Search Results

Search found 10494 results on 420 pages for 'beyond the documentation'.

Page 329/420 | < Previous Page | 325 326 327 328 329 330 331 332 333 334 335 336  | Next Page >

  • generated service mock: everything but RhinoMocks fails?

    - by hko
    I have the "quest" to search for the next Mocking Framework for my company, and basically it's down to NSubstitute (simplest syntax, but no strict mocks), FakeItEasy(best reviews, Roy Osherove bonus, and slightly better lib support than NSubstitute), Moq (best "other libs support", biggest featureset, downside: mock.Object). We definitely want to move on from RhinoMocks, e.g. because of the unusefull interactiontest error messages (it should tell me what the parameter was instead, when a verification fails). So I was pretty surprised the other day (that was yesterday) when I found out RhinoMocks could do a thing where every other mock framework fails at: Mocking an autogenerated SomethingService (a typical VS autogenerated service with a default construtor in a partial class). Please don't argue about the design.. I intend to write lightweight integration tests (and some unit tests), and I can't mess around with the service, the product is installed on too many customers system. See this code: // here the NSubstitute and FakeItEasy equivalents throw an exception.. see below TicketStoreService fakeTicketStoreService = MockRepository.GenerateMock<TicketStoreService>(); fakeTicketStoreService.Expect(service => service.DoSomething(Arg.Is(new Guid())).Return(new Guid()); fakeTicketStoreService.DoSomething(Arg.Is(new Guid())); fakeTicketStoreService.VerifyAllExpectations(); Note that DoSomething is a non-virtual methodcall in an autogenerated class. So it shouldn't work, according to common knowledge. But it does. Problem is that it's the only (non commercial) framework that can do this: Rhino.Mocks works, and verification works too FakeItEasy says it doesn't find a default constructor (probably just wrong exception message): No default constructor was found on the type SomeNamespace.TicketStoreService Moq gives something sane and understandable: Invalid setup on a non-virtual (overridable in VB) member: service=> service.DoSomething Nsubstitute gives a message System.NotSupportedException: Cannot serialize member System.ComponentModel.Component.Site of type System.ComponentModel.ISite because it is an interface. I'm really wondering what's going on here with the frameworks, except Moq. The "fancy new" frameworks seem to have an initial perf hit too, probably preparing some Type cache and serializing stuff, whilst RhinoMocks somehow manages to create a very "slim" mock without recursion. I have to admit I didn't like RhinoMocks very well, but here it shines.. unfortunately. So, is there a way to get that to work with newer (non-commercial!) mocking frameworks, or somehow get a sane error message out of Rhino.Mocks? And why can Rhino.Mocks achieve this, when clearly every Mocking framework states it can only work with virtual methods when given a concrete class? Let's not derail the discussion by talking about alternative approaches like Extract&Override or runtime-proxy Mocking frameworks like JustMock/TypeMock/Moles or the new Fakes framework, I know these, but that would be less ideal solutions, for reasons beyond this topic. Any help appreciated..

    Read the article

  • Autocomplete server-side implementation

    - by toluju
    What is a fast and efficient way to implement the server-side component for an autocomplete feature in an html input box? I am writing a service to autocomplete user queries in our web interface's main search box, and the completions are displayed in an ajax-powered dropdown. The data we are running queries against is simply a large table of concepts our system knows about, which matches roughly with the set of wikipedia page titles. For this service obviously speed is of utmost importance, as responsiveness of the web page is important to the user experience. The current implementation simply loads all concepts into memory in a sorted set, and performs a simple log(n) lookup on a user keystroke. The tailset is then used to provide additional matches beyond the closest match. The problem with this solution is that it does not scale. It currently is running up against the VM heap space limit (I've set -Xmx2g, which is about the most we can push on our 32 bit machines), and this prevents us from expanding our concept table or adding more functionality. Switching to 64-bit VMs on machines with more memory isn't an immediate option. I've been hesitant to start working on a disk-based solution as I am concerned that disk seek time will kill performance. Are there possible solutions that will let me scale better, either entirely in memory or with some fast disk-backed implementations? Edits: @Gandalf: For our use case it is important the the autocompletion is comprehensive and isn't just extra help for the user. As for what we are completing, it is a list of concept-type pairs. For example, possible entries are [("Microsoft", "Software Company"), ("Jeff Atwood", "Programmer"), ("StackOverflow.com", "Website")]. We are using Lucene for the full search once a user selects an item from the autocomplete list, but I am not yet sure Lucene would work well for the autocomplete itself. @Glen: No databases are being used here. When I'm talking about a table I just mean the structured representation of my data. @Jason Day: My original implementation to this problem was to use a Trie, but the memory bloat with that was actually worse than the sorted set due to needing a large number of object references. I'll read on the ternary search trees to see if it could be of use.

    Read the article

  • What is the difference between NULL in C++ and null in Java?

    - by Stephano
    I've been trying to figure out why C++ is making me crazy typing NULL. Suddenly it hits me the other day; I've been typing null (lower case) in Java for years. Now suddenly I'm programming in C++ and that little chunk of muscle memory is making me crazy. Wikiperipatetic defines C++ NULL as part of the stddef: A macro that expands to a null pointer constant. It may be defined as ((void*)0), 0 or 0L depending on the compiler and the language. Sun's docs tells me this about Java's "null literal": The null type has one value, the null reference, represented by the literal null, which is formed from ASCII characters. A null literal is always of the null type. So this is all very nice. I know what a null pointer reference is, and thank you for the compiler notes. Now I'm a little fuzzy on the idea of a literal in Java so I read on... A literal is the source code representation of a fixed value; literals are represented directly in your code without requiring computation. There's also a special null literal that can be used as a value for any reference type. null may be assigned to any variable, except variables of primitive types. There's little you can do with a null value beyond testing for its presence. Therefore, null is often used in programs as a marker to indicate that some object is unavailable. Ok, so I think I get it now. In C++ NULL is a macro that, when compiled, defines the null pointer constant. In Java, null is a fixed value that any non-primitive can be assigned too; great for testing in a handy if statement. Java does not have pointers, so I can see why they kept null a simple value rather than anything fancy. But why did java decide to change the all caps NULL to null? Furthermore, am I missing anything here?

