Search Results

Search found 8391 results on 336 pages for 'partial hash arguments'.

Page 305/336 | < Previous Page | 301 302 303 304 305 306 307 308 309 310 311 312  | Next Page >

  • MODX parse error function implode (is it me or modx?)

    - by Ian
    Hi, I cannot for the life of me figure this out, maybe someone can help. Using MODX a form takes user criteria to create a filter and return a list of documents. The form is one text field and a few checkboxes. If both text field and checkbox data is posted, the function works fine; if just the checkbox data is posted the function works fine; but if just the text field data is posted, modx gives me the following error: Error: implode() [function.implode]: Invalid arguments passed. I've tested this outside of modx with flat files and it all works fine leading me to assume a bug exists within modx. But I'm not convinced. Here's my code: <?php $order = array('price ASC'); //default sort order if(!empty($_POST['tour_finder_duration'])){ //duration submitted $days = htmlentities($_POST['tour_finder_duration']); //clean up post array_unshift($order,"duration DESC"); //add duration sort before default $filter[] = 'duration,'.$days.',4'; //add duration to filter[] (field,criterion,mode) $criteria[] = 'Number of days: <strong>'.$days.'</strong>'; //displayed on results page } if(!empty($_POST['tour_finder_dests'])){ //destination/s submitted $dests = $_POST['tour_finder_dests']; foreach($dests as $value){ //iterate through dests array $filter[] = 'searchDests,'.htmlentities($value).',7'; //add dests to filter[] $params['docid'] = $value; $params['field'] = 'pagetitle'; $pagetitle = $modx->runSnippet('GetField',$params); $dests_array[] = '<a href="[~'.$value.'~]" title="Read more about '.$pagetitle.'" class="tourdestlink">'.$pagetitle.'</a>'; } $dests_array = implode(', ',$dests_array); $criteria[] = 'Destinations: '.$dests_array; //displayed on results page } if(is_array($filter)){ $filter = implode('|',$filter);//pipe-separated string } if(is_array($order)){ $order = implode(',',$order);//comma-separated string } if(is_array($criteria)){ $criteria = implode('<br />',$criteria); } echo '<br />Order: '.$order.'<br /> Filter: '.$filter.'<br /> Criteria: '.$criteria; //next: extract docs using $filter and $order, display user's criteria using $criteria... ?> The echo statement is displayed above the MODX error message and the $filter array is correctly imploded. Any help will save my computer from flying out the window. Thanks

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to implement a caching model without violating MVC pattern?

    - by RPM1984
    Hi Guys, I have an ASP.NET MVC 3 (Razor) Web Application, with a particular page which is highly database intensive, and user experience is of the upmost priority. Thus, i am introducing caching on this particular page. I'm trying to figure out a way to implement this caching pattern whilst keeping my controller thin, like it currently is without caching: public PartialViewResult GetLocationStuff(SearchPreferences searchPreferences) { var results = _locationService.FindStuffByCriteria(searchPreferences); return PartialView("SearchResults", results); } As you can see, the controller is very thin, as it should be. It doesn't care about how/where it is getting it's info from - that is the job of the service. A couple of notes on the flow of control: Controllers get DI'ed a particular Service, depending on it's area. In this example, this controller get's a LocationService Services call through to an IQueryable<T> Repository and materialize results into T or ICollection<T>. How i want to implement caching: I can't use Output Caching - for a few reasons. First of all, this action method is invoked from the client-side (jQuery/AJAX), via [HttpPost], which according to HTTP standards should not be cached as a request. Secondly, i don't want to cache purely based on the HTTP request arguments - the cache logic is a lot more complicated than that - there is actually two-level caching going on. As i hint to above, i need to use regular data-caching, e.g Cache["somekey"] = someObj;. I don't want to implement a generic caching mechanism where all calls via the service go through the cache first - i only want caching on this particular action method. First thought's would tell me to create another service (which inherits LocationService), and provide the caching workflow there (check cache first, if not there call db, add to cache, return result). That has two problems: The services are basic Class Libraries - no references to anything extra. I would need to add a reference to System.Web here. I would have to access the HTTP Context outside of the web application, which is considered bad practice, not only for testability, but in general - right? I also thought about using the Models folder in the Web Application (which i currently use only for ViewModels), but having a cache service in a models folder just doesn't sound right. So - any ideas? Is there a MVC-specific thing (like Action Filter's, for example) i can use here? General advice/tips would be greatly appreciated.

    Read the article

  • In what circumstances are instance variables declared as '_var' in 'use fields' private?

    - by Pedro Silva
    I'm trying to understand the behavior of the fields pragma, which I find poorly documented, regarding fields prefixed with underscores. This is what the documentation has to say about it: Field names that start with an underscore character are made private to the class and are not visible to subclasses. Inherited fields can be overridden but will generate a warning if used together with the -w switch. This is not consistent with its actual behavior, according to my test, below. Not only are _-prefixed fields visible within a subclass, they are visible within foreign classes as well (unless I don't get what 'visible' means). Also, directly accessing the restricted hash works fine. Where can I find more about the behavior of the fields pragma, short of going at the source code? { package Foo; use strict; use warnings; use fields qw/a _b __c/; sub new { my ( $class ) = @_; my Foo $self = fields::new($class); $self->a = 1; $self->b = 2; $self->c = 3; return $self; } sub a : lvalue { shift->{a} } sub b : lvalue { shift->{_b} } sub c : lvalue { shift->{__c} } } { package Bar; use base 'Foo'; use strict; use warnings; use Data::Dumper; my $o = Bar->new; print Dumper $o; ##$VAR1 = bless({'_b' => 2, '__c' => 3, 'a' => 1}, 'Foo'); $o->a = 4; $o->b = 5; $o->c = 6; print Dumper $o; ##$VAR1 = bless({'_b' => 5, '__c' => 6, 'a' => 4}, 'Foo'); $o->{a} = 7; $o->{_b} = 8; $o->{__c} = 9; print Dumper $o; ##$VAR1 = bless({'_b' => 8, '__c' => 9, 'a' => 7}, 'Foo'); }

