Search Results

Search found 8391 results on 336 pages for 'partial hash arguments'.

Page 305/336 | < Previous Page | 301 302 303 304 305 306 307 308 309 310 311 312  | Next Page >

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • MODX parse error function implode (is it me or modx?)

    - by Ian
    Hi, I cannot for the life of me figure this out, maybe someone can help. Using MODX a form takes user criteria to create a filter and return a list of documents. The form is one text field and a few checkboxes. If both text field and checkbox data is posted, the function works fine; if just the checkbox data is posted the function works fine; but if just the text field data is posted, modx gives me the following error: Error: implode() [function.implode]: Invalid arguments passed. I've tested this outside of modx with flat files and it all works fine leading me to assume a bug exists within modx. But I'm not convinced. Here's my code: <?php $order = array('price ASC'); //default sort order if(!empty($_POST['tour_finder_duration'])){ //duration submitted $days = htmlentities($_POST['tour_finder_duration']); //clean up post array_unshift($order,"duration DESC"); //add duration sort before default $filter[] = 'duration,'.$days.',4'; //add duration to filter[] (field,criterion,mode) $criteria[] = 'Number of days: <strong>'.$days.'</strong>'; //displayed on results page } if(!empty($_POST['tour_finder_dests'])){ //destination/s submitted $dests = $_POST['tour_finder_dests']; foreach($dests as $value){ //iterate through dests array $filter[] = 'searchDests,'.htmlentities($value).',7'; //add dests to filter[] $params['docid'] = $value; $params['field'] = 'pagetitle'; $pagetitle = $modx->runSnippet('GetField',$params); $dests_array[] = '<a href="[~'.$value.'~]" title="Read more about '.$pagetitle.'" class="tourdestlink">'.$pagetitle.'</a>'; } $dests_array = implode(', ',$dests_array); $criteria[] = 'Destinations: '.$dests_array; //displayed on results page } if(is_array($filter)){ $filter = implode('|',$filter);//pipe-separated string } if(is_array($order)){ $order = implode(',',$order);//comma-separated string } if(is_array($criteria)){ $criteria = implode('<br />',$criteria); } echo '<br />Order: '.$order.'<br /> Filter: '.$filter.'<br /> Criteria: '.$criteria; //next: extract docs using $filter and $order, display user's criteria using $criteria... ?> The echo statement is displayed above the MODX error message and the $filter array is correctly imploded. Any help will save my computer from flying out the window. Thanks

    Read the article

  • Solving a cyclical dependency in Ninject (Compact Framework)

    - by Alex
    I'm trying to use Ninject for dependency injection in my MVP application. However, I have a problem because I have two types that depend on each other, thus creating a cyclic dependency. At first, I understand that it was a problem, because I had both types require each other in their constructors. Therefore, I moved one of the dependencies to a property injection instead, but I'm still getting the error message. What am I doing wrong? This is the presenter: public class LoginPresenter : Presenter<ILoginView>, ILoginPresenter { public LoginPresenter( ILoginView view ) : base( view ) { } } and this is the view: public partial class LoginForm : Form, ILoginView { [Inject] public ILoginPresenter Presenter { private get; set; } public LoginForm() { InitializeComponent(); } } And here's the code that causes the exception: static class Program { /// <summary> /// The main entry point for the application. /// </summary> [MTAThread] static void Main() { // Show the login form Views.LoginForm loginForm = Kernel.Get<Views.Interfaces.ILoginView>() as Views.LoginForm; Application.Run( loginForm ); } } The exception happens on the line with the Kernel.Get<>() call. Here it is: Error activating ILoginPresenter using binding from ILoginPresenter to LoginPresenter A cyclical dependency was detected between the constructors of two services. Activation path: 4) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 3) Injection of dependency ILoginView into parameter view of constructor of type LoginPresenter 2) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 1) Request for ILoginView Suggestions: 1) Ensure that you have not declared a dependency for ILoginPresenter on any implementations of the service. 2) Consider combining the services into a single one to remove the cycle. 3) Use property injection instead of constructor injection, and implement IInitializable if you need initialization logic to be run after property values have been injected. Why doesn't Ninject understand that since one is constructor injection and the other is property injection, this can work just fine? I even read somewhere looking for the solution to this problem that Ninject supposedly gets this right as long as the cyclic dependency isn't both in the constructors. Apparently not, though. Any help resolving this would be much appreciated.

    Read the article

  • Any thoughts on how to create a true 'punch-out' area in a Sprite?

    - by rhtx
    I've been working on this for awhile, now. You might also call it a 'reverse mask', or an 'inverse mask'. Basically, I'm creating a view window within a display object. I need to allow objects on the stage that are under the window to be able to interact with the mouse. This is similar to a WPF question: http://stackoverflow.com/questions/740994/use-wpf-object-to-punch-hole-in-another, which has a much shorter write-up. I've got a Class called PunchOutShield, which creates a Sprite that covers the stage (or over some desired area). The Sprite's Graphics object is filled using the color and transparency of Flex's modal screen. The result is a screen that looks like the screen which appears behind a modal PopUp. PunchOutShield has a method called punch, which takes two arguments - the first is a Shape object, which defines the shape of the punch-through area; the second is a Point object, which indicates where to position the punch-through area. It took some experimenting, but I found that I can successfully create a punch-out area (i.e. - the modal screen does not display within the bounds of the given Shape). To do this, I set cacheAsBitmap to true on the Sprite that is used to create the modal screen, and also on the Shape object, which is added to the modal screen Sprite's displayList. If I set the blend mode of the Shape to ERASE, a completely transparent area is created in the modal screen. So far, great. The problem is that Shape does not subclass InteractiveObject, so there is no way to set mouseEnabled = false on it. And so, it prevents interaction between the mouse and any objects that are visible through the punch-out area. On top of that, InteractiveObject isn't available to look at, so I can't see if there is a way to borrow what it's doing to provide the mouseEnabled functionality and apply it to a subclass of Shape. I've tried using another Sprite object, rather than a Shape object, but the blending doesn't work out correctly. I'm not sure why there is a difference, but the Shape object seems to somehow combine with the parenting Sprite, allowing the ERASE blendMode to effect the desired punch-out visual appearance. It wouldn't be the end of the world if I had to draw up the screen with a series of rectangles so that the punch-out area was just simply not drawn, but that approach won't work if the punch-out area is complex. Or round. Any thoughts on this approach, or on an alternative approach?

