Search Results

Search found 8391 results on 336 pages for 'partial hash arguments'.

Page 305/336 | < Previous Page | 301 302 303 304 305 306 307 308 309 310 311 312  | Next Page >

  • Class template specializations with shared functionality

    - by Thomas
    I'm writing a simple maths library with a template vector type: template<typename T, size_t N> class Vector { public: Vector<T, N> &operator+=(Vector<T, N> const &other); // ... more operators, functions ... }; Now I want some additional functionality specifically for some of these. Let's say I want functions x() and y() on Vector<T, 2> to access particular coordinates. I could create a partial specialization for this: template<typename T> class Vector<T, 3> { public: Vector<T, 3> &operator+=(Vector<T, 3> const &other); // ... and again all the operators and functions ... T x() const; T y() const; }; But now I'm repeating everything that already existed in the generic template. I could also use inheritance. Renaming the generic template to VectorBase, I could do this: template<typename T, size_t N> class Vector : public VectorBase<T, N> { }; template<typename T> class Vector<T, 3> : public VectorBase<T, 3> { public: T x() const; T y() const; }; However, now the problem is that all operators are defined on VectorBase, so they return VectorBase instances. These cannot be assigned to Vector variables: Vector<float, 3> v; Vector<float, 3> w; w = 5 * v; // error: no conversion from VectorBase<float, 3> to Vector<float, 3> I could give Vector an implicit conversion constructor to make this possible: template<typename T, size_t N> class Vector : public VectorBase<T, N> { public: Vector(VectorBase<T, N> const &other); }; However, now I'm converting from Vector to VectorBase and back again. Even though the types are the same in memory, and the compiler might optimize all this away, it feels clunky and I don't really like to have potential run-time overhead for what is essentially a compile-time problem. Is there any other way to solve this?

    Read the article

  • jQuery: modify hidden form field value before submit

    - by Jason Miesionczek
    I have the following code in a partial view (using Spark): <span id="selectCount">0</span> video(s) selected. <for each="var video in Model"> <div style="padding: 3px; margin:2px" class="video_choice" id="${video.YouTubeID}"> <span id="video_name">${video.Name}</span><br/> <for each="var thumb in video.Thumbnails"> <img src="${thumb}" /> </for> </div> </for> # using(Html.BeginForm("YouTubeVideos","Profile", FormMethod.Post, new { id = "youTubeForm" })) # { <input type="hidden" id="video_names" name="video_names" /> <input type="submit" value="add selected"/> # } <ScriptBlock> $(".video_choice").click(function() { $(this).toggleClass('selected'); var count = $(".selected").length; $("#selectCount").html(count); }); var options = { target: '#videos', beforeSubmit: function(arr, form, opts) { var names = []; $(".selected").each(function() { names[names.length] = $(this).attr('id'); }); var namestring = names.join(","); $("#video_names").attr('value',namestring); //alert(namestring); //arr["video_names"] = namestring; //alert($.param(arr)); //alert($("#video_names").attr('value')); return true; } }; $("#youTubeForm").ajaxForm(options); </ScriptBlock> Essentially i display a series of divs that contain information pulled from the YouTube API. I use jQuery to allow the the user to select which videos they would like to add to their profile. When i submit the form i would like to populate the hidden field with a comma separated list of video ids. Everything works except that when i try to set the value of the field, in the controller on post, the field comes back empty. I am using the jQuery ajax form plugin. What am i doing wrong that is not allowing the value i set in the field to be sent to the server?

    Read the article

  • How to implement a caching model without violating MVC pattern?

    - by RPM1984
    Hi Guys, I have an ASP.NET MVC 3 (Razor) Web Application, with a particular page which is highly database intensive, and user experience is of the upmost priority. Thus, i am introducing caching on this particular page. I'm trying to figure out a way to implement this caching pattern whilst keeping my controller thin, like it currently is without caching: public PartialViewResult GetLocationStuff(SearchPreferences searchPreferences) { var results = _locationService.FindStuffByCriteria(searchPreferences); return PartialView("SearchResults", results); } As you can see, the controller is very thin, as it should be. It doesn't care about how/where it is getting it's info from - that is the job of the service. A couple of notes on the flow of control: Controllers get DI'ed a particular Service, depending on it's area. In this example, this controller get's a LocationService Services call through to an IQueryable<T> Repository and materialize results into T or ICollection<T>. How i want to implement caching: I can't use Output Caching - for a few reasons. First of all, this action method is invoked from the client-side (jQuery/AJAX), via [HttpPost], which according to HTTP standards should not be cached as a request. Secondly, i don't want to cache purely based on the HTTP request arguments - the cache logic is a lot more complicated than that - there is actually two-level caching going on. As i hint to above, i need to use regular data-caching, e.g Cache["somekey"] = someObj;. I don't want to implement a generic caching mechanism where all calls via the service go through the cache first - i only want caching on this particular action method. First thought's would tell me to create another service (which inherits LocationService), and provide the caching workflow there (check cache first, if not there call db, add to cache, return result). That has two problems: The services are basic Class Libraries - no references to anything extra. I would need to add a reference to System.Web here. I would have to access the HTTP Context outside of the web application, which is considered bad practice, not only for testability, but in general - right? I also thought about using the Models folder in the Web Application (which i currently use only for ViewModels), but having a cache service in a models folder just doesn't sound right. So - any ideas? Is there a MVC-specific thing (like Action Filter's, for example) i can use here? General advice/tips would be greatly appreciated.

    Read the article

  • Why does this textbox binding example work in WPF but not in Silverlight?