    Read the article

  • Displaying pic for user through a question's answer

    - by bgadoci
    Ok, I am trying to display the profile pic of a user. The application I have set up allows users to create questions and answers (I am calling answers 'sites' in the code) the view in which I am trying to do so is in the /views/questions/show.html.erb file. It might also be of note that I am using the Paperclip gem. Here is the set up: Associations Users class User < ActiveRecord::Base has_many :questions, :dependent => :destroy has_many :sites, :dependent => :destroy has_many :notes, :dependent => :destroy has_many :likes, :through => :sites , :dependent => :destroy has_many :pics, :dependent => :destroy has_many :likes, :dependent => :destroy end Questions class Question < ActiveRecord::Base has_many :sites, :dependent => :destroy has_many :notes, :dependent => :destroy has_many :likes, :dependent => :destroy belongs_to :user end Answers (sites) class Site < ActiveRecord::Base belongs_to :question belongs_to :user has_many :notes, :dependent => :destroy has_many :likes, :dependent => :destroy has_attached_file :photo, :styles => { :small => "250x250>" } end Pics class Pic < ActiveRecord::Base has_attached_file :profile_pic, :styles => { :small => "100x100" } belongs_to :user end The /views/questions/show.html.erb is rendering the partial /views/sites/_site.html.erb which is calling the Answer (site) with: <% div_for site do %> <%=h site.description %> <% end %> I have been trying to do things like: <%=image_tag site.user.pic.profile_pic.url(:small) %> <%=image_tag site.user.profile_pic.url(:small) %> etc. But that is obviously wrong. My error directs me to the Questions#show action so I am imagining that I need to define something in there but not sure what. Is is possible to call the pic given the current associations, placement of the call, and if so what Controller additions do I need to make, and what line of code will call the pic? UPDATE: Here is the QuestionsController#show code: def show @question = Question.find(params[:id]) @sites = @question.sites.all(:select => "sites.*, SUM(likes.like) as like_total", :joins => "LEFT JOIN likes AS likes ON likes.site_id = sites.id", :group => "sites.id", :order => "like_total DESC") respond_to do |format| format.html # show.html.erb format.xml { render :xml => @question } end end

    Read the article

  • C++ using cdb_read returns extra characters on some reads

    - by Moe Be
    Hi All, I am using the following function to loop through a couple of open CDB hash tables. Sometimes the value for a given key is returned along with an additional character (specifically a CTRL-P (a DLE character/0x16/0o020)). I have checked the cdb key/value pairs with a couple of different utilities and none of them show any additional characters appended to the values. I get the character if I use cdb_read() or cdb_getdata() (the commented out code below). If I had to guess I would say I am doing something wrong with the buffer I create to get the result from the cdb functions. Any advice or assistance is greatly appreciated. char* HashReducer::getValueFromDb(const string &id, vector <struct cdb *> &myHashFiles) { unsigned char hex_value[BUFSIZ]; size_t hex_len; //construct a real hex (not ascii-hex) value to use for database lookups atoh(id,hex_value,&hex_len); char *value = NULL; vector <struct cdb *>::iterator my_iter = myHashFiles.begin(); vector <struct cdb *>::iterator my_end = myHashFiles.end(); try { //while there are more databases to search and we have not found a match for(; my_iter != my_end && !value ; my_iter++) { //cerr << "\n looking for this MD5:" << id << " hex(" << hex_value << ") \n"; if (cdb_find(*my_iter, hex_value, hex_len)){ //cerr << "\n\nI found the key " << id << " and it is " << cdb_datalen(*my_iter) << " long\n\n"; value = (char *)malloc(cdb_datalen(*my_iter)); cdb_read(*my_iter,value,cdb_datalen(*my_iter),cdb_datapos(*my_iter)); //value = (char *)cdb_getdata(*my_iter); //cerr << "\n\nThe value is:" << value << " len is:" << strlen(value)<< "\n\n"; }; } } catch (...){} return value; }

    Read the article

  • WinForm-style Invoke() in unmanaged C++

    - by Matt Green
    I've been playing with a DataBus-type design for a hobby project, and I ran into an issue. Back-end components need to notify the UI that something has happened. My implementation of the bus delivers the messages synchronously with respect to the sender. In other words, when you call Send(), the method blocks until all the handlers have called. (This allows callers to use stack memory management for event objects.) However, consider the case where an event handler updates the GUI in response to an event. If the handler is called, and the message sender lives on another thread, then the handler cannot update the GUI due to Win32's GUI elements having thread affinity. More dynamic platforms such as .NET allow you to handle this by calling a special Invoke() method to move the method call (and the arguments) to the UI thread. I'm guessing they use the .NET parking window or the like for these sorts of things. A morbid curiosity was born: can we do this in C++, even if we limit the scope of the problem? Can we make it nicer than existing solutions? I know Qt does something similar with the moveToThread() function. By nicer, I'll mention that I'm specifically trying to avoid code of the following form: if(! this->IsUIThread()) { Invoke(MainWindowPresenter::OnTracksAdded, e); return; } being at the top of every UI method. This dance was common in WinForms when dealing with this issue. I think this sort of concern should be isolated from the domain-specific code and a wrapper object made to deal with it. My implementation consists of: DeferredFunction - functor that stores the target method in a FastDelegate, and deep copies the single event argument. This is the object that is sent across thread boundaries. UIEventHandler - responsible for dispatching a single event from the bus. When the Execute() method is called, it checks the thread ID. If it does not match the UI thread ID (set at construction time), a DeferredFunction is allocated on the heap with the instance, method, and event argument. A pointer to it is sent to the UI thread via PostThreadMessage(). Finally, a hook function for the thread's message pump is used to call the DeferredFunction and de-allocate it. Alternatively, I can use a message loop filter, since my UI framework (WTL) supports them. Ultimately, is this a good idea? The whole message hooking thing makes me leery. The intent is certainly noble, but are there are any pitfalls I should know about? Or is there an easier way to do this?

