Search Results

Search found 44965 results on 1799 pages for 'presenter first'.

Page 298/1799 | < Previous Page | 294 295 296 297 298 299 300 301 302 303 304 305  | Next Page >

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Strange Locking Behaviour in SQL Server 2005

    - by SQL Learner
    Can anyone please tell me why does the following statement inside a given stored procedure returns repeated results even with locks on the rows used by the first SELECT statement? BEGIN TRANSACTION DECLARE @Temp TABLE ( ID INT ) INSERT INTO @Temp SELECT ID FROM SomeTable WITH (ROWLOCK, UPDLOCK, READPAST) WHERE SomeValue <= 10 INSERT INTO @Temp SELECT ID FROM SomeTable WITH (ROWLOCK, UPDLOCK, READPAST) WHERE SomeValue >= 5 SELECT * FROM @Temp COMMIT TRANSACTION Any values in SomeTable for which SomeValue is between 5 and 10 will be returned twice, even though they were locked in the first SELECT. I thought that locks were in place for the whole transaction, and so I wasn't expecting the query to return repeated results. Why is this happening?

    Read the article

  • Delegate Example From C# In Depth Confusion

    - by ChloeRadshaw
    I am looking at this example: List<Product> products = Product. GetSampleProducts() ; products.Sort( (first, second) => first.Name.CompareTo(second. Name) ) ; foreach (Product product in products) { Console. WriteLine(product) ; } What function is actually called in the API when you do that? Does the compiler create a class which implemnents the IComparer interface? I thought delegates were anonymous methods - Here it seems to be an anonymous interface implementation which is casuing confusion

    Read the article

  • objective-c - calling one constructor from another

    - by synic
    Say you had the following two constructors: - (id)initWithTitle:(NSString *)title; - (id)initWithTitle:(NSString *)title page:(NSString *)page; The second constructor is no different from the first, except that it sets up the member variable "page". Since it basically has to do the same thing, is there a way to call the first one from the second one to reduce code duplication, or do you have to set up a third method to do the common tasks? I'm talking about something similar to this, though I doubt this will work: - (id)initWithTitle:(NSString *)_title { if(self = [super init]) { self.title = _title; } return self; } - (id)initWithTitle:(NSString *)_title page:(NSString *)_page { if(self = [self initWithTitle:_title]) { self.page = _page; } return self; }

    Read the article

  • How to deal with delegate method calling back the object who send the message ?

    - by olipion
    I have two object: @protocol ObjectADelegate - (void)objectAfirst:(ObjectA *)obj; - (void)objectAsecond:(ObjectA *)obj; @end @interface ObjectA : NSObject { id<ObjectADelegate> delegate; - (void)callSecond { [self.delegate objectAsecond:self]; } @end @interface ObjectB : NSObject <ObjectADelegate>{ ObjectA *myObjectA; } @implementation ObjectB - (void)objectAfirst:(ObjectA *)obj { // First is finished, do second [obj callSecond]; } - (void)objectASecond:(ObjectA *)obj { // Do my stuff } @end As you can see in the code, when ObjectA send the message objectAfirst to its delegate, objectb use again objectA methods that result in objecta calling back objectb. It means that what first fire objectAfirst is not finished but objectA send the objectAsecond message. Could it be a problem ? Any way to let delay message handling in objectB ? for example, something like using [obj performSelector:@selector(callSecond) afterDelay:0.01]; instead of [obj callSecond]; ?

    Read the article

  • JDBC Pagination

    - by Zeeshan
    Hi, I want to implement pagination using JDBC. The actual thing I want to know is "How can i get first 50 and then next 50 records from database for page 1 and 2 respectively" My Query is Select * from data [data table contains 20,000 rows] For page #1 I get 50 records and for page #2 I want to get next 50 records. How can I implement it efficiently in JDBC? I have searched and found that rs.absolute(row) is the way to skip first page records but it takes some amount of time on large result sets and I don't want to bear this amount of time. Also, I don't want to use rownum and limit + offset in query because these are not good to use in query, I dont know why, still I don't want to use it in query. Can anyone help me how to get limited ResultSet for pagination or is there any way JDBC is giving us?