    Read the article

  • C#/.NET Project - Am I setting things up correctly?

    - by JustLooking
    1st solution located: \Common\Controls\Controls.sln and its project: \Common\Controls\Common.Controls\Common.Controls.csproj Description: This is a library that contains this class: public abstract class OurUserControl : UserControl { // Variables and other getters/setters common to our UserControls } 2nd solution located: \AControl\AControl.sln and its project: \AControl\AControl\AControl.csproj Description: Of the many forms/classes, it will contain this class: using Common.Controls; namespace AControl { public partial class AControl : OurUserControl { // The implementation } } A note about adding references (not sure if this is relevant): When I add references (for projects I create), using the names above: 1. I add Common.Controls.csproj to AControl.sln 2. In AControl.sln I turn off the build of Common.Controls.csproj 3. I add the reference to Common.Controls (by project) to AControl.csproj. This is the (easiest) way I know how to get Debug versions to match Debug References, and Release versions to match Release References. Now, here is where the issue lies (the 3rd solution/project that actually utilizes the UserControl): 3rd solution located: \MainProj\MainProj.sln and its project: \MainProj\MainProj\MainProj.csproj Description: Here's a sample function in one of the classes: private void TestMethod<T>() where T : Common.Controls.OurUserControl, new() { T TheObject = new T(); TheObject.OneOfTheSetters = something; TheObject.AnotherOfTheSetters = something_else; // Do stuff with the object } We might call this function like so: private void AnotherMethod() { TestMethod<AControl.AControl>(); } This builds, runs, and works. No problem. The odd thing is after I close the project/solution and re-open it, I have red squigglies everywhere. I bring up my error list and I see tons of errors (anything that deals with AControl will be noted as an error). I'll see errors such as: The type 'AControl.AControl' cannot be used as type parameter 'T' in the generic type or method 'MainProj.MainClass.TestMethod()'. There is no implicit reference conversion from 'AControl.AControl' to 'Common.Controls.OurUserControl'. or inside the actual method (the properties located in the abstract class): 'AControl.AControl' does not contain a definition for 'OneOfTheSetters' and no extension method 'OneOfTheSetters' accepting a first argument of type 'AControl.AControl' could be found (are you missing a using directive or an assembly reference?) Meanwhile, I can still build and run the project (then the red squigglies go away until I re-open the project, or close/re-open the file). It seems to me that I might be setting up the projects incorrectly. Thoughts?

    Read the article

  • Delphi - Read File To StringList, then delete and write back to file.

    - by Jkraw90
    I'm currently working on a program to generate the hashes of files, in Delphi 2010. As part of this I have a option to create User Presets, e.g. pre-defined choice of hashing algo's which the user can create/save/delete. I have the create and load code working fine. It uses a ComboBox and loads from a file "fhpre.ini", inside this file is the users presets stored in format of:- PresetName PresetCode (a 12 digit string using 0 for don't hash and 1 for do) On application loading it loads the data from this file into the ComboBox and an Array with the ItemIndex of ComboBox matching the corrisponding correct string of 0's and 1's in the Array. Now I need to implement a feature to have the user delete a preset from the list. So far my code is as follows, procedure TForm1.Panel23Click(Sender : TObject); var fil : textfile; contents : TStringList; x,i : integer; filline : ansistring; filestream : TFileStream; begin //Start Procedure //Load data into StringList contents := TStringList.Create; fileStream := TFileStream.Create((GetAppData+'\RFA\fhpre.ini'), fmShareDenyNone); Contents.LoadFromStream(fileStream); fileStream.Destroy(); //Search for relevant Preset i := 0; if ComboBox4.Text <> Contents[i] then begin Repeat i := i + 1; Until ComboBox4.Text = Contents[i]; end; contents.Delete(i); //Delete Relevant Preset Name contents.Delete(i); //Delete Preset Digit String //Write StringList back to file. AssignFile(fil,(GetAppData+'\RFA\fhpre.ini')); ReWrite(fil); for i := 0 to Contents.Count -1 do WriteLn(Contents[i]); CloseFile(fil); Contents.Free; end; However if this is run, I get a 105 error when it gets to the WriteLn section. I'm aware that the code isn't great, for example doesn't have checks for presets with same name, but that will come, I want to get the base code working first then can tweak and add extra checks etc. Any help would be appreciated.

    Read the article

  • WPF data templates

    - by imekon
    I'm getting started with WPF and trying to get my head around connecting data to the UI. I've managed to connect to a class without any issues, but what I really want to do is connect to a property of the main window. Here's the XAML: <Window x:Class="test3.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:custom="clr-namespace:test3" Title="MainWindow" Height="350" Width="525"> <Window.Resources> <CollectionViewSource Source="{Binding Source={x:Static Application.Current}, Path=Platforms}" x:Key="platforms"/> <DataTemplate DataType="{x:Type custom:Platform}"> <StackPanel> <CheckBox IsChecked="{Binding Path=Selected}"/> <TextBlock Text="{Binding Path=Name}"/> </StackPanel> </DataTemplate> </Window.Resources> <Grid> <ListBox ItemsSource="{Binding Source={StaticResource platforms}}"/> </Grid> Here's the code for the main window: public partial class MainWindow : Window { ObservableCollection<Platform> m_platforms; public MainWindow() { m_platforms = new ObservableCollection<Platform>(); m_platforms.Add(new Platform("PC")); InitializeComponent(); } public ObservableCollection<Platform> Platforms { get { return m_platforms; } set { m_platforms = value; } } } Here's the Platform class: public class Platform { private string m_name; private bool m_selected; public Platform(string name) { m_name = name; m_selected = false; } public string Name { get { return m_name; } set { m_name = value; } } public bool Selected { get { return m_selected; } set { m_selected = value; } } } This all compiles and runs fine but the list box displays with nothing in it. If I put a breakpoint on the get method of Platforms, it doesn't get called. I don't understand as Platforms is what the XAML should be connecting to!