    - by Edward Tanguay
    Why is it in the following silverlight application that when I: change the default text in the first textbox move the cursor to the second text box (i.e. take focus off first textbox) click the button that inside the button handler, it still has the old value "default text"? What do I have to do to get the binding to work in Silverlight? The same code works fine in WPF. XAML: <UserControl x:Class="TestUpdate123.MainPage" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:d="http://schemas.microsoft.com/expression/blend/2008" xmlns:mc="http://schemas.openxmlformats.org/markup-compatibility/2006" mc:Ignorable="d" d:DesignWidth="640" d:DesignHeight="480"> <StackPanel Margin="10" HorizontalAlignment="Left"> <TextBox Text="{Binding InputText}" Height="200" Width="600" Margin="0 0 0 10"/> <StackPanel HorizontalAlignment="Left"> <Button Content="Convert" Click="Button_Convert_Click" Margin="0 0 0 10"/> </StackPanel> <TextBox Height="200" Width="600" Margin="0 0 0 10"/> <TextBlock Text="{Binding OutputText}"/> </StackPanel> </UserControl> Code Behind: using System.Windows; using System.Windows.Controls; using System.ComponentModel; namespace TestUpdate123 { public partial class MainPage : UserControl, INotifyPropertyChanged { #region ViewModelProperty: InputText private string _inputText; public string InputText { get { return _inputText; } set { _inputText = value; OnPropertyChanged("InputText"); } } #endregion #region ViewModelProperty: OutputText private string _outputText; public string OutputText { get { return _outputText; } set { _outputText = value; OnPropertyChanged("OutputText"); } } #endregion public MainPage() { InitializeComponent(); DataContext = this; InputText = "default text"; } private void Button_Convert_Click(object sender, RoutedEventArgs e) { OutputText = InputText; } #region INotifiedProperty Block public event PropertyChangedEventHandler PropertyChanged; protected void OnPropertyChanged(string propertyName) { PropertyChangedEventHandler handler = PropertyChanged; if (handler != null) { handler(this, new PropertyChangedEventArgs(propertyName)); } } #endregion } }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • jQuery UI dialog + WebKit + HTML response with script

    - by Anthony Koval'
    Once again I am faced with a great problem! :) So, here is the stuff: on the client side, I have a link. By clicking on it, jQuery makes a request to the server, gets response as HTML content, then popups UI dialog with that content. Here is the code of the request-function: function preview(){ $.ajax({ url: "/api/builder/", type: "post", //dataType: "html", data: {"script_tpl": $("#widget_code").text(), "widgets": $.toJSON(mwidgets), "widx": "0"}, success: function(data){ //console.log(data) $("#previewArea").dialog({ bgiframe: true, autoOpen: false, height: 600, width: 600, modal: true, buttons: { "Cancel": function() { $(this).dialog('destroy'); } } }); //console.log(data.toString()); $('#previewArea').attr("innerHTML", data.toString()); $("#previewArea").dialog("open"); }, error: function(){ console.log("shit happens"); } }) } The response (data) is: <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <script type="text/javascript">var smakly_widget_sid = 0 ,widgets = [{"cols": "2","rows": "2","div_id": "smakly_widget","wid": "0","smakly_style": "small_image",}, ] </script> <script type="text/javascript" src="/media/js/smak/smakme.js"></script> </head> <body> preview <div id="smakly_widget" style="width:560px;height:550px"> </div> </body> </html> As you see, there is a script to load: smakme.js, somehow it doesn't execute in WebKit-based browsers (I tried in Safari and Chrome), but in Firefox, Internet Explorer and Opera it works as expected! Here is that script: String.prototype.format = function(){ var pattern = /\{\d+\}/g; var args = arguments; return this.replace(pattern, function(capture){ return args[capture.match(/\d+/)]; }); } var turl = "/widget" var widgetCtrl = new(function(){ this.render_widget = function (w, content){ $("#" + w.div_id).append(content); } this.build_widgets = function(){ for (var widx in widgets){ var w = widgets[widx], iurl = '{0}?sid={1}&wid={2}&w={3}&h={4}&referer=http://ya.ru&thrash={5}'.format( turl, smakly_widget_sid, w.wid, w.cols, w.rows, Math.floor(Math.random()*1000).toString()), content = $('<iframe src="{0}" width="100%" height="100%"></iframe>'.format(iurl)); this.render_widget(w, content); } } }) $(document).ready(function(){ widgetCtrl.build_widgets(); }) Is that some security issue, or anything else?

    Read the article

  • Multi-tier applications using L2S, WCF and Base Class

    - by Gena Verdel
    Hi all. One day I decided to build this nice multi-tier application using L2S and WCF. The simplified model is : DataBase-L2S-Wrapper(DTO)-Client Application. The communication between Client and Database is achieved by using Data Transfer Objects which contain entity objects as their properties. abstract public class BaseObject { public virtual IccSystem.iccObjectTypes ObjectICC_Type { get { return IccSystem.iccObjectTypes.unknownType; } } [global::System.Data.Linq.Mapping.ColumnAttribute(Storage = "_ID", AutoSync = AutoSync.OnInsert, DbType = "BigInt NOT NULL IDENTITY", IsPrimaryKey = true, IsDbGenerated = true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order = 1)] public virtual long ID { //get; //set; get { return _ID; } set { _ID = value; } } } [DataContract] public class BaseObjectWrapper<T> where T : BaseObject { #region Fields private T _DBObject; #endregion #region Properties [DataMember] public T Entity { get { return _DBObject; } set { _DBObject = value; } } #endregion } Pretty simple, isn't it?. Here's the catch. Each one of the mapped classes contains ID property itself so I decided to override it like this [global::System.Data.Linq.Mapping.TableAttribute(Name="dbo.Divisions")] [global::System.Runtime.Serialization.DataContractAttribute()] public partial class Division : INotifyPropertyChanging, INotifyPropertyChanged { [global::System.Data.Linq.Mapping.ColumnAttribute(Storage="_ID", AutoSync=AutoSync.OnInsert, DbType="BigInt NOT NULL IDENTITY", IsPrimaryKey=true, IsDbGenerated=true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order=1)] public override long ID { get { return this._ID; } set { if ((this._ID != value)) { this.OnIDChanging(value); this.SendPropertyChanging(); this._ID = value; this.SendPropertyChanged("ID"); this.OnIDChanged(); } } } } Wrapper for division is pretty straightforward as well: public class DivisionWrapper : BaseObjectWrapper<Division> { } It worked pretty well as long as I kept ID values at mapped class and its BaseObject class the same(that's not very good approach, I know, but still) but then this happened: private CentralDC _dc; public bool UpdateDivision(ref DivisionWrapper division) { DivisionWrapper tempWrapper = division; if (division.Entity == null) { return false; } try { Table<Division> table = _dc.Divisions; var q = table.Where(o => o.ID == tempWrapper.Entity.ID); if (q.Count() == 0) { division.Entity._errorMessage = "Unable to locate entity with id " + division.Entity.ID.ToString(); return false; } var realEntity = q.First(); realEntity = division.Entity; _dc.SubmitChanges(); return true; } catch (Exception ex) { division.Entity._errorMessage = ex.Message; return false; } } When trying to enumerate over the in-memory query the following exception occurred: Class member BaseObject.ID is unmapped. Although I'm stating the type and overriding the ID property L2S fails to work. Any suggestions?