    Read the article

  • Rails, Edit page update in a window

    - by Mike
    I have my code working so that I have a table of businesses. There's a pencil icon you can click on the edit the business information. The edit information comes up in a partial inside of a modal pop up box. The only problem is that once they make the changes they want and click update, it sends them to the 'show' page for that business. What I want to happen is have the pop up box close and have it update the information. This is my update function in my controller. def update @business = Business.find(params[:id]) respond_to do |format| if @business.update_attributes(params[:business]) flash[:notice] = 'Business was successfully updated.' format.html { redirect_to(business_url(@business)) } format.js else format.html { render :action => "edit" } format.xml { render :xml => @business.errors, :status => :unprocessable_entity } end end end I tried following railscast 43 and i created an .rjs file but I couldn't get that to work at all. My update was still taking me to the show page. Any help would be appreciated. EDIT: Added some more code. <% form_for(@business) do |f| %> <%= f.error_messages %> <p> <%= f.label :name %><br /> <%= f.text_field :name %> </p> ... <%= f.label :business_category %><br /> <%= f.select :business_category_id, @business_categories_map, :selected => @business.business_category_id %> </p> <p> <%= f.label :description %><br /> <%= f.text_area :description %> </p> <p> <%= f.submit 'Update' %> </p> <% end %> This is my form inside of my edit page which is being called through the index in a pop up by: <div id="popupEdit<%=h business.id %>" class="popupContact"> <a class="popupClose<%=h business.id %>" id="popupClose">x</a> <% if business.business_category_id %> <% @business = business %> <%= render "business/edit" %> <% end %> </div>

    Read the article

  • Solving a cyclical dependency in Ninject (Compact Framework)

    - by Alex
    I'm trying to use Ninject for dependency injection in my MVP application. However, I have a problem because I have two types that depend on each other, thus creating a cyclic dependency. At first, I understand that it was a problem, because I had both types require each other in their constructors. Therefore, I moved one of the dependencies to a property injection instead, but I'm still getting the error message. What am I doing wrong? This is the presenter: public class LoginPresenter : Presenter<ILoginView>, ILoginPresenter { public LoginPresenter( ILoginView view ) : base( view ) { } } and this is the view: public partial class LoginForm : Form, ILoginView { [Inject] public ILoginPresenter Presenter { private get; set; } public LoginForm() { InitializeComponent(); } } And here's the code that causes the exception: static class Program { /// <summary> /// The main entry point for the application. /// </summary> [MTAThread] static void Main() { // Show the login form Views.LoginForm loginForm = Kernel.Get<Views.Interfaces.ILoginView>() as Views.LoginForm; Application.Run( loginForm ); } } The exception happens on the line with the Kernel.Get<>() call. Here it is: Error activating ILoginPresenter using binding from ILoginPresenter to LoginPresenter A cyclical dependency was detected between the constructors of two services. Activation path: 4) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 3) Injection of dependency ILoginView into parameter view of constructor of type LoginPresenter 2) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 1) Request for ILoginView Suggestions: 1) Ensure that you have not declared a dependency for ILoginPresenter on any implementations of the service. 2) Consider combining the services into a single one to remove the cycle. 3) Use property injection instead of constructor injection, and implement IInitializable if you need initialization logic to be run after property values have been injected. Why doesn't Ninject understand that since one is constructor injection and the other is property injection, this can work just fine? I even read somewhere looking for the solution to this problem that Ninject supposedly gets this right as long as the cyclic dependency isn't both in the constructors. Apparently not, though. Any help resolving this would be much appreciated.

    Read the article

  • WPF data templates

    - by imekon
    I'm getting started with WPF and trying to get my head around connecting data to the UI. I've managed to connect to a class without any issues, but what I really want to do is connect to a property of the main window. Here's the XAML: <Window x:Class="test3.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:custom="clr-namespace:test3" Title="MainWindow" Height="350" Width="525"> <Window.Resources> <CollectionViewSource Source="{Binding Source={x:Static Application.Current}, Path=Platforms}" x:Key="platforms"/> <DataTemplate DataType="{x:Type custom:Platform}"> <StackPanel> <CheckBox IsChecked="{Binding Path=Selected}"/> <TextBlock Text="{Binding Path=Name}"/> </StackPanel> </DataTemplate> </Window.Resources> <Grid> <ListBox ItemsSource="{Binding Source={StaticResource platforms}}"/> </Grid> Here's the code for the main window: public partial class MainWindow : Window { ObservableCollection<Platform> m_platforms; public MainWindow() { m_platforms = new ObservableCollection<Platform>(); m_platforms.Add(new Platform("PC")); InitializeComponent(); } public ObservableCollection<Platform> Platforms { get { return m_platforms; } set { m_platforms = value; } } } Here's the Platform class: public class Platform { private string m_name; private bool m_selected; public Platform(string name) { m_name = name; m_selected = false; } public string Name { get { return m_name; } set { m_name = value; } } public bool Selected { get { return m_selected; } set { m_selected = value; } } } This all compiles and runs fine but the list box displays with nothing in it. If I put a breakpoint on the get method of Platforms, it doesn't get called. I don't understand as Platforms is what the XAML should be connecting to!

    Read the article

  • R: Plotting a graph with different colors of points based on advanced criteria

    - by balconydoor
    What I would like to do is a plot (using ggplot), where the x axis represent years which have a different colour for the last three years in the plot than the rest. The last three years should also meet a certain criteria and based on this the last three years can either be red or green. The criteria is that the mean of the last three years should be less (making it green) or more (making it red) than the 66%-percentile of the remaining years. So far I have made two different functions calculating the last three year mean: LYM3 <- function (x) { LYM3 <- tail(x,3) mean(LYM3$Data,na.rm=T) } And the 66%-percentile for the remaining: perc66 <- function(x) { percentile <- head(x,-3) quantile(percentile$Data, .66, names=F,na.rm=T) } Here are two sets of data that can be used in the calculations (plots), the first which is an example from my real data where LYM3(df1) < perc66(df1) and the second is just made up data where LYM3 perc66. df1<- data.frame(Year=c(1979:2010), Data=c(347261.87, 145071.29, 110181.93, 183016.71, 210995.67, 205207.33, 103291.78, 247182.10, 152894.45, 170771.50, 206534.55, 287770.86, 223832.43, 297542.86, 267343.54, 475485.47, 224575.08, 147607.81, 171732.38, 126818.10, 165801.08, 136921.58, 136947.63, 83428.05, 144295.87, 68566.23, 59943.05, 49909.08, 52149.11, 117627.75, 132127.79, 130463.80)) df2 <- data.frame(Year=c(1979:2010), Data=c(sample(50,29,replace=T),75,75,75)) Here’s my code for my plot so far: plot <- ggplot(df1, aes(x=Year, y=Data)) + theme_bw() + geom_point(size=3, aes(colour=ifelse(df1$Year<2008, "black",ifelse(LYM3(df1) < perc66(df1),"green","red")))) + geom_line() + scale_x_continuous(breaks=c(1980,1985,1990,1995,2000,2005,2010), limits=c(1978,2011)) plot As you notice it doesn’t really do what I want it to do. The only thing it does seem to do is that it turns the years before 2008 into one level and those after into another one and base the point colour off these two levels. Since I don’t want this year to be stationary either, I made another tiny function: fun3 <- function(x) { df <- subset(x, Year==(max(Year)-2)) df$Year } So the previous code would have the same effect as: geom_point(size=3, aes(colour=ifelse(df1$Year<fun3(df1), "black","red"))) But it still does not care about my colours. Why does it make the years into levels? And how come an ifelse function doesn’t work within another one in this case? How would it be possible to the arguments to do what I like? I realise this might be a bit messy, asking for a lot at the same time, but I hope my description is pretty clear. It would be helpful if someone could at least point me in the right direction. I tried to put the code for the plot into a function as well so I wouldn’t have to change the data frame at all functions within the plot, but I can’t get it to work. Thank you!