    Read the article

  • Move namespace declaration from payload to envelope on an axis created web service

    - by rmarimon
    I just created a web service client using axis and eclipse that does not work with my web service provider. The message created by the web service client looks like this: <?xml version="1.0" encoding="UTF-8"?> <soapenv:Envelope xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance"> <soapenv:Body> <enviarMensajeRequest xmlns="http://www.springframework.org/spring-ws/Imk-Zenkiu-Services"> <usuario>someuser</usuario> <clave>somepassword</clave> <mensaje>somemessage</mensaje> <contacto> <buzonSMS>somenumber</buzonSMS> <primerNombre>somefirstname</primerNombre> <primerApellido>somelastname</primerApellido> </contacto> </enviarMensajeRequest> </soapenv:Body> </soapenv:Envelope> I see nothing wrong with the message but my provider insists the message should be: <?xml version="1.0" encoding="UTF-8"?> <soapenv:Envelope xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:imk="http://www.springframework.org/spring-ws/Imk-Zenkiu-Services"> <soapenv:Body> <imk:enviarMensajeRequest> <imk:usuario>someuser</imk:usuario> <imk:clave>somepassword</imk:clave> <imk:mensaje>somemessage</imk:mensaje> <imk:contacto> <imk:buzonSMS>somenumber</imk:buzonSMS> <imk:primerNombre>somefirstname</imk:primerNombre> <imk:primerApellido>somelastname</imk:primerApellido> </imk:contacto> </imk:enviarMensajeRequest> </soapenv:Body> </soapenv:Envelope> Notice the namespace declaration moving from the enviarMensajeRequest to the soapenv:Envelope and the qualification with imk: on the parameters. I've tried many combinations on the process but my web service, wsdl and xml knowledge is very limited. The provider says that they can't help beyond telling me this. Any ideas? Perhaps a different framework that I can use to create the correct client.

    Read the article

  • UITableView: Handle cell selection in a mixed cell table view static and dynamic cells

    - by AlexR
    I am trying to mix dynamic and static cells in a grouped table view: I would like to get two sections with static cells at the top followed by a section of dynamic cells (please refer to the screenshot below). I have set the table view contents to static cells. Edit Based on AppleFreak's advice I have changed my code as follows: - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell; if (indexPath.section <= 1) { // section <= 1 indicates static cells cell = [super tableView:tableView cellForRowAtIndexPath:indexPath]; } else { // section > 1 indicates dynamic cells CellIdentifier = [NSString stringWithFormat:@"section%idynamic",indexPath.section]; cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier forIndexPath:indexPath]; } return cell; } However, my app crashes with error message Terminating app due to uncaught exception 'NSInternalInconsistencyException', reason: 'UITableView dataSource must return a cell from tableView:cellForRowAtIndexPath:' for section 0 and row 0. The cell returned from cell = [super tableView:tableView cellForRowAtIndexPath:indexPath] for section 0 and row 0 is nil. What is wrong with my code? Could there be any problems with my outlets? I haven't set any outlets because I am subclassing UITableViewController and supposedly do not any outlets for tableview to be set (?). Any suggestions on how to better do it? Edit II I have recreated my scene in storyboard (please refer to my updated screen shot above) and rewritten the view controller in order to start from a new base. I have also read the description in Apple's forum as applefreak suggested. However, I run in my first problem with the method numberOfSectionsInTableView:tableView, in which I increment the number of static sections (two) by one. - (NSInteger)numberOfSectionsInTableView:(UITableView *)tableView { return [super numberOfSectionsInTableView:tableView] + 1 ; } The app crashed with the error message: Terminating app due to uncaught exception 'NSRangeException', reason: '* -[__NSArrayI objectAtIndex:]: index 2 beyond bounds [0 .. 1]' Why is this code not working for me even though I followed Apple's and applefreak recommendations? It is possible that the tableView has changed a bit in iOS 6? Solution: I got this to work now using AppleFreaks code sample in his answer below. Thank you, AppleFreak! Edit III: Cell Selection: How can I handle cell selection in a mixed (dynamic and static cells) cell table view? When do I call super and when do I call self tableView? When I use [[super tableView] selectRowAtIndexPath:indexPath animated:NO scrollPosition:UITableViewScrollPositionNone] and try to check for the selected index paths with: UITableView *tableView = [super tableView]; if ( [[tableView indexPathForSelectedRow] isEqual:customGrowthIndexPath] ) { .. } I get an return value of nil. As I can't find the source of my error, I really would appreciate your help

    Read the article

  • Issues adding search to iPhone app

    - by Graeme
    Hi, Basically I'm trying to add a search function to my iPhone app, but I'm not having much luck at the moment. I've downloaded the Apple provided Table Search app, and have copied across the code to mine. It builds OK, but here's the problem. Unlike the Apple example, all my data is stored in an array, that is accessed by calling [ciParser.currentArray]. Any ideas on how to change the code to suit my needs? I'm getting an error "Terminating app due to uncaught exception 'NSRangeException', reason: '* -[NSCFArray objectAtIndex:]: index (0) beyond bounds (0)'" whenever I click on the search bar and the app exits. Below is the code in particular that the debugger highlights as being troublesome. Apparently this error means the database trying to be searched is empty, but I could be wrong. FYI my app downloads and parsers an RSS feed using a class which is referenced by ciParser - which in turn stores the downloaded content in an array that I need to search. // Customize the appearance of table view cells. - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithStyle:UITableViewCellStyleDefault reuseIdentifier:CellIdentifier] autorelease]; } /* If the requesting table view is the search display controller's table view, configure the cell using the filtered content, otherwise use the main list. */ CurrentItem * nextCurrentItem=[ciParser.currentArray objectAtIndex:indexPath.row]; if (tableView == self.searchDisplayController.searchResultsTableView) { (Code which debugger points to as being wrong) nextCurrentItem = [self.filteredListContent objectAtIndex:indexPath.row]; } else { nextCurrentItem = [ciParser.currentArray objectAtIndex:indexPath.row]; } NSString*settingValue = [[NSUserDefaults standardUserDefaults]stringForKey:@"state"]; if ([settingValue isEqualToString:@"New South Wales"]) { cell.textLabel.text=nextCurrentItem.title; } else if ([settingValue isEqualToString:@"Western Australia"]) { cell.textLabel.text=@"The FESA does not provide any Current Incident reports."; } else if ([settingValue isEqualToString:@"Victoria"]) { cell.textLabel.text=nextCurrentItem.title; } else if ([settingValue isEqualToString:@"South Australia"]) { cell.textLabel.text=nextCurrentItem.title; } else if ([settingValue isEqualToString:@"Tasmania"]) { cell.textLabel.text=nextCurrentItem.title; } // Set up the cell... [cell setAccessoryType:UITableViewCellAccessoryDisclosureIndicator]; return cell; }

    Read the article

  • Blackberry ListField Text Wrapping - only two lines.