    Read the article

  • Rails, Edit page update in a window

    - by Mike
    I have my code working so that I have a table of businesses. There's a pencil icon you can click on the edit the business information. The edit information comes up in a partial inside of a modal pop up box. The only problem is that once they make the changes they want and click update, it sends them to the 'show' page for that business. What I want to happen is have the pop up box close and have it update the information. This is my update function in my controller. def update @business = Business.find(params[:id]) respond_to do |format| if @business.update_attributes(params[:business]) flash[:notice] = 'Business was successfully updated.' format.html { redirect_to(business_url(@business)) } format.js else format.html { render :action => "edit" } format.xml { render :xml => @business.errors, :status => :unprocessable_entity } end end end I tried following railscast 43 and i created an .rjs file but I couldn't get that to work at all. My update was still taking me to the show page. Any help would be appreciated. EDIT: Added some more code. <% form_for(@business) do |f| %> <%= f.error_messages %> <p> <%= f.label :name %><br /> <%= f.text_field :name %> </p> ... <%= f.label :business_category %><br /> <%= f.select :business_category_id, @business_categories_map, :selected => @business.business_category_id %> </p> <p> <%= f.label :description %><br /> <%= f.text_area :description %> </p> <p> <%= f.submit 'Update' %> </p> <% end %> This is my form inside of my edit page which is being called through the index in a pop up by: <div id="popupEdit<%=h business.id %>" class="popupContact"> <a class="popupClose<%=h business.id %>" id="popupClose">x</a> <% if business.business_category_id %> <% @business = business %> <%= render "business/edit" %> <% end %> </div>

    Read the article

  • Delphi - Read File To StringList, then delete and write back to file.

    - by Jkraw90
    I'm currently working on a program to generate the hashes of files, in Delphi 2010. As part of this I have a option to create User Presets, e.g. pre-defined choice of hashing algo's which the user can create/save/delete. I have the create and load code working fine. It uses a ComboBox and loads from a file "fhpre.ini", inside this file is the users presets stored in format of:- PresetName PresetCode (a 12 digit string using 0 for don't hash and 1 for do) On application loading it loads the data from this file into the ComboBox and an Array with the ItemIndex of ComboBox matching the corrisponding correct string of 0's and 1's in the Array. Now I need to implement a feature to have the user delete a preset from the list. So far my code is as follows, procedure TForm1.Panel23Click(Sender : TObject); var fil : textfile; contents : TStringList; x,i : integer; filline : ansistring; filestream : TFileStream; begin //Start Procedure //Load data into StringList contents := TStringList.Create; fileStream := TFileStream.Create((GetAppData+'\RFA\fhpre.ini'), fmShareDenyNone); Contents.LoadFromStream(fileStream); fileStream.Destroy(); //Search for relevant Preset i := 0; if ComboBox4.Text <> Contents[i] then begin Repeat i := i + 1; Until ComboBox4.Text = Contents[i]; end; contents.Delete(i); //Delete Relevant Preset Name contents.Delete(i); //Delete Preset Digit String //Write StringList back to file. AssignFile(fil,(GetAppData+'\RFA\fhpre.ini')); ReWrite(fil); for i := 0 to Contents.Count -1 do WriteLn(Contents[i]); CloseFile(fil); Contents.Free; end; However if this is run, I get a 105 error when it gets to the WriteLn section. I'm aware that the code isn't great, for example doesn't have checks for presets with same name, but that will come, I want to get the base code working first then can tweak and add extra checks etc. Any help would be appreciated.

    Read the article

  • invalid postback event instead of dropdown to datagrid

    - by rima
    I faced with funny situation. I created a page which is having some value, I set these value and control my post back event also. The problem is happening when I change a component index(ex reselect a combobox which is not inside my datagrid) then I dont know why without my page call the Page_Load it goes to create a new row in grid function and all of my parameter are null! I am just receiving null exception. So in other word I try to explain the situation: when I load my page I am initializing some parameter. then everything is working fine. in my page when I change selected item of my combo box, page suppose to go and run function related to that combo box, and call page_load, but it is not going there and it goes to rowcreated function. I am trying to illustrate part of my page. Please help me because I am not receiving any error except null exception and it triger wrong even which seems so complicated for me. public partial class W_CM_FRM_02 : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { if (Page.IsPostBack && !loginFail) return; InitializeItems(); } } private void InitializeItems() { cols = new string[] { "v_classification_code", "v_classification_name" }; arrlstCMMM_CLASSIFICATION = (ArrayList)db.Select(cols, "CMMM_CLASSIFICATION", "v_classification_code <> 'N'", " ORDER BY v_classification_name"); } } protected void DGV_RFA_DETAILS_RowCreated(object sender, GridViewRowEventArgs e) { //db = (Database)Session["oCon"]; foreach (DataRow dr in arrlstCMMM_CLASSIFICATION) ((DropDownList)DGV_RFA_DETAILS.Rows[index].Cells[4].FindControl("OV_RFA_CLASSIFICATION")).Items.Add(new ListItem(dr["v_classification_name"].ToString(), dr["v_classification_code"].ToString())); } protected void V_CUSTOMER_SelectedIndexChanged(object sender, EventArgs e) { if (V_CUSTOMER.SelectedValue == "xxx" || V_CUSTOMER.SelectedValue == "ddd") V_IMPACTED_FUNCTIONS.Enabled = true; } } my form: <%@ Page Language="C#" MasterPageFile="~/MasterPage.master" AutoEventWireup="true" CodeFile="W_CM_FRM_02.aspx.cs" Inherits="W_CM_FRM_02" Title="W_CM_FRM_02" enableeventvalidation="false" EnableViewState="true"%> <td>Project name*</td> <td><asp:DropDownList ID="V_CUSTOMER" runat="server" AutoPostBack="True" onselectedindexchanged="V_CUSTOMER_SelectedIndexChanged" /></td> <td colspan = "8"> <asp:GridView ID="DGV_RFA_DETAILS" runat="server" ShowFooter="True" AutoGenerateColumns="False" CellPadding="1" ForeColor="#333333" GridLines="None" OnRowDeleting="grvRFADetails_RowDeleting" Width="100%" Style="text-align: left" onrowcreated="DGV_RFA_DETAILS_RowCreated"> <RowStyle BackColor="#FFFBD6" ForeColor="#333333" /> <Columns> <asp:BoundField DataField="ON_RowNumber" HeaderText="SNo" /> <asp:TemplateField HeaderText="RFA/RAD/Ticket No*"> <ItemTemplate> <asp:TextBox ID="OV_RFA_NO" runat="server" Width="120"></asp:TextBox> </ItemTemplate> </asp:TemplateField>