    Read the article

  • How to created filtered reports in WPF?

    - by Michael Goyote
    Creating reports in WPF. I have two related tables. Table A-Customer: CustomerID(PK) Names Phone Number Customer Num Table B-Items: Products Price CustomerID I want to be able to generate a report like this: CustomerA Items Price Item A 10 Item B 10 Item C 10 --------------- Total 30 So this is what I have done: <Window x:Class="ReportViewerWPF.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:rv="clr-namespace:Microsoft.Reporting.WinForms; assembly=Microsoft.ReportViewer.WinForms" Title="Customer Report" Height="300" Width="400"> <Grid> <WindowsFormsHost Name="windowsFormsHost1"> <rv:ReportViewer x:Name="reportViewer1"/> </WindowsFormsHost> </Grid> Then I created a dataset and loaded the two tables, followed by a report wizard (dragged all the available fields and dropped them to the Values pane). The code behind the WPF window is this: public partial class CustomerReport : Window { public CustomerReport() { InitializeComponent(); _reportViewer.Load += ReportViewer_Load; } private bool _isReportViewerLoaded; private void ReportViewer_Load(object sender, EventArgs e) { if (!_isReportViewerLoaded) { Microsoft.Reporting.WinForms.ReportDataSource reportDataSource1 = new Microsoft.Reporting.WinForms.ReportDataSource(); HM2DataSet dataset = new HM2DataSet(); dataset.BeginInit(); reportDataSource1.Name = "DataSet";//This is the dataset name reportDataSource1.Value = dataset.CustomerTable; this.reportViewer1.LocalReport.DataSources.Add(reportDataSource1); this.reportViewer1.LocalReport.ReportPath = "../../Report3.rdlc"; dataset.EndInit(); HM2DataSetTableAdapters.CustomerTableAdapter funcTableAdapter = new HM2DataSetTableAdapters.CustomerTableAdapter(); funcTableAdapter.ClearBeforeFill = true; funcTableAdapter.Fill(dataset.CustomerTable); _reportViewer.RefreshReport(); _isReportViewerLoaded = true; } } As you might have guessed this loaded this list of customer with items and price: Customer Items Price Customer A Items A 10 Customer A Items B 10 Customer B Items D 10 Customer B Items C 10 How can I fine-tune this report to look like the one above, where the user can filter the customer he wants displayed on the report? Thanks in advance for the help. I would have preferred to use LINQ whenever filtering data

    Read the article

  • Php plugin to replace '->' with '.' as the member access operator ? Or even better: alternative synt

    - by Gigi
    Present day usable solution: Note that if you use an ide or an advanced editor, you could make a code template, or record a macro that inserts '->' when you press Ctrl and '.' or something. Netbeans has macros, and I have recorded a macro for this, and I like it a lot :) (just click the red circle toolbar button (start record macro),then type -> into the editor (thats all the macro will do, insert the arrow into the editor), then click the gray square (stop record macro) and assign the 'Ctrl dot' shortcut to it, or whatever shortcut you like) The php plugin: The php plugin, would also have to have a different string concatenation operator than the dot. Maybe a double dot ? Yea... why not. All it has to do is set an activation tag so that it doesnt replace / interpreter '.' as '->' for old scripts and scripts that dont intent do use this. Something like this: <php+ $obj.i = 5 ?> (notice the modified '<?php' tag to '<?php+' ) This way it wouldnt break old code. (and you can just add the '<?php+' code template to your editor and then type 'php tab' (for netbeans) and it would insert '<?php+' ) With the alternative syntax method you could even have old and new syntax cohabitating on the same page like this (I am illustrating this to show the great compatibility of this method, not because you would want to do this): <?php+ $obj.i = 5; ?> <?php $obj->str = 'a' . 'b'; ?> You could change the tag to something more explanatory, in case somebody who doesnt know about the plugin reads the script and thinks its a syntax error <?php-dot.com $obj.i = 5; ?> This is easy because most editors have code templates, so its easy to assign a shortcut to it. And whoever doesnt want the dot replacement, doesnt have to use it. These are NOT ultimate solutions, they are ONLY examples to show that solutions exist, and that arguments against replacing '->' with '.' are only excuses. (Just admit you like the arrow, its ok : ) With this potential method, nobody who doesnt want to use it would have to use it, and it wouldnt break old code. And if other problems (ahem... excuses) arise, they could be fixed too. So who can, and who will do such a thing ?