    - by Diego Tori
    Within my ListField, I want to be able to take any given long String, and just be able to wrap the first line within the width of the screen, and just take the remaining string and display it below and ellipsis the rest. Right now, this is what I'm using to detect wrapping within my draw paint call: int totalWidth = 0; int charWidth = 0; int lastIndex = 0; int spaceIndex = 0; int lineIndex = 0; String firstLine = ""; String secondLine = ""; boolean isSecondLine = false; for (int i = 0; i < longString.length(); i++){ charWidth = Font.getDefault().getAdvance(String.valueOf(longString.charAt(i))); //System.out.println("char width: " + charWidth); if(longString.charAt(i) == ' ') spaceIndex = i; if((charWidth + totalWidth) > (this.getWidth()-32)){ //g.drawText(longString.substring(lastIndex, spaceIndex), xpos, y +_padding, DrawStyle.LEFT, w - xpos); lineIndex++; System.out.println("current lines to draw: " + lineIndex); /*if (lineIndex = 2){ int idx = i; System.out.println("first line " + longString.substring(lastIndex, spaceIndex)); System.out.println("second line " + longString.substring(spaceIndex+1, longString.length())); }*/ //firstLine = longString.substring(lastIndex, spaceIndex); firstLine = longString.substring(0, spaceIndex); //System.out.println("first new line: " +firstLine); //isSecondLine=true; //xpos = 0; //y += Font.getDefault().getHeight(); i = spaceIndex + 1; lastIndex = i; System.out.println("Rest of string: " + longString.substring(lastIndex, longString.length())); charWidth = 0; totalWidth = 0; } totalWidth += charWidth; System.out.println("total width: " + totalWidth); //g.drawText(longString.substring(lastIndex, i+1), xpos, y + (_padding*3)+4, DrawStyle.ELLIPSIS, w - xpos); //secondLine = longString.substring(lastIndex, i+1); secondLine = longString.substring(lastIndex, longString.length()); //isSecondLine = true; } Now this does a great job of actually wrapping any given string (assuming the y values were properly offsetted and it only drew the text after the string width exceeded the screen width, as well as the remaining string afterwards), however, every time I try to get the first two lines, it always ends up returning the last two lines of the string if it goes beyond two lines. Is there a better way to do this sort of thing, since I am fresh out of ideas?

    Read the article

  • Switch case assembly level code

    - by puffadder
    Hi All, I am programming C on cygwin windows. After having done a bit of C programming and getting comfortable with the language, I wanted to look under the hood and see what the compiler is doing for the code that I write. So I wrote down a code block containing switch case statements and converted them into assembly using: gcc -S foo.c Here is the C source: switch(i) { case 1: { printf("Case 1\n"); break; } case 2: { printf("Case 2\n"); break; } case 3: { printf("Case 3\n"); break; } case 4: { printf("Case 4\n"); break; } case 5: { printf("Case 5\n"); break; } case 6: { printf("Case 6\n"); break; } case 7: { printf("Case 7\n"); break; } case 8: { printf("Case 8\n"); break; } case 9: { printf("Case 9\n"); break; } case 10: { printf("Case 10\n"); break; } default: { printf("Nothing\n"); break; } } Now the resultant assembly for the same is: movl $5, -4(%ebp) cmpl $10, -4(%ebp) ja L13 movl -4(%ebp), %eax sall $2, %eax movl L14(%eax), %eax jmp *%eax .section .rdata,"dr" .align 4 L14: .long L13 .long L3 .long L4 .long L5 .long L6 .long L7 .long L8 .long L9 .long L10 .long L11 .long L12 .text L3: movl $LC0, (%esp) call _printf jmp L2 L4: movl $LC1, (%esp) call _printf jmp L2 L5: movl $LC2, (%esp) call _printf jmp L2 L6: movl $LC3, (%esp) call _printf jmp L2 L7: movl $LC4, (%esp) call _printf jmp L2 L8: movl $LC5, (%esp) call _printf jmp L2 L9: movl $LC6, (%esp) call _printf jmp L2 L10: movl $LC7, (%esp) call _printf jmp L2 L11: movl $LC8, (%esp) call _printf jmp L2 L12: movl $LC9, (%esp) call _printf jmp L2 L13: movl $LC10, (%esp) call _printf L2: Now, in the assembly, the code is first checking the last case (i.e. case 10) first. This is very strange. And then it is copying 'i' into 'eax' and doing things that are beyond me. I have heard that the compiler implements some jump table for switch..case. Is it what this code is doing? Or what is it doing and why? Because in case of less number of cases, the code is pretty similar to that generated for if...else ladder, but when number of cases increases, this unusual-looking implementation is seen. Thanks in advance.