    Read the article

  • .NET Windows Service with timer stops responding

    - by Biri
    I have a windows service written in c#. It has a timer inside, which fires some functions on a regular basis. So the skeleton of my service: public partial class ArchiveService : ServiceBase { Timer tickTack; int interval = 10; ... protected override void OnStart(string[] args) { tickTack = new Timer(1000 * interval); tickTack.Elapsed += new ElapsedEventHandler(tickTack_Elapsed); tickTack.Start(); } protected override void OnStop() { tickTack.Stop(); } private void tickTack_Elapsed(object sender, ElapsedEventArgs e) { ... } } It works for some time (like 10-15 days) then it stops. I mean the service shows as running, but it does not do anything. I make some logging and the problem can be the timer, because after the interval it does not call the tickTack_Elapsed function. I was thinking about rewrite it without a timer, using an endless loop, which stops the processing for the amount of time I set up. This is also not an elegant solution and I think it can have some side effects regarding memory. The Timer is used from the System.Timers namespace, the environment is Windows 2003. I used this approach in two different services on different servers, but both is producing this behavior (this is why I thought that it is somehow connected to my code or the framework itself). Does somebody experienced this behavior? What can be wrong? Edit: I edited both services. One got a nice try-catch everywhere and more logging. The second got a timer-recreation on a regular basis. None of them stopped since them, so if this situation remains for another week, I will close this question. Thank you for everyone so far. Edit: I close this question because nothing happened. I mean I made some changes, but those changes are not really relevant in this matter and both services are running without any problem since then. Please mark it as "Closed for not relevant anymore".

    Read the article

  • How can a C/C++ program put itself into background?

    - by Larry Gritz
    What's the best way for a running C or C++ program that's been launched from the command line to put itself into the background, equivalent to if the user had launched from the unix shell with '&' at the end of the command? (But the user didn't.) It's a GUI app and doesn't need any shell I/O, so there's no reason to tie up the shell after launch. But I want a shell command launch to be auto-backgrounded without the '&' (or on Windows). Ideally, I want a solution that would work on any of Linux, OS X, and Windows. (Or separate solutions that I can select with #ifdef.) It's ok to assume that this should be done right at the beginning of execution, as opposed to somewhere in the middle. One solution is to have the main program be a script that launches the real binary, carefully putting it into the background. But it seems unsatisfying to need these coupled shell/binary pairs. Another solution is to immediately launch another executed version (with 'system' or CreateProcess), with the same command line arguments, but putting the child in the background and then having the parent exit. But this seems clunky compared to the process putting itself into background. Edited after a few answers: Yes, a fork() (or system(), or CreateProcess on Windows) is one way to sort of do this, that I hinted at in my original question. But all of these solutions make a SECOND process that is backgrounded, and then terminate the original process. I was wondering if there was a way to put the EXISTING process into the background. One difference is that if the app was launched from a script that recorded its process id (perhaps for later killing or other purpose), the newly forked or created process will have a different id and so will not be controllable by any launching script, if you see what I'm getting at. Edit #2: fork() isn't a good solution for OS X, where the man page for 'fork' says that it's unsafe if certain frameworks or libraries are being used. I tried it, and my app complains loudly at runtime: "The process has forked and you cannot use this CoreFoundation functionality safely. You MUST exec()." I was intrigued by daemon(), but when I tried it on OS X, it gave the same error message, so I assume that it's just a fancy wrapper for fork() and has the same restrictions. Excuse the OS X centrism, it just happens to be the system in front of me at the moment. But I am indeed looking for a solution to all three platforms.

    Read the article

  • Php plugin to replace '->' with '.' as the member access operator ? Or even better: alternative synt

    - by Gigi
    Present day usable solution: Note that if you use an ide or an advanced editor, you could make a code template, or record a macro that inserts '->' when you press Ctrl and '.' or something. Netbeans has macros, and I have recorded a macro for this, and I like it a lot :) (just click the red circle toolbar button (start record macro),then type -> into the editor (thats all the macro will do, insert the arrow into the editor), then click the gray square (stop record macro) and assign the 'Ctrl dot' shortcut to it, or whatever shortcut you like) The php plugin: The php plugin, would also have to have a different string concatenation operator than the dot. Maybe a double dot ? Yea... why not. All it has to do is set an activation tag so that it doesnt replace / interpreter '.' as '->' for old scripts and scripts that dont intent do use this. Something like this: <php+ $obj.i = 5 ?> (notice the modified '<?php' tag to '<?php+' ) This way it wouldnt break old code. (and you can just add the '<?php+' code template to your editor and then type 'php tab' (for netbeans) and it would insert '<?php+' ) With the alternative syntax method you could even have old and new syntax cohabitating on the same page like this (I am illustrating this to show the great compatibility of this method, not because you would want to do this): <?php+ $obj.i = 5; ?> <?php $obj->str = 'a' . 'b'; ?> You could change the tag to something more explanatory, in case somebody who doesnt know about the plugin reads the script and thinks its a syntax error <?php-dot.com $obj.i = 5; ?> This is easy because most editors have code templates, so its easy to assign a shortcut to it. And whoever doesnt want the dot replacement, doesnt have to use it. These are NOT ultimate solutions, they are ONLY examples to show that solutions exist, and that arguments against replacing '->' with '.' are only excuses. (Just admit you like the arrow, its ok : ) With this potential method, nobody who doesnt want to use it would have to use it, and it wouldnt break old code. And if other problems (ahem... excuses) arise, they could be fixed too. So who can, and who will do such a thing ?