    Read the article

  • Problem updating through LINQtoSQL in MVC application using StructureMap, Repository Pattern and UoW

    - by matt
    I have an ASP MVC application using LINQ to SQL for data access. I am trying to use the Repository and Unit of Work patterns, with a service layer consuming the repositories and unit of work. I am experiencing a problem when attempting to perform updates on a particular repository. My application architecture is as follows: My service class: public class MyService { private IRepositoryA _RepositoryA; private IRepositoryB _RepositoryB; private IUnitOfWork _unitOfWork; public MyService(IRepositoryA ARepositoryA, IRepositoryB ARepositoryB, IUnitOfWork AUnitOfWork) { _unitOfWork = AUnitOfWork; _RepositoryA = ARepositoryA; _RepositoryB = ARepositoryB; } public PerformActionOnObject(Guid AID) { MyObject obj = _RepositoryA.GetRecords() .WithID(AID); obj.SomeProperty = "Changed to new value"; _RepositoryA.UpdateRecord(obj); _unitOfWork.Save(); } } Repository interface: public interface IRepositoryA { IQueryable<MyObject> GetRecords(); UpdateRecord(MyObject obj); } Repository LINQtoSQL implementation: public class LINQtoSQLRepositoryA : IRepositoryA { private MyDataContext _DBContext; public LINQtoSQLRepositoryA(IUnitOfWork AUnitOfWork) { _DBConext = AUnitOfWork as MyDataContext; } public IQueryable<MyObject> GetRecords() { return from records in _DBContext.MyTable select new MyObject { ID = records.ID, SomeProperty = records.SomeProperty } } public bool UpdateRecord(MyObject AObj) { MyTableRecord record = (from u in _DB.MyTable where u.ID == AObj.ID select u).SingleOrDefault(); if (record == null) { return false; } record.SomeProperty = AObj.SomePropery; return true; } } Unit of work interface: public interface IUnitOfWork { void Save(); } Unit of work implemented in data context extension. public partial class MyDataContext : DataContext, IUnitOfWork { public void Save() { SubmitChanges(); } } StructureMap registry: public class DataServiceRegistry : Registry { public DataServiceRegistry() { // Unit of work For<IUnitOfWork>() .HttpContextScoped() .TheDefault.Is.ConstructedBy(() => new MyDataContext()); // RepositoryA For<IRepositoryA>() .Singleton() .Use<LINQtoSQLRepositoryA>(); // RepositoryB For<IRepositoryB>() .Singleton() .Use<LINQtoSQLRepositoryB>(); } } My problem is that when I call PerformActionOnObject on my service object, the update never fires any SQL. I think this is because the datacontext in the UnitofWork object is different to the one in RepositoryA where the data is changed. So when the service calls Save() on it's IUnitOfWork, the underlying datacontext does not have any updated data so no update SQL is fired. Is there something I've done wrong in the StrutureMap registry setup? Or is there a more fundamental problem with the design? Many thanks.

    Read the article

  • Writing a managed wrapper for unmanaged (C++) code - custom types/structs

    - by Bobby
    faacEncConfigurationPtr FAACAPI faacEncGetCurrentConfiguration( faacEncHandle hEncoder); I'm trying to come up with a simple wrapper for this C++ library; I've never done more than very simple p/invoke interop before - like one function call with primitive arguments. So, given the above C++ function, for example, what should I do to deal with the return type, and parameter? FAACAPI is defined as: #define FAACAPI __stdcall faacEncConfigurationPtr is defined: typedef struct faacEncConfiguration { int version; char *name; char *copyright; unsigned int mpegVersion; unsigned long bitRate; unsigned int inputFormat; int shortctl; psymodellist_t *psymodellist; int channel_map[64]; } faacEncConfiguration, *faacEncConfigurationPtr; AFAIK this means that the return type of the function is a reference to this struct? And faacEncHandle is: typedef struct { unsigned int numChannels; unsigned long sampleRate; ... SR_INFO *srInfo; double *sampleBuff[MAX_CHANNELS]; ... double *freqBuff[MAX_CHANNELS]; double *overlapBuff[MAX_CHANNELS]; double *msSpectrum[MAX_CHANNELS]; CoderInfo coderInfo[MAX_CHANNELS]; ChannelInfo channelInfo[MAX_CHANNELS]; PsyInfo psyInfo[MAX_CHANNELS]; GlobalPsyInfo gpsyInfo; faacEncConfiguration config; psymodel_t *psymodel; /* quantizer specific config */ AACQuantCfg aacquantCfg; /* FFT Tables */ FFT_Tables fft_tables; int bitDiff; } faacEncStruct, *faacEncHandle; So within that struct we see a lot of other types... hmm. Essentially, I'm trying to figure out how to deal with these types in my managed wrapper? Do I need to create versions of these types/structs, in C#? Something like this: [StructLayout(LayoutKind.Sequential)] struct faacEncConfiguration { uint useTns; ulong bitRate; ... } If so then can the runtime automatically "map" these objects onto eachother? And, would I have to create these "mapped" types for all the types in these return types/parameter type hierarchies, all the way down until I get to all primitives? I know this is a broad topic, any advice on getting up-to-speed quickly on what I need to learn to make this happen would be very much appreciated! Thanks!

    Read the article

  • In what circumstances are instance variables declared as '_var' in 'use fields' private?

    - by Pedro Silva
    I'm trying to understand the behavior of the fields pragma, which I find poorly documented, regarding fields prefixed with underscores. This is what the documentation has to say about it: Field names that start with an underscore character are made private to the class and are not visible to subclasses. Inherited fields can be overridden but will generate a warning if used together with the -w switch. This is not consistent with its actual behavior, according to my test, below. Not only are _-prefixed fields visible within a subclass, they are visible within foreign classes as well (unless I don't get what 'visible' means). Also, directly accessing the restricted hash works fine. Where can I find more about the behavior of the fields pragma, short of going at the source code? { package Foo; use strict; use warnings; use fields qw/a _b __c/; sub new { my ( $class ) = @_; my Foo $self = fields::new($class); $self->a = 1; $self->b = 2; $self->c = 3; return $self; } sub a : lvalue { shift->{a} } sub b : lvalue { shift->{_b} } sub c : lvalue { shift->{__c} } } { package Bar; use base 'Foo'; use strict; use warnings; use Data::Dumper; my $o = Bar->new; print Dumper $o; ##$VAR1 = bless({'_b' => 2, '__c' => 3, 'a' => 1}, 'Foo'); $o->a = 4; $o->b = 5; $o->c = 6; print Dumper $o; ##$VAR1 = bless({'_b' => 5, '__c' => 6, 'a' => 4}, 'Foo'); $o->{a} = 7; $o->{_b} = 8; $o->{__c} = 9; print Dumper $o; ##$VAR1 = bless({'_b' => 8, '__c' => 9, 'a' => 7}, 'Foo'); }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • jQuery UI dialog + WebKit + HTML response with script