    Read the article

  • Classes to Entities; Like-class inheritence problems

    - by Stacey
    Beyond work, some friends and I are trying to build a game of sorts; The way we structure some of it works pretty well for a normal object oriented approach, but as most developers will attest this does not always translate itself well into a database persistent approach. This is not the absolute layout of what we have, it is just a sample model given for sake of representation. The whole project is being done in C# 4.0, and we have every intention of using Entity Framework 4.0 (unless Fluent nHibernate can really offer us something we outright cannot do in EF). One of the problems we keep running across is inheriting things in database models. Using the Entity Framework designer, I can draw the same code I have below; but I'm sure it is pretty obvious that it doesn't work like it is expected to. To clarify a little bit; 'Items' have bonuses, which can be of anything. Therefore, every part of the game must derive from something similar so that no matter what is 'changed' it is all at a basic enough level to be hooked into. Sounds fairly simple and straightforward, right? So then, we inherit everything that pertains to the game from 'Unit'. Weights, Measures, Random (think like dice, maybe?), and there will be other such entities. Some of them are similar, but in code they will each react differently. We're having a really big problem with abstracting this kind of thing into a database model. Without 'Enum' support, it is proving difficult to translate into multiple tables that still share a common listing. One solution we've depicted is to use a 'key ring' type approach, where everything that attaches to a character is stored on a 'Ring' with a 'Key', where each Key has a Value that represents a type. This works functionally but we've discovered it becomes very sluggish and performs poorly. We also dislike this approach because it begins to feel as if everything is 'dumped' into one class; which makes management and logical structure difficult to adhere to. I was hoping someone else might have some ideas on what I could do with this problem. It's really driving me up the wall; To summarize; the goal is to build a type (Unit) that can be used as a base type (Table per Type) for generic reference across a relatively global scope, without having to dump everything into a single collection. I can use an Interface to determine actual behavior so that isn't too big of an issue. This is 'roughly' the same idea expressed in the Entity Framework.

    Read the article

  • C++ Virtual Constructor, without clone()

    - by Julien L.
    I want to perform "deep copies" of an STL container of pointers to polymorphic classes. I know about the Prototype design pattern, implemented by means of the Virtual Ctor Idiom, as explained in the C++ FAQ Lite, Item 20.8. It is simple and straightforward: struct ABC // Abstract Base Class { virtual ~ABC() {} virtual ABC * clone() = 0; }; struct D1 : public ABC { virtual D1 * clone() { return new D1( *this ); } // Covariant Return Type }; A deep copy is then: for( i = 0; i < oldVector.size(); ++i ) newVector.push_back( oldVector[i]->clone() ); Drawbacks As Andrei Alexandrescu states it: The clone() implementation must follow the same pattern in all derived classes; in spite of its repetitive structure, there is no reasonable way to automate defining the clone() member function (beyond macros, that is). Moreover, clients of ABC can possibly do something bad. (I mean, nothing prevents clients to do something bad, so, it will happen.) Better design? My question is: is there another way to make an abstract base class clonable without requiring derived classes to write clone-related code? (Helper class? Templates?) Following is my context. Hopefully, it will help understanding my question. I am designing a class hierarchy to perform operations on a class Image: struct ImgOp { virtual ~ImgOp() {} bool run( Image & ) = 0; }; Image operations are user-defined: clients of the class hierarchy will implement their own classes derived from ImgOp: struct CheckImageSize : public ImgOp { std::size_t w, h; bool run( Image &i ) { return w==i.width() && h==i.height(); } }; struct CheckImageResolution; struct RotateImage; ... Multiple operations can be performed sequentially on an image: bool do_operations( std::vector< ImgOp* > v, Image &i ) { std::for_each( v.begin(), v.end(), /* bind2nd(mem_fun(&ImgOp::run), i ...) don't remember syntax */ ); } int main( ... ) { std::vector< ImgOp* > v; v.push_back( new CheckImageSize ); v.push_back( new CheckImageResolution ); v.push_back( new RotateImage ); Image i; do_operations( v, i ); } If there are multiple images, the set can be split and shared over several threads. To ensure "thread-safety", each thread must have its own copy of all operation objects contained in v -- v becomes a prototype to be deep copied in each thread.

    Read the article

  • help Implementing Object Oriented ansi-C approach??

    - by No Money
    Hey there, I am an Intermediate programmer in Java and know some of the basics in C++. I recently started to scam over "C language" [please note that i emphasized on C language and want to stick with C as i found it to be a perfect tool, so no need for suggestions focusing on why should i move back to C++ or Java]. Moving on, I code an Object Oriented approach in C but kindda scramble with the pointers part. Please understand that I am just a noob trying to extend my knowledge beyond what i learned in High School. Here is my code..... #include <stdio.h> typedef struct per{ int privateint; char *privateString; struct per (*New) (); void (*deleteperOBJ) (struct t_person *); void (*setperNumber) ((struct*) t_person,int); void (*setperString) ((struct*) t_person,char *); void (*dumpperState) ((struct*) t_person); }t_person; void setperNumber(t_person *const per,int num){ if(per==NULL) return; per->privateint=num; } void setperString(t_person *const per,char *string){ if(per==NULL) return; per->privateString=string; } void dumpperState(t_person *const per){ if(per==NULL) return; printf("value of private int==%d\n", per->privateint); printf("value of private string==%s\n", per->privateString); } void deleteperOBJ(struct t_person *const per){ free((void*)t_person->per); t_person ->per = NULL; } main(){ t_person *const per = (struct*) malloc(sizeof(t_person)); per = t_person -> struct per -> New(); per -> setperNumber (t_person *per, 123); per -> setperString(t_person *per, "No money"); dumpperState(t_person *per); deleteperOBJ(t_person *per); } Just to warn you, this program has several errors and since I am a beginner I couldn't help except to post this thread as a question. I am looking forward for assistance. Thanks in advance.