    Read the article

  • Perform tasks with delay, without delaying web response (ASP.NET)

    - by Tomas Lycken
    I'm working on a feature that needs to send two text messages with a 30 second delay, and it is crucial that both text messages are sent. Currently, this feature is built with ajax requests, that are sent with a 30 second javascript delay, but since this requires the user to have his browser open and left on the same page for at least 30 seconds, it is not a method I like. Instead, I have tried to solve this with threading. This is what I've done: Public Shared Sub Larma() Dim thread As New System.Threading.Thread(AddressOf Larma_Thread) thread.Start() End Sub Private Shared Sub Larma_Thread() StartaLarm() Thread.Sleep(1000 * 30) StoppaLarm() End Sub A web handler calls Larma(), and StartaLarm() and StoppaLarm() are the methods that send the first and second text messages respectively. However, I only get the first text message delivered - the second is never sent. Am I doing something wrong here? I have no deep understanding of how threading works in ASP.NET, so please let me know how to accomplish this.

    Read the article

  • css of pagination links

    - by fusion
    i'd like a basic idea of how to go about formatting the following paging of the search result. this is the paging code: //Create and print the Navigation bar $nav=""; $next = $page+1; $prev = $page-1; if($page > 1) { $nav .= "<div class=\"search_mainpg\"><div class=\"searchpage\" style=\"width:5%;\"><a onclick=\"showPage('','$prev'); return false;\" href=\"$self?page=" . $prev . "&q=" .urlencode($search_result) . "\">< Prev</a></div>"; $first = "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('','1'); return false;\" href=\"$self?page=1&q=" .urlencode($search_result) . "\"> << </a></div>" ; } else { $nav .= "&nbsp;"; $first = "&nbsp;"; } for($i = 1 ; $i <= $numpages ; $i++) { if($i == $page) { $nav .= "<b>$i</b>"; }else{ $nav .= "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('',$i); return false;\" href=\"$self?page=" . $i . "&q=" .urlencode($search_result) . "\">$i</a></div>"; } } if($page < $numpages) { $nav .= "<div class=\"searchpage\" style=\"width:5%;\"><a onclick=\"showPage('','$next'); return false;\" href=\"$self?page=" . $next . "&q=" .urlencode($search_result) . "\">Next ></a></div>"; $last = "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('','$numpages'); return false;\" href=\"$self?page=$numpages&q=" .urlencode($search_result) . "\"> >> </a></div></div>"; } else { $nav .= "&nbsp;"; $last = "&nbsp;"; } echo $first . $nav . $last; currently, it displays like this:

    Read the article

  • Should I be using libraries if I'm trying to learn how to program?

    - by CodeJustin.com
    I have been programming "a lot" in the past few months and at first I was trying to find the "easyest" language. Fortunately I realized that it's not about the language, it's about learning HOW to code. I ran into the Stanford lectures online (programming methodology) and I watched them all (around 23 hours total) awhile ago. Then I got into Java ME and programmed about 28.47% of a mobile RPG game (only around 2k lines of code). I feel like I learned a lot from those two experiences compared to previous ones but now that I'm moving into flash/actionscript 3.0 development and I'm finding myself learning like I did when I first started with PHP. I'm not really getting whats under the hood kind of. I'm finding myself using libraries to speed up development time which doesn't seem like a bad thing BUT I personally do not know how to write the libraries myself off hand. So should I be coding everything myself or is it ok to use libraries when you don't even know how to code them?

    Read the article

  • Can I set JFrame's normal size while it is maximized?

    - by icza
    I'd like to set the normal size of a visible JFrame while it is in Frame.MAXIMIZED_BOTH state (by normal size i mean the size of frame when it is in Frame.NORMAL state) . The reason I want to do this is so that when the user un-maximizes the frame, it will have the proper size I want it to be. But if I do so, the window will switch to normal state. If I set the size first, then switch to MAXIMIZED_BOTH state, then I will see a disturbing blink or resize (which I don't want to). I've also tried setting the size first, then changing state to MAXIMIZED_BOTH, and then making it visible, but the state change is deferred if the window is not visible (and will only be executed once it is made visible, also resulting in a visual resize). So what can I do if I want my frame to have a predefined normal size, but I want it to appear maximized?