    - by Anthony Koval'
    Once again I am faced with a great problem! :) So, here is the stuff: on the client side, I have a link. By clicking on it, jQuery makes a request to the server, gets response as HTML content, then popups UI dialog with that content. Here is the code of the request-function: function preview(){ $.ajax({ url: "/api/builder/", type: "post", //dataType: "html", data: {"script_tpl": $("#widget_code").text(), "widgets": $.toJSON(mwidgets), "widx": "0"}, success: function(data){ //console.log(data) $("#previewArea").dialog({ bgiframe: true, autoOpen: false, height: 600, width: 600, modal: true, buttons: { "Cancel": function() { $(this).dialog('destroy'); } } }); //console.log(data.toString()); $('#previewArea').attr("innerHTML", data.toString()); $("#previewArea").dialog("open"); }, error: function(){ console.log("shit happens"); } }) } The response (data) is: <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <script type="text/javascript">var smakly_widget_sid = 0 ,widgets = [{"cols": "2","rows": "2","div_id": "smakly_widget","wid": "0","smakly_style": "small_image",}, ] </script> <script type="text/javascript" src="/media/js/smak/smakme.js"></script> </head> <body> preview <div id="smakly_widget" style="width:560px;height:550px"> </div> </body> </html> As you see, there is a script to load: smakme.js, somehow it doesn't execute in WebKit-based browsers (I tried in Safari and Chrome), but in Firefox, Internet Explorer and Opera it works as expected! Here is that script: String.prototype.format = function(){ var pattern = /\{\d+\}/g; var args = arguments; return this.replace(pattern, function(capture){ return args[capture.match(/\d+/)]; }); } var turl = "/widget" var widgetCtrl = new(function(){ this.render_widget = function (w, content){ $("#" + w.div_id).append(content); } this.build_widgets = function(){ for (var widx in widgets){ var w = widgets[widx], iurl = '{0}?sid={1}&wid={2}&w={3}&h={4}&referer=http://ya.ru&thrash={5}'.format( turl, smakly_widget_sid, w.wid, w.cols, w.rows, Math.floor(Math.random()*1000).toString()), content = $('<iframe src="{0}" width="100%" height="100%"></iframe>'.format(iurl)); this.render_widget(w, content); } } }) $(document).ready(function(){ widgetCtrl.build_widgets(); }) Is that some security issue, or anything else?

    Read the article

  • due at midnight - program compiles but has logic error(s)

    - by Leslie Laraia
    not sure why this program isn't working. it compiles, but doesn't provide the expected output. the input file is basically just this: Smith 80000 Jones 100000 Scott 75000 Washington 110000 Duffy 125000 Jacobs 67000 Here is the program: import java.io.File; import java.io.FileNotFoundException; import java.util.Scanner; /** * * @author Leslie */ public class Election { /** * @param args the command line arguments */ public static void main(String[] args) throws FileNotFoundException { // TODO code application logic here File inputFile = new File("C:\\Users\\Leslie\\Desktop\\votes.txt"); Scanner in = new Scanner(inputFile); int x = 0; String line = ""; Scanner lineScanner = new Scanner(line); line = in.nextLine(); while (in.hasNextLine()) { line = in.nextLine(); x++; } String[] senatorName = new String[x]; int[] votenumber = new int[x]; double[] votepercent = new double[x]; System.out.printf("%44s", "Election Results for State Senator"); System.out.println(); System.out.printf("%-22s", "Candidate"); //Prints the column headings to the screen System.out.printf("%22s", "Votes Received"); System.out.printf("%22s", "%of Total Votes"); int i; for(i=0; i<x; i++) { while(in.hasNextLine()) { line = in.nextLine(); String candidateName = lineScanner.next(); String candidate = candidateName.trim(); senatorName[i] = candidate; int votevalue = lineScanner.nextInt(); votenumber[i] = votevalue; } } votepercent = percentages(votenumber, x); for (i = 0; i < x; i++) { System.out.println(); System.out.printf("%-22s", senatorName[i]); System.out.printf("%22d", votenumber[i]); System.out.printf("%22.2f", votepercent[i]); System.out.println(); } } public static double [] percentages(int[] votenumber, int z) { double [] percentage = new double [z]; double total = 0; for (double element : votenumber) { total = total + element; } for(int i=0; i < votenumber.length; i++) { int y = votenumber[i]; percentage[i] = (y/total) * 100; } return percentage; } }

    Read the article

  • Serialization Error:Unable to generate a temporary class (result=1).\r\nerror CS0030:- c#

    - by ltech
    Running XSD.exe on my xml to generate C# class. All works well except on this property public DocumentATTRIBUTES[][] Document { get { return this.documentField; } set { this.documentField = value; } } I want to try and use CollectionBase, and this was my attempt public DocumentATTRIBUTESCollection Document { get { return this.documentField; } set { this.documentField = value; } } /// <remarks/> [System.SerializableAttribute()] [System.Diagnostics.DebuggerStepThroughAttribute()] [System.ComponentModel.DesignerCategoryAttribute("code")] [System.Xml.Serialization.XmlTypeAttribute(AnonymousType = true)] public partial class DocumentATTRIBUTES { private string _author; private string _maxVersions; private string _summary; /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string author { get { return _author; } set { _author = value; } } /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string max_versions { get { return _maxVersions; } set { _maxVersions = value; } } /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string summary { get { return _summary; } set { _summary = value; } } } public class DocumentAttributeCollection : System.Collections.CollectionBase { public DocumentAttributeCollection() : base() { } public DocumentATTRIBUTES this[int index] { get { return (DocumentATTRIBUTES)this.InnerList[index]; } } public void Insert(int index, DocumentATTRIBUTES value) { this.InnerList.Insert(index, value); } public int Add(DocumentATTRIBUTES value) { return (this.InnerList.Add(value)); } } However when I try to serialize my object using XmlSerializer serializer = new XmlSerializer(typeof(DocumentMetaData)); I get the error: {"Unable to generate a temporary class (result=1).\r\nerror CS0030: Cannot convert type 'DocumentATTRIBUTES' to 'DocumentAttributeCollection'\r\nerror CS1502: The best overloaded method match for 'DocumentAttributeCollection.Add(DocumentATTRIBUTES)' has some invalid arguments\r\nerror CS1503: Argument '1': cannot convert from 'DocumentAttributeCollection' to 'DocumentATTRIBUTES'\r\n"} the XSD pertaining to this property is <xs:complexType> <xs:sequence> <xs:element name="ATTRIBUTES" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="author" type="xs:string" minOccurs="0" /> <xs:element name="max_versions" type="xs:string" minOccurs="0" /> <xs:element name="summary" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> </xs:sequence> </xs:complexType> </xs:element>

