user input like that input:: first line:>>name(white space)last name second line:>>identification number(white space)birtdate(,,:,,:) third line:>>lesson which he take (ce140 ce213 ce383...) last line:>>note he take(80 60 ......) this input type for each student i tried to hold this input in struct like struct name is first line { second line third line last line } my testing scanf("%[^\n]\n); take input hold in string scanf("%s",...secondline_name); storing in secondline_name . . . but this doesnot work are there any other way to hold input

  Read the article

• C# Why does calling an interface member from a class generate an error?

  - by Jack

  So I have an interface: interface IFoo { int Bar(); int this[int i] {get; set;} } And a class that derives from it class Foo : IFoo { public int IFoo.Bar() { //Implementation { public int IFoo.this[int i] { //Implementation } } Now, I try to do this: var fooey = new Foo(); int i = Fooey.Bar(); or this: int i = Fooey[4]; I would expect these to work properly. However, the compiler generates an error as if such members don't exist. Why is that? I am aware I can cast Foo as IFoo, but I am also aware that casting is costly to performance, which is often the reason to use interfaces in the first place. EDIT 1: These are the errors generated 'Foo' does not contain a definition for 'Bar' and no extension method 'Bar' accepting a first argument of type 'Foo' could be found (are you missing a using directive or an assembly reference?) "Cannot apply indexing to an expression of type 'Foo'"

  Read the article

• objective-c - calling one constructor from another

  - by synic

  Say you had the following two constructors: - (id)initWithTitle:(NSString *)title; - (id)initWithTitle:(NSString *)title page:(NSString *)page; The second constructor is no different from the first, except that it sets up the member variable "page". Since it basically has to do the same thing, is there a way to call the first one from the second one to reduce code duplication, or do you have to set up a third method to do the common tasks? I'm talking about something similar to this, though I doubt this will work: - (id)initWithTitle:(NSString *)_title { if(self = [super init]) { self.title = _title; } return self; } - (id)initWithTitle:(NSString *)_title page:(NSString *)_page { if(self = [self initWithTitle:_title]) { self.page = _page; } return self; }

  Read the article

• AudioOutputUnitStart takes time

  - by tokentoken

  Hello, I'm making an iPhone game application using Core Audio, Extended Audio File Services. It works OK, but when I first call AudioOutputUnitStart, it takes about 1-2 seconds. After the second call, no problem. For a game application, 1-2 seconds is very noticeable. (I tested this on iPhone simulator, and iPhone 3GS) Also, if I leave the game for about 10 seconds, first call of AudioOutputUnitStart also takes time. Maybe I have to call AudioOutputUnitStart beginning of the application to prevent the start-up time?

  Read the article

• Start all tab's activities for pre-cache

  - by Pentium10

  I have a TabActivity with three tabs defined. The first tab is light-weight and renders in acceptable time. But the 2nd and 3rd tab, does need a couple of seconds to get visually rendered, after I click them. I would like to launch them, after I've loaded my first tab, in background for pre-cache. Once they are loaded, I can switch quickly between them. So I am wondering how can I launch the 2nd and 3rd tab. They are intents loaded in the view area.

  Read the article

• Search in the control WebBrowser

  - by mail-22

  as in the WebBrowser control are to find all occurrences of a keyword, highlight them and go to the first occurrence ?

  Read the article

< Previous Page | 294 295 296 297 298 299 300 301 302 303 304 305  | Next Page >