    Read the article

  • How to convert string to integer?

    - by user1260584
    So I'm having a hard time with my situation and need some advice. I'm trying to convert my two Strings that I have into integers, so that I can use them in math equations. Here is what I tried, however it brings me an error in the app. ' equals.setOnClickListener(new View.OnClickListener() { public void onClick(View arg0) { // TODO Auto-generated method stub num1 = edit.getText().toString(); num2 = edit.getText().toString(); int first = Integer.parseInt(num1); int second = Integer.parseInt(num2); edit.setText(first + second); } }); Is there something that I am doing wrong? Thank you for any help. EDIT: Yes this is Java. num1 and num2 are strings that I have previously named. What do you mean by trim?

    Read the article

  • Is using a DataSet's column Expression works in background same as manual calculation?

    - by Harikrishna
    I have one datatable which is not bindided and records are coming from the file by parsing it in the datatable dynamically every time. Now there is three columns in the datatable Marks1,Marks2 and FinalMarks. And their types is decimal. Now for making addition of columns Marks1 and Marks2 's records and store it into FinalMarks column,For that what I do is : datatableResult.Columns["FinalMarks"].Expression="Marks1+Marks2"; It's works properly. It can be done in other way also is foreach (DataRow r in datatableResult.Rows) { r["FinalMarks"]=Convert.ToDecimal(r["Marks1"])+Convert.ToDecimal(r["Marks2"]); } Is first approach same as second approach in background means is both approach same or what? EDIT: I want to know that first approach works in background as second approach.

    Read the article

  • Passing data from one viewcontroller to another

    - by user1392515
    I subclassed two view controllers. The first one is supposed to pass data, a NSUrl object to the second one. .m of the first one: NSURL *temp = [NSURL URLWithString:@"http://example.com"]; UIViewController *presentationsFullScreen_ViewController = [self.storyboard instantiateViewControllerWithIdentifier:@"PresentationsFullScreen_ViewController"]; presentationsFullScreen_ViewController.urlToUse = temp; .h of the second one: #import <UIKit/UIKit.h> @interface PresentationsFullScreen_ViewController : UIViewController { NSURL *urlToUse; } @property (nonatomic,retain) NSURL *urlToUse; It is obviously not working and not compiling,telling me essentially that I didn't subclass it and that the property urlToUse is not found on UIViewController. How do I subclass correctly? Thanks!

    Read the article

  • Auto not being recognised by the compiler, what would be the best replacement?