    Read the article

  • urgent..haskell mini interpreter

    - by mohamed elshikh
    i'm asked to implement this project and i have problems in part b which is the eval function this is the full describtion of the project You are required to implement an interpreter for mini-Haskell language. An interpreter is dened in Wikipedia as a computer program that executes, i.e. performs, instructions written in a programming language. The interpreter should be able to evaluate functions written in a special notation, which you will dene. A function is dened by: Function name Input Parameters : dened as a list of variables. The body of the function. The body of the function can be any of the following statements: a) Variable: The function may return any of the input variables. b) Arithmetic Expressions: The arithmetic expressions include input variables and addition, sub- traction, multiplication, division and modulus operations on arithmetic expressions. c) Boolean Expressions: The Boolean expressions include the ordering of arithmetic expressions (applying the relationships: <, =<, , = or =) and the anding, oring and negation of Boolean expressions. d) If-then-else statements: where the if keyword is followed by a Boolean expression. The then and else parts may be followed by any of the statements described here. e) Guarded expressions: where each case consists of a boolean expression and any of the statements described here. The expression consists of any number of cases. The rst case whose condition is true, its body should be evaluated. The guarded expression has to terminate with an otherwise case. f) Function calls: the body of the function may have a call to another function. Note that all inputs passed to the function will be of type Int. The output of the function can be of type Int or Bool. To implement the interpreter, you are required to implement the following: a) Dene a datatype for the following expressions: Variables Arithmetic expressions Boolean expressions If-then-else statements Guarded expressions Functions b) Implement the function eval which evaluates a function. It takes 3 inputs: The name of a function to be evaluated represented as a string. A list of inputs to that function. The arguments will always be of datatype Int. A list of functions. Each function is represented as instance of the datatype that you have created for functions. c) Implement the function get_type that returns the type of the function (as a string). The input to this function is the same as in part b. here is what i've done data Variable = v(char) data Arth= va Variable | Add Arth Arth | Sub Arth Arth | Times Arth Arth | Divide Arth Arth data Bol= Great Arth Arth | Small Arth Arth | Geq Arth Arth | Seq Arth Arth | And Bol Bol | Or Bol Bol | Neg Bol data Cond = data Guard = data Fun =cons String [Variable] Body data Body= bodycons(String) |Bol |Cond |Guard |Arth

    Read the article

  • User Control as container

    - by Luca
    I'm designing a simple expander control. I've derived from UserControl, drawn inner controls, built, run; all ok. Since an inner Control is a Panel, I'd like to use it as container at design time. Indeed I've used the attributes: [Designer(typeof(ExpanderControlDesigner))] [Designer("System.Windows.Forms.Design.ParentControlDesigner, System.Design", typeof(IDesigner))] Great I say. But it isn't... The result is that I can use it as container at design time but: The added controls go back the inner controls already embedded in the user control Even if I push to top a control added at design time, at runtime it is back again on controls embedded to the user control I cannot restrict the container area at design time into a Panel area What am I missing? Here is the code for completeness... why this snippet of code is not working? [Designer(typeof(ExpanderControlDesigner))] [Designer("System.Windows.Forms.Design.ParentControlDesigner, System.Design", typeof(IDesigner))] public partial class ExpanderControl : UserControl { public ExpanderControl() { InitializeComponent(); .... [System.Security.Permissions.PermissionSet(System.Security.Permissions.SecurityAction.Demand, Name = "FullTrust")] internal class ExpanderControlDesigner : ControlDesigner { private ExpanderControl MyControl; public override void Initialize(IComponent component) { base.Initialize(component); MyControl = (ExpanderControl)component; // Hook up events ISelectionService s = (ISelectionService)GetService(typeof(ISelectionService)); IComponentChangeService c = (IComponentChangeService)GetService(typeof(IComponentChangeService)); s.SelectionChanged += new EventHandler(OnSelectionChanged); c.ComponentRemoving += new ComponentEventHandler(OnComponentRemoving); } private void OnSelectionChanged(object sender, System.EventArgs e) { } private void OnComponentRemoving(object sender, ComponentEventArgs e) { } protected override void Dispose(bool disposing) { ISelectionService s = (ISelectionService)GetService(typeof(ISelectionService)); IComponentChangeService c = (IComponentChangeService)GetService(typeof(IComponentChangeService)); // Unhook events s.SelectionChanged -= new EventHandler(OnSelectionChanged); c.ComponentRemoving -= new ComponentEventHandler(OnComponentRemoving); base.Dispose(disposing); } public override System.ComponentModel.Design.DesignerVerbCollection Verbs { get { DesignerVerbCollection v = new DesignerVerbCollection(); v.Add(new DesignerVerb("&asd", new EventHandler(null))); return v; } } } I've found many resources (Interaction, designed, limited area), but nothing was usefull for being operative...