    Read the article

  • WPF data templates

    - by imekon
    I'm getting started with WPF and trying to get my head around connecting data to the UI. I've managed to connect to a class without any issues, but what I really want to do is connect to a property of the main window. Here's the XAML: <Window x:Class="test3.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:custom="clr-namespace:test3" Title="MainWindow" Height="350" Width="525"> <Window.Resources> <CollectionViewSource Source="{Binding Source={x:Static Application.Current}, Path=Platforms}" x:Key="platforms"/> <DataTemplate DataType="{x:Type custom:Platform}"> <StackPanel> <CheckBox IsChecked="{Binding Path=Selected}"/> <TextBlock Text="{Binding Path=Name}"/> </StackPanel> </DataTemplate> </Window.Resources> <Grid> <ListBox ItemsSource="{Binding Source={StaticResource platforms}}"/> </Grid> Here's the code for the main window: public partial class MainWindow : Window { ObservableCollection<Platform> m_platforms; public MainWindow() { m_platforms = new ObservableCollection<Platform>(); m_platforms.Add(new Platform("PC")); InitializeComponent(); } public ObservableCollection<Platform> Platforms { get { return m_platforms; } set { m_platforms = value; } } } Here's the Platform class: public class Platform { private string m_name; private bool m_selected; public Platform(string name) { m_name = name; m_selected = false; } public string Name { get { return m_name; } set { m_name = value; } } public bool Selected { get { return m_selected; } set { m_selected = value; } } } This all compiles and runs fine but the list box displays with nothing in it. If I put a breakpoint on the get method of Platforms, it doesn't get called. I don't understand as Platforms is what the XAML should be connecting to!

    Read the article

  • MODX parse error function implode (is it me or modx?)

    - by Ian
    Hi, I cannot for the life of me figure this out, maybe someone can help. Using MODX a form takes user criteria to create a filter and return a list of documents. The form is one text field and a few checkboxes. If both text field and checkbox data is posted, the function works fine; if just the checkbox data is posted the function works fine; but if just the text field data is posted, modx gives me the following error: Error: implode() [function.implode]: Invalid arguments passed. I've tested this outside of modx with flat files and it all works fine leading me to assume a bug exists within modx. But I'm not convinced. Here's my code: <?php $order = array('price ASC'); //default sort order if(!empty($_POST['tour_finder_duration'])){ //duration submitted $days = htmlentities($_POST['tour_finder_duration']); //clean up post array_unshift($order,"duration DESC"); //add duration sort before default $filter[] = 'duration,'.$days.',4'; //add duration to filter[] (field,criterion,mode) $criteria[] = 'Number of days: <strong>'.$days.'</strong>'; //displayed on results page } if(!empty($_POST['tour_finder_dests'])){ //destination/s submitted $dests = $_POST['tour_finder_dests']; foreach($dests as $value){ //iterate through dests array $filter[] = 'searchDests,'.htmlentities($value).',7'; //add dests to filter[] $params['docid'] = $value; $params['field'] = 'pagetitle'; $pagetitle = $modx->runSnippet('GetField',$params); $dests_array[] = '<a href="[~'.$value.'~]" title="Read more about '.$pagetitle.'" class="tourdestlink">'.$pagetitle.'</a>'; } $dests_array = implode(', ',$dests_array); $criteria[] = 'Destinations: '.$dests_array; //displayed on results page } if(is_array($filter)){ $filter = implode('|',$filter);//pipe-separated string } if(is_array($order)){ $order = implode(',',$order);//comma-separated string } if(is_array($criteria)){ $criteria = implode('<br />',$criteria); } echo '<br />Order: '.$order.'<br /> Filter: '.$filter.'<br /> Criteria: '.$criteria; //next: extract docs using $filter and $order, display user's criteria using $criteria... ?> The echo statement is displayed above the MODX error message and the $filter array is correctly imploded. Any help will save my computer from flying out the window. Thanks

    Read the article

  • C#/.NET Project - Am I setting things up correctly?

    - by JustLooking
    1st solution located: \Common\Controls\Controls.sln and its project: \Common\Controls\Common.Controls\Common.Controls.csproj Description: This is a library that contains this class: public abstract class OurUserControl : UserControl { // Variables and other getters/setters common to our UserControls } 2nd solution located: \AControl\AControl.sln and its project: \AControl\AControl\AControl.csproj Description: Of the many forms/classes, it will contain this class: using Common.Controls; namespace AControl { public partial class AControl : OurUserControl { // The implementation } } A note about adding references (not sure if this is relevant): When I add references (for projects I create), using the names above: 1. I add Common.Controls.csproj to AControl.sln 2. In AControl.sln I turn off the build of Common.Controls.csproj 3. I add the reference to Common.Controls (by project) to AControl.csproj. This is the (easiest) way I know how to get Debug versions to match Debug References, and Release versions to match Release References. Now, here is where the issue lies (the 3rd solution/project that actually utilizes the UserControl): 3rd solution located: \MainProj\MainProj.sln and its project: \MainProj\MainProj\MainProj.csproj Description: Here's a sample function in one of the classes: private void TestMethod<T>() where T : Common.Controls.OurUserControl, new() { T TheObject = new T(); TheObject.OneOfTheSetters = something; TheObject.AnotherOfTheSetters = something_else; // Do stuff with the object } We might call this function like so: private void AnotherMethod() { TestMethod<AControl.AControl>(); } This builds, runs, and works. No problem. The odd thing is after I close the project/solution and re-open it, I have red squigglies everywhere. I bring up my error list and I see tons of errors (anything that deals with AControl will be noted as an error). I'll see errors such as: The type 'AControl.AControl' cannot be used as type parameter 'T' in the generic type or method 'MainProj.MainClass.TestMethod()'. There is no implicit reference conversion from 'AControl.AControl' to 'Common.Controls.OurUserControl'. or inside the actual method (the properties located in the abstract class): 'AControl.AControl' does not contain a definition for 'OneOfTheSetters' and no extension method 'OneOfTheSetters' accepting a first argument of type 'AControl.AControl' could be found (are you missing a using directive or an assembly reference?) Meanwhile, I can still build and run the project (then the red squigglies go away until I re-open the project, or close/re-open the file). It seems to me that I might be setting up the projects incorrectly. Thoughts?