    Read the article

  • jquery 1.4.1 breaks my slideshow

    - by JMC Creative
    After toying with the jquery slideshow extension, I created my own that better suited my purposes ( I didn't like that all the images needed to load at the beginning for instance). Now, upon upgrading to jQuery 1.4.2 (I know I'm late), the slideshow loads the first image fine ( from the line$('div#slideshow img#ssone').fadeIn(1500); towards the bottom), but doesn't do anything beyond that. Does anyone have any idea which jquery construct is killing my script? The live page is at lplonline.org which is using 1.3.2 for the time being. Thanks in advance. Array.prototype.random = function( r ) { var i = 0, l = this.length; if( !r ) { r = this.length; } else if( r > 0 ) { r = r % l; } else { i = r; r = l + r % l; } return this[ Math.floor( r * Math.random() - i ) ]; }; jQuery(function($){ var imgArr = new Array(); imgArr[1] = "wp-content/uploads/rotator/Brbrshop4-hrmnywkshp72006.jpg"; imgArr[2] = "wp-content/uploads/rotator/IMGA0125.JPG"; //etc, etc, about 30 of these are created dynamically from a db function randImgs () { var randImg = imgArr.random(); var img1 = $('div#slideshow img#ssone'); var img2 = $('div#slideshow img#sstwo'); if(img1.is(':visible') ) { img2.fadeIn(1500); img1.fadeOut(1500,function() { img1.attr({src : randImg}); }); } else { img1.fadeIn(1500); img2.fadeOut(1500,function() { img2.attr({src : randImg}); }); } } setInterval(randImgs,9000); // 9 SECONDS $('div#slideshow img#ssone').fadeIn(1500); }); </script> <div id="slideshow"> <img id="ssone" style="display:none;" src="wp-content/uploads/rotator/quote-investments.png" alt="" /> <img id="sstwo" style="display:none;" src="wp-content/uploads/rotator/quote-drugs.png" alt="" /> </div>

    Read the article

  • approximating log10[x^k0 + k1]

    - by Yale Zhang
    Greetings. I'm trying to approximate the function Log10[x^k0 + k1], where .21 < k0 < 21, 0 < k1 < ~2000, and x is integer < 2^14. k0 & k1 are constant. For practical purposes, you can assume k0 = 2.12, k1 = 2660. The desired accuracy is 5*10^-4 relative error. This function is virtually identical to Log[x], except near 0, where it differs a lot. I already have came up with a SIMD implementation that is ~1.15x faster than a simple lookup table, but would like to improve it if possible, which I think is very hard due to lack of efficient instructions. My SIMD implementation uses 16bit fixed point arithmetic to evaluate a 3rd degree polynomial (I use least squares fit). The polynomial uses different coefficients for different input ranges. There are 8 ranges, and range i spans (64)2^i to (64)2^(i + 1). The rational behind this is the derivatives of Log[x] drop rapidly with x, meaning a polynomial will fit it more accurately since polynomials are an exact fit for functions that have a derivative of 0 beyond a certain order. SIMD table lookups are done very efficiently with a single _mm_shuffle_epi8(). I use SSE's float to int conversion to get the exponent and significand used for the fixed point approximation. I also software pipelined the loop to get ~1.25x speedup, so further code optimizations are probably unlikely. What I'm asking is if there's a more efficient approximation at a higher level? For example: Can this function be decomposed into functions with a limited domain like log2((2^x) * significand) = x + log2(significand) hence eliminating the need to deal with different ranges (table lookups). The main problem I think is adding the k1 term kills all those nice log properties that we know and love, making it not possible. Or is it? Iterative method? don't think so because the Newton method for log[x] is already a complicated expression Exploiting locality of neighboring pixels? - if the range of the 8 inputs fall in the same approximation range, then I can look up a single coefficient, instead of looking up separate coefficients for each element. Thus, I can use this as a fast common case, and use a slower, general code path when it isn't. But for my data, the range needs to be ~2000 before this property hold 70% of the time, which doesn't seem to make this method competitive. Please, give me some opinion, especially if you're an applied mathematician, even if you say it can't be done. Thanks.

    Read the article

  • how to refactor user-permission system?

    - by John
    Sorry for lengthy question. I can't tell if this should be a programming question or a project management question. Any advice will help. I inherited a reasonably large web project (1 year old) from a solo freelancer who architected it then abandoned it. The project was a mess, but I cleaned up what I could, and now the system is more maintainable. I need suggestions on how to extend the user-permission system. As it is now, the database has a t_user table with the column t_user.membership_type. Currently, there are 4 membership types with the following properties: 3 of the membership types are almost functionally the same, except for the different monthly fees each must pay 1 of the membership type is a "fake-user" type which has limited access ( different business logic also applies) With regards to the fake-user type, if you look in the system's business logic files, you will see a lot of hard-coded IF statements that do something like if (fake-user) { // do something } else { // a paid member of type 1,2 or 3 // proceed normally } My client asked me to add 3 more membership types to the system, each of them with unique features to be implemented this month, and substantive "to-be-determined" features next month. My first reaction is that I need to refactor the user-permission system. But it concerns me that I don't have enough information on the "to-be-determined" membership type features for next month. Refactoring the user-permission system will take a substantive amount of time. I don't want to refactor something and throw it out the following month. I get substantive feature requests on a monthly basis that come out of the blue. There is no project road map. I've asked my client to provide me with a roadmap of what they intend to do with the new membership types, but their answer is along the lines of "We just want to do [feature here] this month. We'll think of something new next month." So questions that come to mind are: 1) Is it dangerous for me to refactor the user permission system not knowing what membership type features exist beyond a month from now? 2) Should I refactor the user permission system regardless? Or just continue adding IF statements as needed in all my controller files? Or can you recommend a different approach to user permission systems? Maybe role-based ? 3) Should this project have a road map? For a 1 year old project like mine, how far into the future should this roadmap project? 4) Any general advice on the best way to add 3 new membership types?

    Read the article

  • Mocking methods that call other methods Still hit database.Can I avoid it?

    - by devnet247
    Hi, It has been decided to write some unit tests using moq etc..It's lots of legacy code c# (this is beyond my control so cannot answer the whys of this) Now how do you cope with a scenario when you dont want to hit the database but you indirectly still hit the database? This is something I put together it's not the real code but gives you an idea. How would you deal with this sort of scenario? Basically calling a method on a mocked interface still makes a dal call as inside that method there are other methods not part of that interface?Hope it's clear [TestFixture] public class Can_Test_this_legacy_code { [Test] public void Should_be_able_to_mock_login() { var mock = new Mock<ILoginDal>(); User user; var userName = "Jo"; var password = "password"; mock.Setup(x => x.login(It.IsAny<string>(), It.IsAny<string>(),out user)); var bizLogin = new BizLogin(mock.Object); bizLogin.Login(userName, password, out user); } } public class BizLogin { private readonly ILoginDal _login; public BizLogin(ILoginDal login) { _login = login; } public void Login(string userName, string password, out User user) { //Even if I dont want to this will call the DAL!!!!! var bizPermission = new BizPermission(); var permissionList = bizPermission.GetPermissions(userName); //Method I am actually testing _login.login(userName,password,out user); } } public class BizPermission { public List<Permission>GetPermissions(string userName) { var dal=new PermissionDal(); var permissionlist= dal.GetPermissions(userName); return permissionlist; } } public class PermissionDal { public List<Permission> GetPermissions(string userName) { //I SHOULD NOT BE GETTING HERE!!!!!! return new List<Permission>(); } } public interface ILoginDal { void login(string userName, string password,out User user); } public interface IOtherStuffDal { List<Permission> GetPermissions(); } public class Permission { public int Id { get; set; } public string Name { get; set; } } Any suggestions? Am I missing the obvious? Is this Untestable code? Very very grateful for any suggestions.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Backbone.js (model instanceof Model) via Chrome Extension