    Read the article

  • Why doesn't TextBlock databinding call ToString() on a property whose compile-time type is an interf

    - by Jay
    This started with weird behaviour that I thought was tied to my implementation of ToString(), and I asked this question: http://stackoverflow.com/questions/2916068/why-wont-wpf-databindings-show-text-when-tostring-has-a-collaborating-object It turns out to have nothing to do with collaborators and is reproducible. When I bind Label.Content to a property of the DataContext that is declared as an interface type, ToString() is called on the runtime object and the label displays the result. When I bind TextBlock.Text to the same property, ToString() is never called and nothing is displayed. But, if I change the declared property to a concrete implementation of the interface, it works as expected. Is this somehow by design? If so, any idea why? To reproduce: Create a new WPF Application (.NET 3.5 SP1) Add the following classes: public interface IFoo { string foo_part1 { get; set; } string foo_part2 { get; set; } } public class Foo : IFoo { public string foo_part1 { get; set; } public string foo_part2 { get; set; } public override string ToString() { return foo_part1 + " - " + foo_part2; } } public class Bar { public IFoo foo { get { return new Foo {foo_part1 = "first", foo_part2 = "second"}; } } } Set the XAML of Window1 to: <Window x:Class="WpfApplication1.Window1" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" Title="Window1" Height="300" Width="300"> <StackPanel> <Label Content="{Binding foo, Mode=Default}"/> <TextBlock Text="{Binding foo, Mode=Default}"/> </StackPanel> </Window> in Window1.xaml.cs: public partial class Window1 : Window { public Window1() { InitializeComponent(); DataContext = new Bar(); } } When you run this application, you'll see the text only once (at the top, in the label). If you change the type of foo property on Bar class to Foo (instead of IFoo) and run the application again, you'll see the text in both controls.

    Read the article

  • MouseWheel Event Fire

    - by Rahat
    I have a problem on calling my private method on MouseWheel event. In fact my mouse wheel event gets fired properly when i only increment a variable or display something in Title bar etc. But when i want to call a private method, that method gets called only one time which is not the requirement i want to call that method depending on the speed of scroll i.e. when scroll is done one time slowly call the private method one time but when the scroll is done in high speed call the private method more than one time depending on the scroll speed. For further explanation i am placing the sample code which displays the value of i in Title bar and add it in the Listbox control properly depending on the scroll speed but when i want to call the private method more than one time depending upon the scroll speed, that method gets called only one time. public partial class Form1 : Form { ListBox listBox1 = new ListBox(); int i = 0; public Form1() { InitializeComponent(); // Settnig ListBox control properties this.listBox1.Anchor = ((System.Windows.Forms.AnchorStyles)((((System.Windows.Forms.AnchorStyles.Top | System.Windows.Forms.AnchorStyles.Bottom) | System.Windows.Forms.AnchorStyles.Left) | System.Windows.Forms.AnchorStyles.Right))); this.listBox1.FormattingEnabled = true; this.listBox1.Location = new System.Drawing.Point(13, 13); this.listBox1.Name = "listBox1"; this.listBox1.Size = new System.Drawing.Size(259, 264); this.listBox1.TabIndex = 0; // Attaching Mouse Wheel Event this.listBox1.MouseWheel += new MouseEventHandler(Form1_MouseWheel); // Adding Control this.Controls.Add(this.listBox1); } void Form1_MouseWheel(object sender, MouseEventArgs e) { i++; this.Text = i.ToString(); this.listBox1.Items.Add(i.ToString()); // Uncomment the following line to call the private method // this method gets called only one time irrelevant of the // mouse wheel scroll speed. // this.LaunchThisEvent(); } private void Form1_Load(object sender, EventArgs e) { this.listBox1.Select(); } private void LaunchThisEvent() { // Display message each time // this method gets called. MessageBox.Show(i.ToString()); } } How to call the private method more than one time depending upon the speed of the mouse wheel scroll?

    Read the article

  • Delphi - Read File To StringList, then delete and write back to file.

    - by Jkraw90
    I'm currently working on a program to generate the hashes of files, in Delphi 2010. As part of this I have a option to create User Presets, e.g. pre-defined choice of hashing algo's which the user can create/save/delete. I have the create and load code working fine. It uses a ComboBox and loads from a file "fhpre.ini", inside this file is the users presets stored in format of:- PresetName PresetCode (a 12 digit string using 0 for don't hash and 1 for do) On application loading it loads the data from this file into the ComboBox and an Array with the ItemIndex of ComboBox matching the corrisponding correct string of 0's and 1's in the Array. Now I need to implement a feature to have the user delete a preset from the list. So far my code is as follows, procedure TForm1.Panel23Click(Sender : TObject); var fil : textfile; contents : TStringList; x,i : integer; filline : ansistring; filestream : TFileStream; begin //Start Procedure //Load data into StringList contents := TStringList.Create; fileStream := TFileStream.Create((GetAppData+'\RFA\fhpre.ini'), fmShareDenyNone); Contents.LoadFromStream(fileStream); fileStream.Destroy(); //Search for relevant Preset i := 0; if ComboBox4.Text <> Contents[i] then begin Repeat i := i + 1; Until ComboBox4.Text = Contents[i]; end; contents.Delete(i); //Delete Relevant Preset Name contents.Delete(i); //Delete Preset Digit String //Write StringList back to file. AssignFile(fil,(GetAppData+'\RFA\fhpre.ini')); ReWrite(fil); for i := 0 to Contents.Count -1 do WriteLn(Contents[i]); CloseFile(fil); Contents.Free; end; However if this is run, I get a 105 error when it gets to the WriteLn section. I'm aware that the code isn't great, for example doesn't have checks for presets with same name, but that will come, I want to get the base code working first then can tweak and add extra checks etc. Any help would be appreciated.

    Read the article

  • how to update only the updated rows in gridview?

    - by user603007
    what is the handiest way to update only the updated rows (only the checkbox column) in this gridview? what is a handy way to check wether the row was updated? c# public partial class _Default : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { List<customer> listCustomer = new List<customer>(); customer cust1 = new customer(){name="fred",email="[email protected]",jobless="true"}; customer cust2 = new customer(){name="mark",email="[email protected]",jobless="false"}; listCustomer.Add(cust1); listCustomer.Add(cust2); GridView1.DataSource=listCustomer; GridView1.DataBind(); } } protected void btnUpdate_Click1(object sender, EventArgs e) { foreach (GridViewRow rw in GridView1.Rows) { CheckBox thiscontrol = (CheckBox)rw.Cells[0].FindControl("cb"); var ch = thiscontrol.Checked; //only update the updated rows? } } public class customer { public string name { get; set; } public string email { get; set; } public string jobless { get; set; } } html <%@ Page Language="C#" AutoEventWireup="true" CodeBehind="Default.aspx.cs" Inherits="gridviewUpdate._Default" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head runat="server"> <title></title> </head> <body> <form id="form1" runat="server"> <div> <asp:GridView ID="GridView1" AutoGenerateColumns="false" runat="server"> <Columns> <asp:TemplateField> <ItemTemplate> <asp:CheckBox ID="jobless" runat="server" Checked='<%# Eval("jobless").ToString().Equals("true") %>' /> </ItemTemplate> </asp:TemplateField> <asp:BoundField DataField="email" /> <asp:BoundField DataField="name" /> </Columns> </asp:GridView> </div>