    Read the article

  • drupal jQuery 1.4 on specific pages

    - by Mark
    I'm looking for a way to force drupal to use 1.4 on specific pages. This is the same as this old question:http://stackoverflow.com/questions/2842792/drupal-jquery-1-4-on-specific-pages It look me a while to try the answer which I marked correct. But because I'm new to module dev overall I couldn't figure it out based on the answer. The code from that answer looked like this: /** * Implementation of hook_theme_registry_alter(). * Based on the jquery_update module. * * Make this page preprocess function runs *last*, * so that a theme can't call drupal_get_js(). */ function MYMODULE_theme_registry_alter(&$theme_registry) { if (isset($theme_registry['page'])) { // See if our preprocess function is loaded, if so remove it. if ($key = array_search('MYMODULE_preprocess_page', $theme_registry['page']['preprocess functions'])) { unset($theme_registry['page']['preprocess functions'][$key]); } // Now add it on at the end of the array so that it runs last. $theme_registry['page']['preprocess functions'][] = 'MYMODULE_preprocess_page'; } } /** * Implementation of moduleName_preprocess_hook(). * Based on the jquery_update module functions. * * Strips out JS and CSS for a path. */ function MYMODULE_preprocess_page(&$variables, $arg = 'my_page', $delta=0) { // I needed a one hit wonder. Can be altered to use function arguments // to increase it's flexibility. if(arg($delta) == $arg) { $scripts = drupal_add_js(); $css = drupal_add_css(); // Only do this for pages that have JavaScript on them. if (!empty($variables['scripts'])) { $path = drupal_get_path('module', 'admin_menu'); unset($scripts['module'][$path . '/admin_menu.js']); $variables['scripts'] = drupal_get_js('header', $scripts); } // Similar process for CSS but there are 2 Css realted variables. // $variables['css'] and $variables['styles'] are both used. if (!empty($variables['css'])) { $path = drupal_get_path('module', 'admin_menu'); unset($css['all']['module'][$path . '/admin_menu.css']); unset($css['all']['module'][$path . '/admin_menu.color.css']); $variables['styles'] = drupal_get_css($css); } } } I need the jquery_update 1.3.2 to be unset on the node-types of 'blog' and 'video'. Can someone help me out? Thank you.

    Read the article

  • Correct way to use Drupal 7 Entities and Field API

    - by Martin Petts
    I'm trying to use Drupal 7's entities and field API to correctly build a new module. What I have been unable to understand from the documentation is the correct way to use the new API to create a 'content type' (not a node type) with a number of set fields, such as Body. I'm trying to set up the entity using hook_entity_info, then I believe I need to add the body field using field_create_instance, but I can't seem to get it to work. In mycontenttype.module: /** * Implements hook_entity_info(). */ function mycontenttype_entity_info() { $return = array( 'mycontenttype' => array( 'label' => t('My Content Type'), 'controller class' => 'MyContentTypeEntityController', 'base table' => 'content_type', 'uri callback' => 'content_type_uri', 'entity keys' => array( 'id' => 'cid', 'label' => 'title' ), 'bundles' => array( 'mycontenttype' => array( 'label' => 'My Content Type', 'admin' => array( 'path' => 'admin/contenttype', 'access arguments' => array('administer contenttype') ) ) ), 'fieldable' => true ) ); return $return; } /** * Implements hook_field_extra_fields(). */ function mycontenttype_field_extra_fields() { $return['mycontenttype']['mycontenttype'] = array( 'form' = array( 'body' = array( 'label' = 'Body', 'description' = t('Body content'), 'weight' = 0, ), ), ); return $return; } Then does this go in the .install file? function mycontenttype_install() { $field = array( 'field_name' => 'body', 'type' => 'text_with_summary', 'entity_types' => array('survey'), 'translatable' => TRUE, ); field_create_field($field); $instance = array( 'entity_type' => 'mycontenttype', 'field_name' => 'body', 'bundle' => 'mycontenttype', 'label' => 'Body', 'widget_type' => 'text_textarea_with_summary', 'settings' => array('display_summary' => TRUE), 'display' => array( 'default' => array( 'label' => 'hidden', 'type' => 'text_default', ), 'teaser' => array( 'label' => 'hidden', 'type' => 'text_summary_or_trimmed', ) ) ); field_create_instance($instance); }

    Read the article

  • How to use a LinkButton inside gridview to delete selected username in the code-behind file?

    - by jenifer
    I have a "UserDetail" table in my "JobPost.mdf". I have a "Gridview1" showing the column from "UserDetail" table,which has a primary key "UserName". This "UserName" is originally saved using Membership class function. Now I add a "Delete" linkbutton to the GridView1. This "Delete" is not autogenerate button,I dragged inside the column itemtemplate from ToolBox. The GridView1's columns now become "Delete_LinkButton"+"UserName"(within the UserDetail table)+"City"(within the UserDetail table)+"IsAdmin"(within the UserDetail table) What I need is that by clicking this "delete_linkButton",it will ONLY delete the entire User Entity on the same row (link by the corresponding "UserName") from the "UserDetail" table,as well as delete all information from the AspNetDB.mdf (User,Membership,UserInRole,etc). I would like to fireup a user confirm,but not mandatory. At least I am trying to make it functional in the correct way. for example: Command UserName City IsAdmin delete ken Los Angles TRUE delete jim Toronto FALSE When I click "delete" on the first row, I need all the record about "ken" inside the "UserDetail" table to be removed. Meanwhile, all the record about "ken" in the AspNetDB.mdf will be gone, including UserinRole table. I am new to asp.net, so I don't know how to pass the commandargument of the "Delete_LinkButton" to the code-behind file LinkButton1_Click(object sender, EventArgs e), because I need one extra parameter "UserName". My partial code is listed below: <asp:TemplateField> <ItemTemplate> <asp:LinkButton ID="Delete_LinkButton" runat="server" onclick="LinkButton1_Click1" CommandArgument='<%# Eval("UserName","{0}") %>'>LinkButton</asp:LinkButton> </ItemTemplate> </asp:TemplateField> protected void Delete_LinkButton_Click(object sender, EventArgs e) { ((LinkButton) GridView1.FindControl("Delete_LinkButton")).Attributes.Add("onclick", "'return confirm('Are you sure you want to delete {0} '" + UserName); Membership.DeleteUser(UserName); JobPostDataContext db = new JobPostDataContext(); var query = from u in db.UserDetails where u.UserName == UserName select u; for (var Item in query) { db.UserDetails.DeleteOnSubmit(Item); } db.SubmitChanges(); } Please do help! Thanks in advance.