    Read the article

  • Java replacement for C macros

    - by thkala
    Recently I refactored the code of a 3rd party hash function from C++ to C. The process was relatively painless, with only a few changes of note. Now I want to write the same function in Java and I came upon a slight issue. In the C/C++ code there is a C preprocessor macro that takes a few integer variables names as arguments and performs a bunch of bitwise operations with their contents and a few constants. That macro is used in several different places, therefore its presence avoids a fair bit of code duplication. In Java, however, there is no equivalent for the C preprocessor. There is also no way to affect any basic type passed as an argument to a method - even autoboxing produces immutable objects. Coupled with the fact that Java methods return a single value, I can't seem to find a simple way to rewrite the macro. Avenues that I considered: Expand the macro by hand everywhere: It would work, but the code duplication could make things interesting in the long run. Write a method that returns an array: This would also work, but it would repeatedly result into code like this: long tmp[] = bitops(k, l, m, x, y, z); k = tmp[0]; l = tmp[1]; m = tmp[2]; x = tmp[3]; y = tmp[4]; z = tmp[5]; Write a method that takes an array as an argument: This would mean that all variable names would be reduced to array element references - it would be rather hard to keep track of which index corresponds to which variable. Create a separate class e.g. State with public fields of the appropriate type and use that as an argument to a method: This is my current solution. It allows the method to alter the variables, while still keeping their names. It has the disadvantage, however, that the State class will get more and more complex, as more macros and variables are added, in order to avoid copying values back and forth among different State objects. How would you rewrite such a C macro in Java? Is there a more appropriate way to deal with this, using the facilities provided by the standard Java 6 Development Kit (i.e. without 3rd party libraries or a separate preprocessor)?

    Read the article

  • iPhone: Create a single UIView from multiple clicks

    - by Cuzog
    I'm making a partial overlay modal in my app with the code from “Semi-Modal (Transparent) Dialogs on the iPhone” at ramin.firoozye.com. In doing so, the button that calls the modal is still visible and clickable. I will hide this button when the modal spawns, but I want to be sure if the user clicks very quickly twice, a new modal doesn't come up for each click. What is the best way to check that the modal doesn't already exist when calling it from the button click? You can download the test project here. For those that don't have xcode, the relevant functions are below: I call forth the modal on button click with this: - (IBAction)displayModal:(id)sender { ModalViewController *modalController = [[ModalViewController alloc] initWithNibName:@"ModalViewController" bundle:nil]; modalController.view.frame = CGRectOffset(modalController.view.frame, 0, 230); [self showModal:modalController.view]; } Then use this function to animate the custom modal over the current view: - (void)showModal:(UIView*) modalView { UIWindow* mainWindow = (((TestAppDelegate*) [UIApplication sharedApplication].delegate).window); CGPoint middleCenter = modalView.center; CGSize offSize = [UIScreen mainScreen].bounds.size; CGPoint offScreenCenter = CGPointMake(offSize.width / 2.0, offSize.height * 1.5); modalView.center = offScreenCenter; // we start off-screen [mainWindow addSubview:modalView]; // Show it with a transition effect [UIView beginAnimations:nil context:nil]; [UIView setAnimationDuration:0.4]; // animation duration in seconds modalView.center = middleCenter; [UIView commitAnimations]; } Then I dismiss the modal on button click with this: - (IBAction)dismissModal:(id)sender { [self hideModal:self.view]; } And then use these functions to animate the modal offscreen and clean itself up: - (void)hideModal:(UIView*) modalView { CGSize offSize = [UIScreen mainScreen].bounds.size; CGPoint offScreenCenter = CGPointMake(offSize.width / 2.0, offSize.height * 1.5); [UIView beginAnimations:nil context:modalView]; [UIView setAnimationDuration:0.7]; [UIView setAnimationDelegate:self]; [UIView setAnimationDidStopSelector:@selector(hideModalEnded:finished:context:)]; modalView.center = offScreenCenter; [UIView commitAnimations]; } - (void)hideModalEnded:(NSString *)animationID finished:(NSNumber *)finished context:(void *)context { UIView* modalView = (UIView *)context; [modalView removeFromSuperview]; [self release]; } Any help is greatly appreciated!

    Read the article

  • How do I query delegation properties of an active directory user account?

    - by Mark J Miller
    I am writing a utility to audit the configuration of a WCF service. In order to properly pass credentials from the client, thru the WCF service back to the SQL back end the domain account used to run the service must be configured in Active Directory with the setting "Trust this user for delegation" (Properties - "Delegation" tab). Using C#, how do I access the settings on this tab in Active Directory. I've spent the last 5 hours trying to track this down on the web and can't seem to find it. Here's what I've done so far: using (Domain domain = Domain.GetCurrentDomain()) { Console.WriteLine(domain.Name); // get domain "dev" from MSSQLSERVER service account DirectoryEntry ouDn = new DirectoryEntry("LDAP://CN=Users,dc=dev,dc=mydomain,dc=lcl"); DirectorySearcher search = new DirectorySearcher(ouDn); // get sAMAccountName "dev.services" from MSSQLSERVER service account search.Filter = "(sAMAccountName=dev.services)"; search.PropertiesToLoad.Add("displayName"); search.PropertiesToLoad.Add("userAccountControl"); SearchResult result = search.FindOne(); if (result != null) { Console.WriteLine(result.Properties["displayName"][0]); DirectoryEntry entry = result.GetDirectoryEntry(); int userAccountControlFlags = (int)entry.Properties["userAccountControl"].Value; if ((userAccountControlFlags & (int)UserAccountControl.TRUSTED_FOR_DELEGATION) == (int)UserAccountControl.TRUSTED_FOR_DELEGATION) Console.WriteLine("TRUSTED_FOR_DELEGATION"); else if ((userAccountControlFlags & (int)UserAccountControl.TRUSTED_TO_AUTH_FOR_DELEGATION) == (int)UserAccountControl.TRUSTED_TO_AUTH_FOR_DELEGATION) Console.WriteLine("TRUSTED_TO_AUTH_FOR_DELEGATION"); else if ((userAccountControlFlags & (int)UserAccountControl.NOT_DELEGATED) == (int)UserAccountControl.NOT_DELEGATED) Console.WriteLine("NOT_DELEGATED"); foreach (PropertyValueCollection pvc in entry.Properties) { Console.WriteLine(pvc.PropertyName); for (int i = 0; i < pvc.Count; i++) { Console.WriteLine("\t{0}", pvc[i]); } } } } The "userAccountControl" does not seem to be the correct property. I think it is tied to the "Account Options" section on the "Account" tab, which is not what we're looking for but this is the closest I've gotten so far. The justification for all this is: We do not have permission to setup the service in QA or in Production, so along with our written instructions (which are notoriously only followed in partial) I am creating a tool that will audit the setup (WCF and SQL) to determine if the setup is correct. This will allow the person deploying the service to run this utility and verify everything is setup correctly - saving us hours of headaches and reducing downtime during deployment.

    Read the article

  • Are Objective-C initializers allowed to share the same name?