    - by Leoncelot
    Hey guys, This is my first time ever posting on this site and the problem I'm about to pose is difficult to articulate due to the set of variables required to arrive at it. Let me just quickly explain the framework I'm working with. I'm building a Chrome Extension using jQuery, jQuery-ui, and Backbone The entire JS suite for the extension is written in CoffeeScript and I'm utilizing Rails and the asset pipeline to manage it all. This means that when I want to deploy my extension code I run rake assets:precompile and copy the resulting compressed JS to my extensions Directory. The nice thing about this approach is that I can actually run the extension js from inside my Rails app by including the library. This is basically the same as my extensions background.js file which injects the js as a content script. Anyway, the problem I've recently encountered was when I tried testing my extension on my buddy's site, whiskeynotes.com. What I was noticing is that my backbone models were being mangled upon adding them to their respective collections. So something like this.collection.add(new SomeModel) created some nonsense version of my model. This code eventually runs into Backbone's prepareModel code _prepareModel: function(model, options) { options || (options = {}); if (!(model instanceof Model)) { var attrs = model; options.collection = this; model = new this.model(attrs, options); if (!model._validate(model.attributes, options)) model = false; } else if (!model.collection) { model.collection = this; } return model; }, Now, in most of the sites on which I've tested the extension, the result is normal, however on my buddy's site the !(model instance Model) evaluates to true even though it is actually an instance of the correct class. The consequence is a super messed up version of the model where the model's attributes is a reference to the models collection (strange right?). Needless to say, all kinds of crazy things were happening afterward. Why this is occurring is beyond me. However changing this line (!(model instanceof Model)) to (!(model instanceof Backbone.Model)) seems to fix the problem. I thought maybe it had something to do with the Flot library (jQuery graph library) creating their own version of 'Model' but looking through the source yielded no instances of it. I'm just curious as to why this would happen. And does it make sense to add this little change to the Backbone source? Update: I just realized that the "fix" doesn't actually work. I can also add that my backbone Models are namespaced in a wrapping object so that declaration looks something like class SomeNamespace.SomeModel extends Backbone.Model

    Read the article

  • Implementing Object Oriented: ansi-C approach

    - by No Money
    Hey there, I am an Intermediate programmer in Java and know some of the basics in C++. I recently started to scam over "C language" [please note that i emphasized on C language and want to stick with C as i found it to be a perfect tool, so no need for suggestions focusing on why should i move back to C++ or Java or any other crappy language (e.g: C#)]. Moving on, I code an Object Oriented approach in C but kindda scramble with the pointers part. Please understand that I am just a noob trying to extend my knowledge beyond what i learned in High School. Here is my code..... #include <stdio.h> typedef struct per{ int privateint; char *privateString; struct per (*New) (); void (*deleteperOBJ) (struct t_person *); void (*setperNumber) ((struct*) t_person,int); void (*setperString) ((struct*) t_person,char *); void (*dumpperState) ((struct*) t_person); }t_person; void setperNumber(t_person *const per,int num){ if(per==NULL) return; per->privateint=num; } void setperString(t_person *const per,char *string){ if(per==NULL) return; per->privateString=string; } void dumpperState(t_person *const per){ if(per==NULL) return; printf("value of private int==%d\n", per->privateint); printf("value of private string==%s\n", per->privateString); } void deleteperOBJ(struct t_person *const per){ free((void*)t_person->per); t_person ->per = NULL; } main(){ t_person *const per = (struct*) malloc(sizeof(t_person)); per = t_person -> struct per -> New(); per -> setperNumber (t_person *per, 123); per -> setperString(t_person *per, "No money"); dumpperState(t_person *per); deleteperOBJ(t_person *per); } Just to warn you, this program has several errors and since I am a beginner I couldn't help except to post this thread as a question. I am looking forward for assistance. Thanks in advance.

    Read the article

  • Project Euler #18 - how to brute force all possible paths in tree-like structure using Python?

    - by euler user
    Am trying to learn Python the Atlantic way and am stuck on Project Euler #18. All of the stuff I can find on the web (and there's a LOT more googling that happened beyond that) is some variation on 'well you COULD brute force it, but here's a more elegant solution'... I get it, I totally do. There are really neat solutions out there, and I look forward to the day where the phrase 'acyclic graph' conjures up something more than a hazy, 1 megapixel resolution in my head. But I need to walk before I run here, see the state, and toy around with the brute force answer. So, question: how do I generate (enumerate?) all valid paths for the triangle in Project Euler #18 and store them in an appropriate python data structure? (A list of lists is my initial inclination?). I don't want the answer - I want to know how to brute force all the paths and store them into a data structure. Here's what I've got. I'm definitely looping over the data set wrong. The desired behavior would be to go 'depth first(?)' rather than just looping over each row ineffectually.. I read ch. 3 of Norvig's book but couldn't translate the psuedo-code. Tried reading over the AIMA python library for ch. 3 but it makes too many leaps. triangle = [ [75], [95, 64], [17, 47, 82], [18, 35, 87, 10], [20, 4, 82, 47, 65], [19, 1, 23, 75, 3, 34], [88, 2, 77, 73, 7, 63, 67], [99, 65, 4, 28, 6, 16, 70, 92], [41, 41, 26, 56, 83, 40, 80, 70, 33], [41, 48, 72, 33, 47, 32, 37, 16, 94, 29], [53, 71, 44, 65, 25, 43, 91, 52, 97, 51, 14], [70, 11, 33, 28, 77, 73, 17, 78, 39, 68, 17, 57], [91, 71, 52, 38, 17, 14, 91, 43, 58, 50, 27, 29, 48], [63, 66, 4, 68, 89, 53, 67, 30, 73, 16, 69, 87, 40, 31], [04, 62, 98, 27, 23, 9, 70, 98, 73, 93, 38, 53, 60, 4, 23], ] def expand_node(r, c): return [[r+1,c+0],[r+1,c+1]] all_paths = [] my_path = [] for i in xrange(0, len(triangle)): for j in xrange(0, len(triangle[i])): print 'row ', i, ' and col ', j, ' value is ', triangle[i][j] ??my_path = somehow chain these together??? if my_path not in all_paths all_paths.append(my_path) Answers that avoid external libraries (like itertools) preferred.