    Read the article

  • Writing a managed wrapper for unmanaged (C++) code - custom types/structs

    - by Bobby
    faacEncConfigurationPtr FAACAPI faacEncGetCurrentConfiguration( faacEncHandle hEncoder); I'm trying to come up with a simple wrapper for this C++ library; I've never done more than very simple p/invoke interop before - like one function call with primitive arguments. So, given the above C++ function, for example, what should I do to deal with the return type, and parameter? FAACAPI is defined as: #define FAACAPI __stdcall faacEncConfigurationPtr is defined: typedef struct faacEncConfiguration { int version; char *name; char *copyright; unsigned int mpegVersion; unsigned long bitRate; unsigned int inputFormat; int shortctl; psymodellist_t *psymodellist; int channel_map[64]; } faacEncConfiguration, *faacEncConfigurationPtr; AFAIK this means that the return type of the function is a reference to this struct? And faacEncHandle is: typedef struct { unsigned int numChannels; unsigned long sampleRate; ... SR_INFO *srInfo; double *sampleBuff[MAX_CHANNELS]; ... double *freqBuff[MAX_CHANNELS]; double *overlapBuff[MAX_CHANNELS]; double *msSpectrum[MAX_CHANNELS]; CoderInfo coderInfo[MAX_CHANNELS]; ChannelInfo channelInfo[MAX_CHANNELS]; PsyInfo psyInfo[MAX_CHANNELS]; GlobalPsyInfo gpsyInfo; faacEncConfiguration config; psymodel_t *psymodel; /* quantizer specific config */ AACQuantCfg aacquantCfg; /* FFT Tables */ FFT_Tables fft_tables; int bitDiff; } faacEncStruct, *faacEncHandle; So within that struct we see a lot of other types... hmm. Essentially, I'm trying to figure out how to deal with these types in my managed wrapper? Do I need to create versions of these types/structs, in C#? Something like this: [StructLayout(LayoutKind.Sequential)] struct faacEncConfiguration { uint useTns; ulong bitRate; ... } If so then can the runtime automatically "map" these objects onto eachother? And, would I have to create these "mapped" types for all the types in these return types/parameter type hierarchies, all the way down until I get to all primitives? I know this is a broad topic, any advice on getting up-to-speed quickly on what I need to learn to make this happen would be very much appreciated! Thanks!

    Read the article

  • Solving a cyclical dependency in Ninject (Compact Framework)

    - by Alex
    I'm trying to use Ninject for dependency injection in my MVP application. However, I have a problem because I have two types that depend on each other, thus creating a cyclic dependency. At first, I understand that it was a problem, because I had both types require each other in their constructors. Therefore, I moved one of the dependencies to a property injection instead, but I'm still getting the error message. What am I doing wrong? This is the presenter: public class LoginPresenter : Presenter<ILoginView>, ILoginPresenter { public LoginPresenter( ILoginView view ) : base( view ) { } } and this is the view: public partial class LoginForm : Form, ILoginView { [Inject] public ILoginPresenter Presenter { private get; set; } public LoginForm() { InitializeComponent(); } } And here's the code that causes the exception: static class Program { /// <summary> /// The main entry point for the application. /// </summary> [MTAThread] static void Main() { // Show the login form Views.LoginForm loginForm = Kernel.Get<Views.Interfaces.ILoginView>() as Views.LoginForm; Application.Run( loginForm ); } } The exception happens on the line with the Kernel.Get<>() call. Here it is: Error activating ILoginPresenter using binding from ILoginPresenter to LoginPresenter A cyclical dependency was detected between the constructors of two services. Activation path: 4) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 3) Injection of dependency ILoginView into parameter view of constructor of type LoginPresenter 2) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 1) Request for ILoginView Suggestions: 1) Ensure that you have not declared a dependency for ILoginPresenter on any implementations of the service. 2) Consider combining the services into a single one to remove the cycle. 3) Use property injection instead of constructor injection, and implement IInitializable if you need initialization logic to be run after property values have been injected. Why doesn't Ninject understand that since one is constructor injection and the other is property injection, this can work just fine? I even read somewhere looking for the solution to this problem that Ninject supposedly gets this right as long as the cyclic dependency isn't both in the constructors. Apparently not, though. Any help resolving this would be much appreciated.

    Read the article

  • C++ using cdb_read returns extra characters on some reads

    - by Moe Be
    Hi All, I am using the following function to loop through a couple of open CDB hash tables. Sometimes the value for a given key is returned along with an additional character (specifically a CTRL-P (a DLE character/0x16/0o020)). I have checked the cdb key/value pairs with a couple of different utilities and none of them show any additional characters appended to the values. I get the character if I use cdb_read() or cdb_getdata() (the commented out code below). If I had to guess I would say I am doing something wrong with the buffer I create to get the result from the cdb functions. Any advice or assistance is greatly appreciated. char* HashReducer::getValueFromDb(const string &id, vector <struct cdb *> &myHashFiles) { unsigned char hex_value[BUFSIZ]; size_t hex_len; //construct a real hex (not ascii-hex) value to use for database lookups atoh(id,hex_value,&hex_len); char *value = NULL; vector <struct cdb *>::iterator my_iter = myHashFiles.begin(); vector <struct cdb *>::iterator my_end = myHashFiles.end(); try { //while there are more databases to search and we have not found a match for(; my_iter != my_end && !value ; my_iter++) { //cerr << "\n looking for this MD5:" << id << " hex(" << hex_value << ") \n"; if (cdb_find(*my_iter, hex_value, hex_len)){ //cerr << "\n\nI found the key " << id << " and it is " << cdb_datalen(*my_iter) << " long\n\n"; value = (char *)malloc(cdb_datalen(*my_iter)); cdb_read(*my_iter,value,cdb_datalen(*my_iter),cdb_datapos(*my_iter)); //value = (char *)cdb_getdata(*my_iter); //cerr << "\n\nThe value is:" << value << " len is:" << strlen(value)<< "\n\n"; }; } } catch (...){} return value; }