    - by NattKatt
    I'm running into an odd issue in Objective-C when I have two classes using initializers of the same name, but differently-typed arguments. For example, let's say I create classes A and B: A.h: #import <Cocoa/Cocoa.h> @interface A : NSObject { } - (id)initWithNum:(float)theNum; @end A.m: #import "A.h" @implementation A - (id)initWithNum:(float)theNum { self = [super init]; if (self != nil) { NSLog(@"A: %f", theNum); } return self; } @end B.h: #import <Cocoa/Cocoa.h> @interface B : NSObject { } - (id)initWithNum:(int)theNum; @end B.m: #import "B.h" @implementation B - (id)initWithNum:(int)theNum { self = [super init]; if (self != nil) { NSLog(@"B: %d", theNum); } return self; } @end main.m: #import <Foundation/Foundation.h> #import "A.h" #import "B.h" int main (int argc, const char * argv[]) { NSAutoreleasePool * pool = [[NSAutoreleasePool alloc] init]; A *a = [[A alloc] initWithNum:20.0f]; B *b = [[B alloc] initWithNum:10]; [a release]; [b release]; [pool drain]; return 0; } When I run this, I get the following output: 2010-04-26 20:44:06.820 FnTest[14617:a0f] A: 20.000000 2010-04-26 20:44:06.823 FnTest[14617:a0f] B: 1 If I reverse the order of the imports so it imports B.h first, I get: 2010-04-26 20:45:03.034 FnTest[14635:a0f] A: 0.000000 2010-04-26 20:45:03.038 FnTest[14635:a0f] B: 10 For some reason, it seems like it's using the data type defined in whichever @interface gets included first for both classes. I did some stepping through the debugger and found that the isa pointer for both a and b objects ends up the same. I also found out that if I no longer make the alloc and init calls inline, both initializations seem to work properly, e.g.: A *a = [A alloc]; [a initWithNum:20.0f]; If I use this convention when I create both a and b, I get the right output and the isa pointers seem to be different for each object. Am I doing something wrong? I would have thought multiple classes could have the same initializer names, but perhaps that is not the case.

    Read the article

  • Database schema for simple stats project

    - by Bubnoff
    Backdrop: I have a file hierarchy of cvs files for multiple locations named by dates they cover ...by month specifically. Each cvs file in the folder is named after the location. eg', folder name: 2010-feb contains: location1.csv location2.csv Each CSV file holds records like this: 2010-06-28, 20:30:00 , 0 2010-06-29, 08:30:00 , 0 2010-06-29, 09:30:00 , 0 2010-06-29, 10:30:00 , 0 2010-06-29, 11:30:00 , 0 meaning of record columns ( column names ): Date, time, # of sessions I have a perl script that pulls the data from this mess and originally I was going to store it as json files, but am thinking a database might be more appropriate long term ...comparing year to year trends ...fun stuff like that. Pt 2 - My question/problem: So I now have a REST service that coughs up json with a test database. My question is [ I suck at db design ], how best to design a database backend for this? I am thinking the following tables would suffice and keep it simple: Location: (PK)location_code, name session: (PK)id, (FK)location_code, month, hour, num_sessions I need to be able to average sessions (plus min and max) for each hour across days of week in addition to days of week in a given month or months. I've been using perl hashes to do this and am trying to decide how best to implement this with a database. Do you think stored procedures should be used? As to the database, depending on info gathered here, it will be postgresql or sqlite. If there is no compelling reason for postgresql I'll stick with sqlite. How and where should I compare the data to hours of operation. I am storing the hours of operation in a yaml file. I currently 'match' the hour in the data to a hash from the yaml to do this. Would a database open simpler methods? I am thinking I would do this comparison as I do now then insert the data. Can be recalled with: SELECT hour, num_sessions FROM session WHERE location_code=LOC1 Since only hours of operation are present, I do not need to worry about it. Should I calculate all results as I do now then store as a stats table for different 'reports'? This, rather than processing on demand? How would this look? Anyway ...I ramble. Thanks for reading! Bubnoff

    Read the article

  • Php plugin to replace '->' with '.' as the member access operator ? Or even better: alternative synt

    - by Gigi
    Present day usable solution: Note that if you use an ide or an advanced editor, you could make a code template, or record a macro that inserts '->' when you press Ctrl and '.' or something. Netbeans has macros, and I have recorded a macro for this, and I like it a lot :) (just click the red circle toolbar button (start record macro),then type -> into the editor (thats all the macro will do, insert the arrow into the editor), then click the gray square (stop record macro) and assign the 'Ctrl dot' shortcut to it, or whatever shortcut you like) The php plugin: The php plugin, would also have to have a different string concatenation operator than the dot. Maybe a double dot ? Yea... why not. All it has to do is set an activation tag so that it doesnt replace / interpreter '.' as '->' for old scripts and scripts that dont intent do use this. Something like this: <php+ $obj.i = 5 ?> (notice the modified '<?php' tag to '<?php+' ) This way it wouldnt break old code. (and you can just add the '<?php+' code template to your editor and then type 'php tab' (for netbeans) and it would insert '<?php+' ) With the alternative syntax method you could even have old and new syntax cohabitating on the same page like this (I am illustrating this to show the great compatibility of this method, not because you would want to do this): <?php+ $obj.i = 5; ?> <?php $obj->str = 'a' . 'b'; ?> You could change the tag to something more explanatory, in case somebody who doesnt know about the plugin reads the script and thinks its a syntax error <?php-dot.com $obj.i = 5; ?> This is easy because most editors have code templates, so its easy to assign a shortcut to it. And whoever doesnt want the dot replacement, doesnt have to use it. These are NOT ultimate solutions, they are ONLY examples to show that solutions exist, and that arguments against replacing '->' with '.' are only excuses. (Just admit you like the arrow, its ok : ) With this potential method, nobody who doesnt want to use it would have to use it, and it wouldnt break old code. And if other problems (ahem... excuses) arise, they could be fixed too. So who can, and who will do such a thing ?