    - by user1719605
    So I have wrote a program that uses auto however the compiler doesn't seem to recognize it, probably it is an earlier compiler. I was wondering for my code, with are suitable variables to fix my code so that I do not need to use the auto keyword? I'm thinking a pointer to a string? or a string iterator, though I am not sure. #include <cstdlib> #include <string> #include <iostream> #include <unistd.h> #include <algorithm> using namespace std; int main(int argc, char* argv[]) { enum MODE { WHOLE, PREFIX, SUFFIX, ANYWHERE, EMBEDDED } mode = WHOLE; bool reverse_match = false; int c; while ((c = getopt(argc, argv, ":wpsaev")) != -1) { switch (c) { case 'w': // pattern matches whole word mode = WHOLE; break; case 'p': // pattern matches prefix mode = PREFIX; break; case 'a': // pattern matches anywhere mode = ANYWHERE; break; case 's': // pattern matches suffix mode = SUFFIX; break; case 'e': // pattern matches anywhere mode = EMBEDDED; break; case 'v': // reverse sense of match reverse_match = true; break; } } argc -= optind; argv += optind; string pattern = argv[0]; string word; int matches = 0; while (cin >> word) { switch (mode) { case WHOLE: if (reverse_match) { if (pattern != word) { matches += 1; cout << word << endl; } } else if (pattern == word) { matches += 1; cout << word << endl; } break; case PREFIX: if (pattern.size() <= word.size()) { auto res = mismatch(pattern.begin(), pattern.end(), word.begin()); if (reverse_match) { if (res.first != word.end()) { matches += 1; cout << word << endl; } } else if (res.first == word.end()) { matches += 1; cout << word << endl; } } break; case ANYWHERE: if (reverse_match) { if (!word.find(pattern) != string::npos) { matches += 1; cout << word << endl; } } else if (word.find(pattern) != string::npos) { matches += 1; cout << word << endl; } break; case SUFFIX: if (pattern.size() <= word.size()) { auto res = mismatch(pattern.rbegin(), pattern.rend(), word.rbegin()); if (reverse_match) { if (res.first != word.rend()) { matches = +1; cout << word << endl; } } else if (res.first == word.rend()) { matches = +1; cout << word << endl; } } break; case EMBEDDED: if (reverse_match) { if (!pattern.find(word) != string::npos) { matches += 1; cout << word << endl;} } else if (pattern.find(word) != string::npos) { matches += 1; cout << word << endl; } break; } } return (matches == 0) ? 1 : 0; } Thanks in advance!

    Read the article

  • Finding Most Recent Order for a Particular Item

    - by visitor
    I'm trying to write a SQL Query for DB2 Version 8 which retrieves the most recent order of a specific part for a list of users. The query receives a parameter which contains a list of customerId numbers and the partId number. For example, Order Table OrderID PartID CustomerID OrderTime I initially wanted to try: Select * from Order where OrderId = ( Select orderId from Order where partId = #requestedPartId# and customerId = #customerId# Order by orderTime desc fetch first 1 rows only ); The problem with the above query is that it only works for a single user and my query needs to include multiple users. Does anyone have a suggestion about how I could expand the above query to work for multiple users? If I remove my "fetch first 1 rows only," then it will return all rows instead of the most recent. I also tried using Max(OrderTime), but I couldn't find a way to return the OrderId from the sub-select. Thanks! Note: DB2 Version 8 does not support the SQL "TOP" function.

    Read the article

  • it's not possible to loop .click function (To create multipple buttons)

    - by user1542680
    Im Trying to create multiple buttons that each one of them doing something else. It working great outside of the "each" loop, But in the moment I'm inserting the .click function in the .each function it doesn't work... Here is the Code: $.each(data.arr, function(i, s){ html += '<div id="mybtn'+s.id+'"><button class="first">Btn1</button><button class="second">Btn2</button></div>'; var btnclass="#mybtn"+s.id+" .first"; $(btnclass).click(function(){ //do something }); }); Please Let me know what is wrong... Thank you very much!!! Eran.

    Read the article

  • data loading - app launching on tableview

    - by wallou
    hi, i encounter an issue with my application. On one hand when my app launches, the first view displayed is a tableview within a tableviewcontroller. On the other hand my app calls a web service to collect data. These methods are in MyAppDelegate\applicationDidFinishLaunching. The thing is that my tableview is made of custom cells that need data from the web service. I noticed that the view (with the tableview) is launched first and then MyAppDelegate\applicationDidFinishLaunchin is executed. As a result the labels of my custom cells are all equal to null as my arrays aren't filled yet by the web service. I would like to know the proper way to make it. If anyone has an idea please tell me. Wallou

    Read the article

  • Permutations with extra restrictions

    - by Full Decent
    I have a set of items, for example: {1,1,1,2,2,3,3,3}, and a restricting set of sets, for example {{3},{1,2},{1,2,3},{1,2,3},{1,2,3},{1,2,3},{2,3},{2,3}. I am looking for permutations of items, but the first element must be 3, and the second must be 1 or 2, etc. One such permutation that fits is: {3,1,1,1,2,2,3} Is there an algorithm to count all permutations for this problem in general? Is there a name for this type of problem? For illustration, I know how to solve this problem for certain types of "restricting sets". Set of items: {1,1,2,2,3}, Restrictions {{1,2},{1,2,3},{1,2,3},{1,2},{1,2}}. This is equal to 2!/(2-1)!/1! * 4!/2!/2!. Effectively permuting the 3 first, since it is the most restrictive and then permuting the remaining items where there is room.