    Read the article

  • WinForm-style Invoke() in unmanaged C++

    - by Matt Green
    I've been playing with a DataBus-type design for a hobby project, and I ran into an issue. Back-end components need to notify the UI that something has happened. My implementation of the bus delivers the messages synchronously with respect to the sender. In other words, when you call Send(), the method blocks until all the handlers have called. (This allows callers to use stack memory management for event objects.) However, consider the case where an event handler updates the GUI in response to an event. If the handler is called, and the message sender lives on another thread, then the handler cannot update the GUI due to Win32's GUI elements having thread affinity. More dynamic platforms such as .NET allow you to handle this by calling a special Invoke() method to move the method call (and the arguments) to the UI thread. I'm guessing they use the .NET parking window or the like for these sorts of things. A morbid curiosity was born: can we do this in C++, even if we limit the scope of the problem? Can we make it nicer than existing solutions? I know Qt does something similar with the moveToThread() function. By nicer, I'll mention that I'm specifically trying to avoid code of the following form: if(! this->IsUIThread()) { Invoke(MainWindowPresenter::OnTracksAdded, e); return; } being at the top of every UI method. This dance was common in WinForms when dealing with this issue. I think this sort of concern should be isolated from the domain-specific code and a wrapper object made to deal with it. My implementation consists of: DeferredFunction - functor that stores the target method in a FastDelegate, and deep copies the single event argument. This is the object that is sent across thread boundaries. UIEventHandler - responsible for dispatching a single event from the bus. When the Execute() method is called, it checks the thread ID. If it does not match the UI thread ID (set at construction time), a DeferredFunction is allocated on the heap with the instance, method, and event argument. A pointer to it is sent to the UI thread via PostThreadMessage(). Finally, a hook function for the thread's message pump is used to call the DeferredFunction and de-allocate it. Alternatively, I can use a message loop filter, since my UI framework (WTL) supports them. Ultimately, is this a good idea? The whole message hooking thing makes me leery. The intent is certainly noble, but are there are any pitfalls I should know about? Or is there an easier way to do this?

    Read the article

  • C - What is the proper format to allow a function to show an error was encountered?

    - by BrainSteel
    I have a question about what a function should do if the arguments to said function don't line up quite right, through no fault of the function call. Since that sentence doesn't make much sense, I'll offer my current issue. To keep it simple, here is the most relevant and basic function I have. float getYValueAt(float x, PHYS_Line line, unsigned short* error) *error = 0; if(x < line.start.x || x > line.end.x){ *error = 1; return -1; } if(line.slope.value != 0){ //line's equation: y - line.start.y = line.slope.value(x - line.start.x) return line.slope.value * (x - line.start.x) + line.start.y; } else if(line.slope.denom == 0){ if(line.start.x == x) return line.start.y; else{ *error = 1; return -1; } } else if(line.slope.num == 0){ return line.start.y; } } The function attempts to find the point on a line, given a certain x value. However, under some circumstances, this may not be possible. For example, on the line x = 3, if 5 is passed as a value, we would have a problem. Another problem arises if the chosen x value is not within the interval the line is on. For this, I included the error pointer. Given this format, a function call could work as follows: void foo(PHYS_Line some_line){ unsigned short error = 0; float y = getYValueAt(5, some_line, &error); if(error) fooey(); else do_something_with_y(y); } My question pertains to the error. Note that the value returned is allowed to be negative. Returning -1 does not ensure that an error has occurred. I know that it is sometimes preferred to use the following method to track an error: float* getYValueAt(float x, PHYS_Line line); and then return NULL if an error occurs, but I believe this requires dynamic memory allocation, which seems even less sightly than the solution I was using. So, what is standard practice for an error occurring?

    Read the article

  • Linker Issues with boost::thread under linux using Eclipse and CMake

    - by OcularProgrammer
    I'm in the process of attempting to port some code across from PC to Ubuntu, and am having some issues due to limited experience developing under linux. We use CMake to generate all our build stuff. Under windows I'm making VS2010 projects, and under Linux I'm making Eclipse projects. I've managed to get my OpenCV stuff ported across successfully, but am having major headaches trying to port my threaded boost apps. Just so we're clear, the steps I have followed so-far on a clean Ubuntu 12 installation. (I've done 2 clean re-installs to try and fix potential library cock-ups, now I'm just giving up and asking): Install Eclipse and Eclipse CDT using my package manager Install CMake and CMake Gui using my package manager Install libboost-all-dev using my package manager So-far that's all I've done. I can create the eclipse project using CMake with no errors, so CMake is successfully finding my boost install. When I try and build through eclipse is when I get issues; The app I'm attempting to build uses boost::asio for some UDP I/O and boost::thread to create worker threads for the asio I/O services. I can successfully compile each module, but when I come to link I get spammed with errors such as: /usr/bin/c++ CMakeFiles/RE05DevelopmentDemo.dir/main.cpp.o CMakeFiles/RE05DevelopmentDemo.dir/RE05FusionListener/RE05FusionListener.cpp.o CMakeFiles/RE05DevelopmentDemo.dir/NewEye/NewEye.cpp.o -o RE05DevelopmentDemo -rdynamic -Wl,-Bstatic -lboost_system-mt -lboost_date_time-mt -lboost_regex-mt -lboost_thread-mt -Wl,-Bdynamic /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `void boost::call_once<void (*)()>(boost::once_flag&, void (*)()) [clone .constprop.98]': make[2]: Leaving directory `/home/david/Code/Build/Support/RE05DevDemo' (.text+0xc8): undefined reference to `pthread_key_create' /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `boost::this_thread::interruption_enabled()': (.text+0x540): undefined reference to `pthread_getspecific' make[1]: Leaving directory `/home/david/Code/Build/Support/RE05DevDemo' /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `boost::this_thread::disable_interruption::disable_interruption()': (.text+0x570): undefined reference to `pthread_getspecific' /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `boost::this_thread::disable_interruption::disable_interruption()': (.text+0x59f): undefined reference to `pthread_getspecific' Some Gotchas that I have collected from other StackOverflow posts and have already checked: The boost libs are all present at /usr/lib I am not getting any compile errors for inability to find the boost headers, so they must be getting found. I am trying to link statically, but I believe eclipse should be passing the correct arguments to make that happen since my CMakeLists.txt includes SET(Boost_USE_STATIC_LIBS ON) I'm officially out of ideas here, I have tried doing local builds of boost and a bunch of other stuff with no more success. I even re-installed Ubuntu to ensure I haven't completely fracked the libs directories and links with multiple weird versions or anything else. Any help would be muchly appreciated.

    Read the article

< Previous Page | 301 302 303 304 305 306 307 308 309 310 311 312  | Next Page >