    Read the article

  • How to setup Lucene/Solr for a B2B web app?

    - by Bill Paetzke
    Given: 1 database per client (business customer) 5000 clients Clients have between 2 to 2000 users (avg is ~100 users/client) 100k to 10 million records per database Users need to search those records often (it's the best way to navigate their data) Possibly relevant info: Several new clients each week (any time during business hours) Multiple web servers and database servers (users can login via any web server) Let's stay agnostic of language or sql brand, since Lucene (and Solr) have a breadth of support For Example: Joel Spolsky said in Podcast #11 that his hosted web app product, FogBugz On-Demand, uses Lucene. He has thousands of on-demand clients. And each client gets their own database. They use an index per client and store it in the client's database. I'm not sure on the details. And I'm not sure if this is a serious mod to Lucene. The Question: How would you setup Lucene search so that each client can only search within its database? How would you setup the index(es)? Where do you store the index(es)? Would you need to add a filter to all search queries? If a client cancelled, how would you delete their (part of the) index? (this may be trivial--not sure yet) Possible Solutions: Make an index for each client (database) Pro: Search is faster (than one-index-for-all method). Indices are relative to the size of the client's data. Con: I'm not sure what this entails, nor do I know if this is beyond Lucene's scope. Have a single, gigantic index with a database_name field. Always include database_name as a filter. Pro: Not sure. Maybe good for tech support or billing dept to search all databases for info. Con: Search is slower (than index-per-client method). Flawed security if query filter removed. One last thing: I would also accept an answer that uses Solr (the extension of Lucene). Perhaps it's better suited for this problem. Not sure.

    Read the article

  • How should I smooth the transition between these two states in flex/flashbuilder

    - by Joshua
    I have an item in which has two states, best described as open and closed, and they look like this: and And what I'd like to do is is smooth the transition between one state and the other, effectively by interpolating between the two points in a smooth manner (sine) to move the footer/button-block and then fade in the pie chart. However this is apparently beyond me and after wrestling with my inability to do so for an hour+ I'm posting it here :D So my transition block looks as follows <s:transitions> <s:Transition id="TrayTrans" fromState="*" toState="*"> <s:Sequence> <s:Move duration="400" target="{footer}" interpolator="{Sine}"/> <s:Fade duration="300" targets="{body}"/> </s:Sequence> </s:Transition> <s:Transition> <s:Rotate duration="3000" /> </s:Transition> </s:transitions> where {body} refers to the pie chart and {footer} refers to the footer/button-block. However this doesn't work so I don't really know what to do... Additional information which may be beneficial: The body block is always of fixed height (perhaps of use for the Xby variables in some effects?). It needs to work in both directions. Oh and the Sine block is defined above in declarations just as <s:Sine id="Sine">. Additionally! How would I go about setting the pie chart to rotate continually using these transition blocks? (this would occur without the labels on) Or is that the wrong way to go about it as it's not a transition as such? The effect I'm after is one where the pie chart rotates slowly without labels prior to a selection of a button below, but on selection the rotation stops and labels appear... Thanks a lot in advance! And apologies on greyscale, but I can't really decide on a colour scheme. Any suggestions welcome.

    Read the article

  • C++ abstract class template + type-specific subclass = trouble with linker

    - by user333279
    Hi there, The project in question is about different endpoints communicating with each other. An endpoint sends events (beyond the scope of the current problem) and can process incoming events. Each event is represented in a generic object as follows: #pragma interface ... // some includes template<typename T> class Event { public: Event(int senderId, Type type, T payload); // Type is an enum Event(int senderId, Type type, int priority, T payload); virtual ~Event(); virtual int getSenderId(); virtual int getPriority(); virtual T getPayload(); void setPriority(const int priority); protected: const int senderId; const Type type; const T payload; int priority; }; It has its implementing class with #pragma implementation tag. An endpoint is defined as follows: #pragma interface #include "Event.h" template<typename T> class AbstractEndPoint { public: AbstractEndPoint(int id); virtual ~AbstractEndPoint(); virtual int getId(); virtual void processEvent(Event<T> event) = 0; protected: const int id; }; It has its implementing class too, but only the constructor, destructor and getId() are defined. The idea is to create concrete endpoints for each different payload type. Therefore I have different payload objects and specific event classes for each type, e.g. Event<TelegramFormatA>, Event<TelegramFormatB> and ConcreteEndPoint for TelegramFormatA, ConcreteEndPoint for TelegramFormatB respectively. The latter classes are defined as class ConcreteEndPoint : AbstractEndPoint<TelegramFormatA> { ... } I'm using g++ 4.4.3 and ld 2.19. Everything compiles nicely, but the linker complaints about undefined references to type-specific event classes, like Event<TelegramFormatA>::Event(....) . I tried explicit instantiation using template class AbstractEndPoint<TelegramFormatA>; but couldn't get past the aforementioned linker errors. Any ideas would be appreciated.