    Read the article

  • Facebook access_token: how do I get it once the user accepted my app?

    - by hoktar
    When a user visits my site which contains a facebook app the first time, it requires him to allow it and he gets promted to do that, then I get the code which I can convert to an access_token. So far so good. But how do I get the token once the user has already visited the site? As long as this token form the first time is active everything is fine. But how do I get another token when the user had already allowed the app a week ago and is only visiting my page again?

    Read the article

  • Encryption By Certificate

    - by user1817240
    I am encrypting customer name in database at database level. While saving in database only first letter of customer name is saved and hence while decrypting only first letter is retrieved. The following code shows the test sp. ALTER PROCEDURE [dbo].[spc_test_insert] ( @sFIRST_NAME typ_encryptedtext, ) AS BEGIN DECLARE @sSENCRYPTION_KEY char(15) DECLARE @sCERTIFICATE char(22) SET @sSENCRYPTION_KEY='SymmetricKey1' SET @sCERTIFICATE='CustomerCertificate' OPEN SYMMETRIC KEY SymmetricKey1 DECRYPTION BY CERTIFICATE CustomerCertificate; INSERT INTO test_table ( FIRST_NAME, ) Values ( -- Add the Params to be Added... EncryptByKey(Key_GUID(@sSENCRYPTION_KEY),@sFIRST_NAME), ) CLOSE SYMMETRIC KEY SymmetricKey1 END encryption decryption working fine in normal insert but its not working in stored procedure.

    Read the article

  • Any Way to Use a Join in a Lambda Where() on a Table<>?

    - by lush
    I'm in my first couple of days using Linq in C#, and I'm curious to know if there is a more concise way of writing the following. MyEntities db = new MyEntities(ConnString); var q = from a in db.TableA join b in db.TableB on a.SomeFieldID equals b.SomeFieldID where (a.UserID == CurrentUser && b.MyField == Convert.ToInt32(MyDropDownList.SelectedValue)) select new { a, b }; if(q.Any()) { //snip } I know that if I were to want to check the existence of a value in the field of a single table, I could just use the following: if(db.TableA.Where(u => u.UserID == CurrentUser).Any()) { //snip } But I'm curious to know if there is a way to do the lambda technique, but where it would satisfy the first technique's conditions across those two tables. Sorry for any mistakes or clarity, I'll edit as necessary. Thanks in advance.

    Read the article

  • Start all tab's activities for pre-cache

    - by Pentium10
    I have a TabActivity with three tabs defined. The first tab is light-weight and renders in acceptable time. But the 2nd and 3rd tab, does need a couple of seconds to get visually rendered, after I click them. I would like to launch them, after I've loaded my first tab, in background for pre-cache. Once they are loaded, I can switch quickly between them. So I am wondering how can I launch the 2nd and 3rd tab. They are intents loaded in the view area.

    Read the article

  • How do i resolve method Overlapping in java/Processing [duplicate]

    - by user3718913
    This question already has an answer here: How do I compare strings in Java? 24 answers I have two methods/function in a class, called, Qestion1 and Question2, i want it in such a way that after the user has answered Question one correctly, the Question 2 method is called. Whenever i call the method 2, it displays both of them together instead exiting the first method first. Here's a dummy code to illustrate what i'm saying: void Question1() { String question="What is the capital of England?"; String Answer="London"; if(Answer=='London') { Question2(); } } void Question2() { String question="What is the capital of California?"; String Answer="Sacramento"; if(Answer=='Sacramento') { Question3(); } } Pls, this question is in no way related to that other question. Pls peruse the thread again.

    Read the article

< Previous Page | 294 295 296 297 298 299 300 301 302 303 304 305  | Next Page >