    Read the article

  • Question about InputMismatchException while using Scanner

    - by aser
    The question : Input file: customer’s account number, account balance at beginning of month, transaction type (withdrawal, deposit, interest), transaction amount Output: account number, beginning balance, ending balance, total interest paid, total amount deposited, number of deposits, total amount withdrawn, number of withdrawals package sentinel; import java.io.*; import java.util.*; public class Ex7 { /** * @param args the command line arguments */ public static void main(String[] args) throws FileNotFoundException { int AccountNum; double BeginningBalance; double TransactionAmount; int TransactionType; double AmountDeposited=0; int NumberOfDeposits=0; double InterestPaid=0.0; double AmountWithdrawn=0.0; int NumberOfWithdrawals=0; boolean found= false; Scanner inFile = new Scanner(new FileReader("Account.in")); PrintWriter outFile = new PrintWriter("Account.out"); AccountNum = inFile.nextInt(); BeginningBalance= inFile.nextDouble(); while (inFile.hasNext()) { TransactionAmount=inFile.nextDouble(); TransactionType=inFile.nextInt(); outFile.printf("Account Number: %d%n", AccountNum); outFile.printf("Beginning Balance: $%.2f %n",BeginningBalance); outFile.printf("Ending Balance: $%.2f %n",BeginningBalance); outFile.println(); switch (TransactionType) { case '1': // case 1 if we have a Deposite BeginningBalance = BeginningBalance + TransactionAmount; AmountDeposited = AmountDeposited + TransactionAmount; NumberOfDeposits++; outFile.printf("Amount Deposited: $%.2f %n",AmountDeposited); outFile.printf("Number of Deposits: %d%n",NumberOfDeposits); outFile.println(); break; case '2':// case 2 if we have an Interest BeginningBalance = BeginningBalance + TransactionAmount; InterestPaid = InterestPaid + TransactionAmount; outFile.printf("Interest Paid: $%.2f %n",InterestPaid); outFile.println(); break; case '3':// case 3 if we have a Withdraw BeginningBalance = BeginningBalance - TransactionAmount; AmountWithdrawn = AmountWithdrawn + TransactionAmount; NumberOfWithdrawals++; outFile.printf("Amount Withdrawn: $%.2f %n",AmountWithdrawn); outFile.printf("Number of Withdrawals: %d%n",NumberOfWithdrawals); outFile.println(); break; default: System.out.println("Invalid transaction Tybe: " + TransactionType + TransactionAmount); } } inFile.close(); outFile.close(); } } But is gives me this : Exception in thread "main" java.util.InputMismatchException at java.util.Scanner.throwFor(Scanner.java:840) at java.util.Scanner.next(Scanner.java:1461) at java.util.Scanner.nextInt(Scanner.java:2091) at java.util.Scanner.nextInt(Scanner.java:2050) at sentinel.Ex7.main(Ex7.java:36) Java Result: 1

    Read the article

  • C#/.NET Project - Am I setting things up correctly?

    - by JustLooking
    1st solution located: \Common\Controls\Controls.sln and its project: \Common\Controls\Common.Controls\Common.Controls.csproj Description: This is a library that contains this class: public abstract class OurUserControl : UserControl { // Variables and other getters/setters common to our UserControls } 2nd solution located: \AControl\AControl.sln and its project: \AControl\AControl\AControl.csproj Description: Of the many forms/classes, it will contain this class: using Common.Controls; namespace AControl { public partial class AControl : OurUserControl { // The implementation } } A note about adding references (not sure if this is relevant): When I add references (for projects I create), using the names above: 1. I add Common.Controls.csproj to AControl.sln 2. In AControl.sln I turn off the build of Common.Controls.csproj 3. I add the reference to Common.Controls (by project) to AControl.csproj. This is the (easiest) way I know how to get Debug versions to match Debug References, and Release versions to match Release References. Now, here is where the issue lies (the 3rd solution/project that actually utilizes the UserControl): 3rd solution located: \MainProj\MainProj.sln and its project: \MainProj\MainProj\MainProj.csproj Description: Here's a sample function in one of the classes: private void TestMethod<T>() where T : Common.Controls.OurUserControl, new() { T TheObject = new T(); TheObject.OneOfTheSetters = something; TheObject.AnotherOfTheSetters = something_else; // Do stuff with the object } We might call this function like so: private void AnotherMethod() { TestMethod<AControl.AControl>(); } This builds, runs, and works. No problem. The odd thing is after I close the project/solution and re-open it, I have red squigglies everywhere. I bring up my error list and I see tons of errors (anything that deals with AControl will be noted as an error). I'll see errors such as: The type 'AControl.AControl' cannot be used as type parameter 'T' in the generic type or method 'MainProj.MainClass.TestMethod()'. There is no implicit reference conversion from 'AControl.AControl' to 'Common.Controls.OurUserControl'. or inside the actual method (the properties located in the abstract class): 'AControl.AControl' does not contain a definition for 'OneOfTheSetters' and no extension method 'OneOfTheSetters' accepting a first argument of type 'AControl.AControl' could be found (are you missing a using directive or an assembly reference?) Meanwhile, I can still build and run the project (then the red squigglies go away until I re-open the project, or close/re-open the file). It seems to me that I might be setting up the projects incorrectly. Thoughts?

    Read the article

  • Java replacement for C macros

    - by thkala
    Recently I refactored the code of a 3rd party hash function from C++ to C. The process was relatively painless, with only a few changes of note. Now I want to write the same function in Java and I came upon a slight issue. In the C/C++ code there is a C preprocessor macro that takes a few integer variables names as arguments and performs a bunch of bitwise operations with their contents and a few constants. That macro is used in several different places, therefore its presence avoids a fair bit of code duplication. In Java, however, there is no equivalent for the C preprocessor. There is also no way to affect any basic type passed as an argument to a method - even autoboxing produces immutable objects. Coupled with the fact that Java methods return a single value, I can't seem to find a simple way to rewrite the macro. Avenues that I considered: Expand the macro by hand everywhere: It would work, but the code duplication could make things interesting in the long run. Write a method that returns an array: This would also work, but it would repeatedly result into code like this: long tmp[] = bitops(k, l, m, x, y, z); k = tmp[0]; l = tmp[1]; m = tmp[2]; x = tmp[3]; y = tmp[4]; z = tmp[5]; Write a method that takes an array as an argument: This would mean that all variable names would be reduced to array element references - it would be rather hard to keep track of which index corresponds to which variable. Create a separate class e.g. State with public fields of the appropriate type and use that as an argument to a method: This is my current solution. It allows the method to alter the variables, while still keeping their names. It has the disadvantage, however, that the State class will get more and more complex, as more macros and variables are added, in order to avoid copying values back and forth among different State objects. How would you rewrite such a C macro in Java? Is there a more appropriate way to deal with this, using the facilities provided by the standard Java 6 Development Kit (i.e. without 3rd party libraries or a separate preprocessor)?