    Read the article

  • refactoring this function in Java

    - by Joel
    Hi folks, I'm learning Java, and I know one of the big complaints about newbie programmers is that we make really long and involved methods that should be broken into several. Well here is one I wrote and is a perfect example. :-D. public void buildBall(){ /* sets the x and y value for the center of the canvas */ double i = ((getWidth() / 2)); double j = ((getHeight() / 2)); /* randomizes the start speed of the ball */ vy = 3.0; vx = rgen.nextDouble(1.0, 3.0); if (rgen.nextBoolean(.05)) vx = -vx; /* creates the ball */ GOval ball = new GOval(i,j,(2 *BALL_RADIUS),(2 * BALL_RADIUS)); ball.setFilled(true); ball.setFillColor(Color.RED); add(ball); /* animates the ball */ while(true){ i = (i + (vx* 2)); j = (j + (vy* 2)); if (i > APPLICATION_WIDTH-(2 * BALL_RADIUS)){ vx = -vx; } if (j > APPLICATION_HEIGHT-(2 * BALL_RADIUS)){ vy = -vy; } if (i < 0){ vx = -vx; } if (j < 0){ vy = -vy; } ball.move(vx + vx, vy + vy); pause(10); /* checks the edges of the ball to see if it hits an object */ colider = getElementAt(i, j); if (colider == null){ colider = getElementAt(i + (2*BALL_RADIUS), j); } if (colider == null){ colider = getElementAt(i + (2*BALL_RADIUS), j + (2*BALL_RADIUS)); } if (colider == null){ colider = getElementAt(i, j + (2*BALL_RADIUS)); } /* If the ball hits an object it reverses direction */ if (colider != null){ vy = -vy; /* removes bricks when hit but not the paddle */ if (j < (getHeight() -(PADDLE_Y_OFFSET + PADDLE_HEIGHT))){ remove(colider); } } } You can see from the title of the method that I started with good intentions of "building the ball". There are a few issues I ran up against: The problem is that then I needed to move the ball, so I created that while loop. I don't see any other way to do that other than just keep it "true", so that means any other code I create below this loop won't happen. I didn't make the while loop a different function because I was using those variables i and j. So I don't see how I can refactor beyond this loop. So my main question is: How would I pass the values of i and j to a new method: "animateBall" and how would I use ball.move(vx + vx, vy + vy); in that new method if ball has been declared in the buildBall method? I understand this is probably a simple thing of better understanding variable scope and passing arguments, but I'm not quite there yet...

    Read the article

  • stringindexoutofbounds with currency converter java program

    - by user1795926
    I am have trouble with a summary not showing up. I am supposed to modify a previous Java assignment by by adding an array of objects. Within the loop, instantiate each individual object. Make sure the user cannot keep adding another Foreign conversion beyond your array size. After the user selects quit from the menu, prompt if the user want to display a summary report. If they select ‘Y’ then, using your array of objects, display the following report: Item Conversion Dollars Amount 1 Japanese Yen 100.00 32,000.00 2 Mexican Peso 400.00 56,000.00 3 Canadian Dollar 100.00 156.00 etc. Number of Conversions = 3 There are no errors when I compile..but when I run the program it is fine until I hit 0 to end the conversion and have it ask if i want to see a summary. This error displays: Exception in thread "main" java.lang.StringIndexOutOfBoundsException: String index out of range: 0 at java.lang.String.charAt(String.java:658) at Lab8.main(Lab8.java:43) my code: import java.util.Scanner; import java.text.DecimalFormat; public class Lab8 { public static void main(String[] args) { final int Max = 10; String a; char summary; int c = 0; Foreign[] Exchange = new Foreign[Max]; Scanner Keyboard = new Scanner(System.in); Foreign.opening(); do { Exchange[c] = new Foreign(); Exchange[c].getchoice(); Exchange[c].dollars(); Exchange[c].amount(); Exchange[c].vertical(); System.out.println("\n" + Exchange[c]); c++; System.out.println("\n" + "Please select 1 through 4, or 0 to quit" + >"\n"); c= Keyboard.nextInt(); } while (c != 0); System.out.print("\nWould you like a summary of your conversions? (Y/N): "); a = Keyboard.nextLine(); summary = a.charAt(0); summary = Character.toUpperCase(summary); if (summary == 'Y') { System.out.println("\nCountry\t\tRate\t\tDollars\t\tAmount"); System.out.println("========\t\t=======\t\t=======\t\t========="); for (int i=0; i < Exchange.length; i++) System.out.println(Exchange[i]); Foreign.counter(); } } } I looked at line 43 and its this line: summary = a.charAt(0); But I am not sure what's wrong with it, can anyone point it out? Thank you.

    Read the article

  • Setting up Edimax EW-7206APg as Universal Repeater

    - by Ondra Žižka
    Hi, I've troubles setting up Edimax EW-7206APg as a Universal Repeater. I've read few manuals, but they are unclear on certain points. I've managed the repeater to get to a state when it's in a "connected" state. I've set the same WPA passphrase as the router has because I haven't seen any other place to set it at. These are my settings: System Uptime 0day:1h:33m:11s Hardware Version Rev. A Runtime Code Version 1.32 Wireless Configuration Mode Universal Repeater ESSID edimax Channel Number 6 Security WPA-shared key BSSID 00:c0:9f:40:bd:38 Associated Clients 0 Wireless Repeater Interface Configuration ESSID Dusan Security WPA BSSID 00:4f:62:23:8f:7e State Connected LAN Configuration IP Address 192.168.0.10 Subnet Mask 255.255.255.0 Default Gateway 192.168.0.1 MAC Address 00:c0:9f:40:bd:37 This is ipconfig /all: Prípona DNS podle pripojení . . . : riomail.cz Popis . . . . . . . . . . . . . . : Intel(R) PRO/Wireless 2200BG Network Connection Fyzická Adresa. . . . . . . . . . : 00-0E-35-3D-77-68 Protokol DHCP povolen . . . . . . : Ano Automatická konfigurace povolena : Ano Adresa IP . . . . . . . . . . . . : 192.168.0.5 Maska podsíte . . . . . . . . . . : 255.255.255.0 Výchozí brána . . . . . . . . . . : 192.168.0.1 Server DHCP . . . . . . . . . . . : 192.168.0.1 Servery DNS . . . . . . . . . . . : 94.74.192.252 94.74.192.244 I can ping the repeater, I can ping the root AP, but not a DNS server or any other IP beyond the root AP. Anyone has an idea what's wrong? Thanks, Ondra

    Read the article

< Previous Page | 325 326 327 328 329 330 331 332 333 334 335 336  | Next Page >