    Read the article

  • run shell command from java

    - by Aykut
    Hi, I am working on an application an have an issue about running shell command from java application. here is the code: public String execRuntime(String cmd) { Process proc = null; int inBuffer, errBuffer; int result = 0; StringBuffer outputReport = new StringBuffer(); StringBuffer errorBuffer = new StringBuffer(); try { proc = Runtime.getRuntime().exec(cmd); } catch (IOException e) { return ""; } try { response.status = 1; result = proc.waitFor(); } catch (InterruptedException e) { return ""; } if (proc != null && null != proc.getInputStream()) { InputStream is = proc.getInputStream(); InputStream es = proc.getErrorStream(); OutputStream os = proc.getOutputStream(); try { while ((inBuffer = is.read()) != -1) { outputReport.append((char) inBuffer); } while ((errBuffer = es.read()) != -1) { errorBuffer.append((char) errBuffer); } } catch (IOException e) { return ""; } try { is.close(); is = null; es.close(); es = null; os.close(); os = null; } catch (IOException e) { return ""; } proc.destroy(); proc = null; } if (errorBuffer.length() > 0) { logger .error("could not finish execution because of error(s)."); logger.error("*** Error : " + errorBuffer.toString()); return ""; } return outputReport.toString(); } but when i try to exec command like : /export/home/test/myapp -T "some argument" myapp reads "some argument" as two seperated arguments.but I want to read "some argument" as only a argument. when i directly run this command from terminal, it executed successfully. I tried '"some argument"' ,""some argument"" , "some\ argument" but did not work for me. how can i read this argument as one argument. Thnaks.

    Read the article

  • WinForm-style Invoke() in unmanaged C++

    - by Matt Green
    I've been playing with a DataBus-type design for a hobby project, and I ran into an issue. Back-end components need to notify the UI that something has happened. My implementation of the bus delivers the messages synchronously with respect to the sender. In other words, when you call Send(), the method blocks until all the handlers have called. (This allows callers to use stack memory management for event objects.) However, consider the case where an event handler updates the GUI in response to an event. If the handler is called, and the message sender lives on another thread, then the handler cannot update the GUI due to Win32's GUI elements having thread affinity. More dynamic platforms such as .NET allow you to handle this by calling a special Invoke() method to move the method call (and the arguments) to the UI thread. I'm guessing they use the .NET parking window or the like for these sorts of things. A morbid curiosity was born: can we do this in C++, even if we limit the scope of the problem? Can we make it nicer than existing solutions? I know Qt does something similar with the moveToThread() function. By nicer, I'll mention that I'm specifically trying to avoid code of the following form: if(! this->IsUIThread()) { Invoke(MainWindowPresenter::OnTracksAdded, e); return; } being at the top of every UI method. This dance was common in WinForms when dealing with this issue. I think this sort of concern should be isolated from the domain-specific code and a wrapper object made to deal with it. My implementation consists of: DeferredFunction - functor that stores the target method in a FastDelegate, and deep copies the single event argument. This is the object that is sent across thread boundaries. UIEventHandler - responsible for dispatching a single event from the bus. When the Execute() method is called, it checks the thread ID. If it does not match the UI thread ID (set at construction time), a DeferredFunction is allocated on the heap with the instance, method, and event argument. A pointer to it is sent to the UI thread via PostThreadMessage(). Finally, a hook function for the thread's message pump is used to call the DeferredFunction and de-allocate it. Alternatively, I can use a message loop filter, since my UI framework (WTL) supports them. Ultimately, is this a good idea? The whole message hooking thing makes me leery. The intent is certainly noble, but are there are any pitfalls I should know about? Or is there an easier way to do this?

    Read the article

  • Linker Issues with boost::thread under linux using Eclipse and CMake

    - by OcularProgrammer
    I'm in the process of attempting to port some code across from PC to Ubuntu, and am having some issues due to limited experience developing under linux. We use CMake to generate all our build stuff. Under windows I'm making VS2010 projects, and under Linux I'm making Eclipse projects. I've managed to get my OpenCV stuff ported across successfully, but am having major headaches trying to port my threaded boost apps. Just so we're clear, the steps I have followed so-far on a clean Ubuntu 12 installation. (I've done 2 clean re-installs to try and fix potential library cock-ups, now I'm just giving up and asking): Install Eclipse and Eclipse CDT using my package manager Install CMake and CMake Gui using my package manager Install libboost-all-dev using my package manager So-far that's all I've done. I can create the eclipse project using CMake with no errors, so CMake is successfully finding my boost install. When I try and build through eclipse is when I get issues; The app I'm attempting to build uses boost::asio for some UDP I/O and boost::thread to create worker threads for the asio I/O services. I can successfully compile each module, but when I come to link I get spammed with errors such as: /usr/bin/c++ CMakeFiles/RE05DevelopmentDemo.dir/main.cpp.o CMakeFiles/RE05DevelopmentDemo.dir/RE05FusionListener/RE05FusionListener.cpp.o CMakeFiles/RE05DevelopmentDemo.dir/NewEye/NewEye.cpp.o -o RE05DevelopmentDemo -rdynamic -Wl,-Bstatic -lboost_system-mt -lboost_date_time-mt -lboost_regex-mt -lboost_thread-mt -Wl,-Bdynamic /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `void boost::call_once<void (*)()>(boost::once_flag&, void (*)()) [clone .constprop.98]': make[2]: Leaving directory `/home/david/Code/Build/Support/RE05DevDemo' (.text+0xc8): undefined reference to `pthread_key_create' /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `boost::this_thread::interruption_enabled()': (.text+0x540): undefined reference to `pthread_getspecific' make[1]: Leaving directory `/home/david/Code/Build/Support/RE05DevDemo' /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `boost::this_thread::disable_interruption::disable_interruption()': (.text+0x570): undefined reference to `pthread_getspecific' /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `boost::this_thread::disable_interruption::disable_interruption()': (.text+0x59f): undefined reference to `pthread_getspecific' Some Gotchas that I have collected from other StackOverflow posts and have already checked: The boost libs are all present at /usr/lib I am not getting any compile errors for inability to find the boost headers, so they must be getting found. I am trying to link statically, but I believe eclipse should be passing the correct arguments to make that happen since my CMakeLists.txt includes SET(Boost_USE_STATIC_LIBS ON) I'm officially out of ideas here, I have tried doing local builds of boost and a bunch of other stuff with no more success. I even re-installed Ubuntu to ensure I haven't completely fracked the libs directories and links with multiple weird versions or anything else. Any help would be muchly appreciated.

    Read the article

< Previous Page | 301 302 303 304 305 306 307 308 309 310 311 312  | Next Page >