    Read the article

  • How to use a LinkButton inside gridview to delete selected username in the code-behind file?

    - by jenifer
    I have a "UserDetail" table in my "JobPost.mdf". I have a "Gridview1" showing the column from "UserDetail" table,which has a primary key "UserName". This "UserName" is originally saved using Membership class function. Now I add a "Delete" linkbutton to the GridView1. This "Delete" is not autogenerate button,I dragged inside the column itemtemplate from ToolBox. The GridView1's columns now become "Delete_LinkButton"+"UserName"(within the UserDetail table)+"City"(within the UserDetail table)+"IsAdmin"(within the UserDetail table) What I need is that by clicking this "delete_linkButton",it will ONLY delete the entire User Entity on the same row (link by the corresponding "UserName") from the "UserDetail" table,as well as delete all information from the AspNetDB.mdf (User,Membership,UserInRole,etc). I would like to fireup a user confirm,but not mandatory. At least I am trying to make it functional in the correct way. for example: Command UserName City IsAdmin delete ken Los Angles TRUE delete jim Toronto FALSE When I click "delete" on the first row, I need all the record about "ken" inside the "UserDetail" table to be removed. Meanwhile, all the record about "ken" in the AspNetDB.mdf will be gone, including UserinRole table. I am new to asp.net, so I don't know how to pass the commandargument of the "Delete_LinkButton" to the code-behind file LinkButton1_Click(object sender, EventArgs e), because I need one extra parameter "UserName". My partial code is listed below: <asp:TemplateField> <ItemTemplate> <asp:LinkButton ID="Delete_LinkButton" runat="server" onclick="LinkButton1_Click1" CommandArgument='<%# Eval("UserName","{0}") %>'>LinkButton</asp:LinkButton> </ItemTemplate> </asp:TemplateField> protected void Delete_LinkButton_Click(object sender, EventArgs e) { ((LinkButton) GridView1.FindControl("Delete_LinkButton")).Attributes.Add("onclick", "'return confirm('Are you sure you want to delete {0} '" + UserName); Membership.DeleteUser(UserName); JobPostDataContext db = new JobPostDataContext(); var query = from u in db.UserDetails where u.UserName == UserName select u; for (var Item in query) { db.UserDetails.DeleteOnSubmit(Item); } db.SubmitChanges(); } Please do help! Thanks in advance.

    Read the article

  • Linker Issues with boost::thread under linux using Eclipse and CMake

    - by OcularProgrammer
    I'm in the process of attempting to port some code across from PC to Ubuntu, and am having some issues due to limited experience developing under linux. We use CMake to generate all our build stuff. Under windows I'm making VS2010 projects, and under Linux I'm making Eclipse projects. I've managed to get my OpenCV stuff ported across successfully, but am having major headaches trying to port my threaded boost apps. Just so we're clear, the steps I have followed so-far on a clean Ubuntu 12 installation. (I've done 2 clean re-installs to try and fix potential library cock-ups, now I'm just giving up and asking): Install Eclipse and Eclipse CDT using my package manager Install CMake and CMake Gui using my package manager Install libboost-all-dev using my package manager So-far that's all I've done. I can create the eclipse project using CMake with no errors, so CMake is successfully finding my boost install. When I try and build through eclipse is when I get issues; The app I'm attempting to build uses boost::asio for some UDP I/O and boost::thread to create worker threads for the asio I/O services. I can successfully compile each module, but when I come to link I get spammed with errors such as: /usr/bin/c++ CMakeFiles/RE05DevelopmentDemo.dir/main.cpp.o CMakeFiles/RE05DevelopmentDemo.dir/RE05FusionListener/RE05FusionListener.cpp.o CMakeFiles/RE05DevelopmentDemo.dir/NewEye/NewEye.cpp.o -o RE05DevelopmentDemo -rdynamic -Wl,-Bstatic -lboost_system-mt -lboost_date_time-mt -lboost_regex-mt -lboost_thread-mt -Wl,-Bdynamic /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `void boost::call_once<void (*)()>(boost::once_flag&, void (*)()) [clone .constprop.98]': make[2]: Leaving directory `/home/david/Code/Build/Support/RE05DevDemo' (.text+0xc8): undefined reference to `pthread_key_create' /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `boost::this_thread::interruption_enabled()': (.text+0x540): undefined reference to `pthread_getspecific' make[1]: Leaving directory `/home/david/Code/Build/Support/RE05DevDemo' /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `boost::this_thread::disable_interruption::disable_interruption()': (.text+0x570): undefined reference to `pthread_getspecific' /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `boost::this_thread::disable_interruption::disable_interruption()': (.text+0x59f): undefined reference to `pthread_getspecific' Some Gotchas that I have collected from other StackOverflow posts and have already checked: The boost libs are all present at /usr/lib I am not getting any compile errors for inability to find the boost headers, so they must be getting found. I am trying to link statically, but I believe eclipse should be passing the correct arguments to make that happen since my CMakeLists.txt includes SET(Boost_USE_STATIC_LIBS ON) I'm officially out of ideas here, I have tried doing local builds of boost and a bunch of other stuff with no more success. I even re-installed Ubuntu to ensure I haven't completely fracked the libs directories and links with multiple weird versions or anything else. Any help would be muchly appreciated.

    Read the article

  • In what circumstances are instance variables declared as '_var' in 'use fields' readonly?

    - by Pedro Silva
    I'm trying to understand the behavior of the fields pragma, which I find poorly documented, regarding fields prefixed with underscores. This is what the documentation has to say about it: Field names that start with an underscore character are made private to the class and are not visible to subclasses. Inherited fields can be overridden but will generate a warning if used together with the -w switch. This is not consistent with its actual behavior, according to my test, below. Not only are _-prefixed fields visible within a subclass, they are visible within foreign classes as well (unless I don't get what 'visible' means). Also, directly accessing the restricted hash works fine. Where can I find more about the behavior of the fields pragma, short of going at the source code? { package Foo; use strict; use warnings; use fields qw/a _b __c/; sub new { my ( $class ) = @_; my Foo $self = fields::new($class); $self->a = 1; $self->b = 2; $self->c = 3; return $self; } sub a : lvalue { shift->{a} } sub b : lvalue { shift->{_b} } sub c : lvalue { shift->{__c} } } { package Bar; use base 'Foo'; use strict; use warnings; use Data::Dumper; my $o = Bar->new; print Dumper $o; ##$VAR1 = bless({'_b' => 2, '__c' => 3, 'a' => 1}, 'Foo'); $o->a = 4; $o->b = 5; $o->c = 6; print Dumper $o; ##$VAR1 = bless({'_b' => 5, '__c' => 6, 'a' => 4}, 'Foo'); $o->{a} = 7; $o->{_b} = 8; $o->{__c} = 9; print Dumper $o; ##$VAR1 = bless({'_b' => 8, '__c' => 9, 'a' => 7}, 'Foo'); }

    Read the article

  • iPhone: Create a single UIView from multiple clicks

    - by Cuzog
    I'm making a partial overlay modal in my app with the code from “Semi-Modal (Transparent) Dialogs on the iPhone” at ramin.firoozye.com. In doing so, the button that calls the modal is still visible and clickable. I will hide this button when the modal spawns, but I want to be sure if the user clicks very quickly twice, a new modal doesn't come up for each click. What is the best way to check that the modal doesn't already exist when calling it from the button click? You can download the test project here. For those that don't have xcode, the relevant functions are below: I call forth the modal on button click with this: - (IBAction)displayModal:(id)sender { ModalViewController *modalController = [[ModalViewController alloc] initWithNibName:@"ModalViewController" bundle:nil]; modalController.view.frame = CGRectOffset(modalController.view.frame, 0, 230); [self showModal:modalController.view]; } Then use this function to animate the custom modal over the current view: - (void)showModal:(UIView*) modalView { UIWindow* mainWindow = (((TestAppDelegate*) [UIApplication sharedApplication].delegate).window); CGPoint middleCenter = modalView.center; CGSize offSize = [UIScreen mainScreen].bounds.size; CGPoint offScreenCenter = CGPointMake(offSize.width / 2.0, offSize.height * 1.5); modalView.center = offScreenCenter; // we start off-screen [mainWindow addSubview:modalView]; // Show it with a transition effect [UIView beginAnimations:nil context:nil]; [UIView setAnimationDuration:0.4]; // animation duration in seconds modalView.center = middleCenter; [UIView commitAnimations]; } Then I dismiss the modal on button click with this: - (IBAction)dismissModal:(id)sender { [self hideModal:self.view]; } And then use these functions to animate the modal offscreen and clean itself up: - (void)hideModal:(UIView*) modalView { CGSize offSize = [UIScreen mainScreen].bounds.size; CGPoint offScreenCenter = CGPointMake(offSize.width / 2.0, offSize.height * 1.5); [UIView beginAnimations:nil context:modalView]; [UIView setAnimationDuration:0.7]; [UIView setAnimationDelegate:self]; [UIView setAnimationDidStopSelector:@selector(hideModalEnded:finished:context:)]; modalView.center = offScreenCenter; [UIView commitAnimations]; } - (void)hideModalEnded:(NSString *)animationID finished:(NSNumber *)finished context:(void *)context { UIView* modalView = (UIView *)context; [modalView removeFromSuperview]; [self release]; } Any help is greatly appreciated!

    Read the article

  • urgent..haskell mini interpreter

    - by mohamed elshikh
    i'm asked to implement this project and i have problems in part b which is the eval function this is the full describtion of the project You are required to implement an interpreter for mini-Haskell language. An interpreter is dened in Wikipedia as a computer program that executes, i.e. performs, instructions written in a programming language. The interpreter should be able to evaluate functions written in a special notation, which you will dene. A function is dened by: Function name Input Parameters : dened as a list of variables. The body of the function. The body of the function can be any of the following statements: a) Variable: The function may return any of the input variables. b) Arithmetic Expressions: The arithmetic expressions include input variables and addition, sub- traction, multiplication, division and modulus operations on arithmetic expressions. c) Boolean Expressions: The Boolean expressions include the ordering of arithmetic expressions (applying the relationships: <, =<, , = or =) and the anding, oring and negation of Boolean expressions. d) If-then-else statements: where the if keyword is followed by a Boolean expression. The then and else parts may be followed by any of the statements described here. e) Guarded expressions: where each case consists of a boolean expression and any of the statements described here. The expression consists of any number of cases. The rst case whose condition is true, its body should be evaluated. The guarded expression has to terminate with an otherwise case. f) Function calls: the body of the function may have a call to another function. Note that all inputs passed to the function will be of type Int. The output of the function can be of type Int or Bool. To implement the interpreter, you are required to implement the following: a) Dene a datatype for the following expressions: Variables Arithmetic expressions Boolean expressions If-then-else statements Guarded expressions Functions b) Implement the function eval which evaluates a function. It takes 3 inputs: The name of a function to be evaluated represented as a string. A list of inputs to that function. The arguments will always be of datatype Int. A list of functions. Each function is represented as instance of the datatype that you have created for functions. c) Implement the function get_type that returns the type of the function (as a string). The input to this function is the same as in part b. here is what i've done data Variable = v(char) data Arth= va Variable | Add Arth Arth | Sub Arth Arth | Times Arth Arth | Divide Arth Arth data Bol= Great Arth Arth | Small Arth Arth | Geq Arth Arth | Seq Arth Arth | And Bol Bol | Or Bol Bol | Neg Bol data Cond = data Guard = data Fun =cons String [Variable] Body data Body= bodycons(String) |Bol |Cond |Guard |Arth

    Read the article

< Previous Page | 301 302 303 304 305 306 307 308 309 310 311 312  | Next Page >