Search Results

Search found 1552 results on 63 pages for 'homework'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 35/63 | < Previous Page | 31 32 33 34 35 36 37 38 39 40 41 42  | Next Page >

  • errorerror C2059: syntax error : ']', i cant figure out why this coming up in c++

    - by user320950
    void display_totals(); int exam1[100][3];// array that can hold 100 numbers for 1st column int exam2[100][3];// array that can hold 100 numbers for 2nd column int exam3[100][3];// array that can hold 100 numbers for 3rd column int main() { int go,go2,go3; go=read_file_in_array; go2= calculate_total(exam1[],exam2[],exam3[]); go3=display_totals; cout << go,go2,go3; return 0; } void display_totals() { int grade_total; grade_total=calculate_total(exam1[],exam2[],exam3[]); } int calculate_total(int exam1[],int exam2[],int exam3[]) { int calc_tot,above90=0, above80=0, above70=0, above60=0,i,j; calc_tot=read_file_in_array(exam[100][3]); exam1[][]=exam[100][3]; exam2[][]=exam[100][3]; exam3[][]=exam[100][3]; for(i=0;i<100;i++); { if(exam1[i] <=90 && exam1[i] >=100) { above90++; cout << above90; } } return exam1[i],exam2[i],exam3[i]; } int read_file_in_array(int exam[100][3]) { ifstream infile; int num, i=0,j=0; infile.open("grades.txt");// file containing numbers in 3 columns if(infile.fail()) // checks to see if file opended { cout << "error" << endl; } while(!infile.eof()) // reads file to end of line { for(i=0;i<100;i++); // array numbers less than 100 { for(j=0;j<3;j++); // while reading get 1st array or element infile >> exam[i][j]; cout << exam[i][j] << endl; } } infile.close(); return exam[i][j]; }

    Read the article

  • toString() Method question

    - by cdominguez13
    I've been working on this assignemnt here's code: public class Student { private String fname; private String lname; private String studentId; private double gpa; public Student(String studentFname,String studentLname,String stuId,double studentGpa) { fname = studentFname; lname = studentLname; studentId = stuId; gpa = studentGpa; } public double getGpa() { return gpa; } public String getStudentId() { return studentId; } public String getName() { return lname + ", " + fname; } public void setGpa(double gpaReplacement) { if (gpaReplacement >= 0.0 && gpaReplacement <= 4.0) gpa = gpaReplacement; else System.out.println("Invalid GPA! Please try again."); System.exit(0); } } Now I need to create a toString() method that returns a String formatted something like this: Name: Wilson, Mary Ann ID number: 12345 GPA: 3.5

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Trouble with arraylist and stack

    - by helloman
    I am having trouble starting out this program, I am suppose to write a program that will create an ArrayList, asking the user for 10 numbers. Then this will be put into the Array. Then after the list is made navigate it and if a number is even remove it from the ArrayList and copy it to a stack of integers. import java.io.* ; import java.util.*; public class Test { public static void main(String[] args){ Scanner input = new Scanner (System.in); ArrayList<Integer> integers = new ArrayList<Integer>(); System.out.print ("Enter Number: \n"); for (int i = 0; i < 10; i++){ integers.add(input.nextInt()); } for (int i = 0; i < 10 ; i++){ if (i %2==0) } } }

    Read the article

  • Can't get Jacobi algorithm to work in Objective-C

    - by Chris Long
    Hi, For some reason, I can't get this program to work. I've had other CS majors look at it and they can't figure it out either. This program performs the Jacobi algorithm (you can see step-by-step instructions and a MATLAB implementation here). BTW, it's different from the Wikipedia article of the same name. Since NSArray is one-dimensional, I added a method that makes it act like a two-dimensional C array. After running the Jacobi algorithm many times, the diagonal entries in the NSArray (i[0][0], i[1][1], etc.) are supposed to get bigger and the others approach 0. For some reason though, they all increase exponentially. For instance, i[2][4] should equal 0.0000009, not 9999999, while i[2][2] should be big. Thanks in advance, Chris NSArray+Matrix.m @implementation NSArray (Matrix) @dynamic offValue, transposed; - (double)offValue { double sum = 0.0; for ( MatrixItem *item in self ) if ( item.nonDiagonal ) sum += pow( item.value, 2.0 ); return sum; } - (NSMutableArray *)transposed { NSMutableArray *transpose = [[[NSMutableArray alloc] init] autorelease]; int i, j; for ( i = 0; i < 5; i++ ) { for ( j = 0; j < 5; j++ ) { [transpose addObject:[self objectAtRow:j andColumn:i]]; } } return transpose; } - (id)objectAtRow:(NSUInteger)row andColumn:(NSUInteger)column { NSUInteger index = 5 * row + column; return [self objectAtIndex:index]; } - (NSMutableArray *)multiplyWithMatrix:(NSArray *)array { NSMutableArray *result = [[NSMutableArray alloc] init]; int i = 0, j = 0, k = 0; double value; for ( i = 0; i < 5; i++ ) { value = 0.0; for ( j = 0; j < 5; j++ ) { for ( k = 0; k < 5; k++ ) { MatrixItem *firstItem = [self objectAtRow:i andColumn:k]; MatrixItem *secondItem = [array objectAtRow:k andColumn:j]; value += firstItem.value * secondItem.value; } MatrixItem *item = [[MatrixItem alloc] initWithValue:value]; item.row = i; item.column = j; [result addObject:item]; } } return result; } @end Jacobi_AlgorithmAppDelegate.m // ... - (void)jacobiAlgorithmWithEntry:(MatrixItem *)entry { MatrixItem *b11 = [matrix objectAtRow:entry.row andColumn:entry.row]; MatrixItem *b22 = [matrix objectAtRow:entry.column andColumn:entry.column]; double muPlus = ( b22.value + b11.value ) / 2.0; muPlus += sqrt( pow((b22.value - b11.value), 2.0) + 4.0 * pow(entry.value, 2.0) ); Vector *u1 = [[[Vector alloc] initWithX:(-1.0 * entry.value) andY:(b11.value - muPlus)] autorelease]; [u1 normalize]; Vector *u2 = [[[Vector alloc] initWithX:-u1.y andY:u1.x] autorelease]; NSMutableArray *g = [[[NSMutableArray alloc] init] autorelease]; for ( int i = 0; i <= 24; i++ ) { MatrixItem *item = [[[MatrixItem alloc] init] autorelease]; if ( i == 6*entry.row ) item.value = u1.x; else if ( i == 6*entry.column ) item.value = u2.y; else if ( i == ( 5*entry.row + entry.column ) || i == ( 5*entry.column + entry.row ) ) item.value = u1.y; else if ( i % 6 == 0 ) item.value = 1.0; else item.value = 0.0; [g addObject:item]; } NSMutableArray *firstResult = [[g.transposed multiplyWithMatrix:matrix] autorelease]; matrix = [firstResult multiplyWithMatrix:g]; } // ...

    Read the article

  • problem with join SQL Server 2000

    - by eyalb
    I have 3 tables - Items, Props, Items_To_Props i need to return all items that match all properties that i send example items 1 2 3 4 props T1 T2 T3 items_to_props 1 T1 1 T2 1 T3 2 T1 3 T1 when i send T1,T2 i need to get only item 1

    Read the article

  • single user dungeon

    - by mario estes
    hey dudes, my first question anyway, i have made a single user dungeon and am looking to change it in to a multi user dungoen how can i do this by the way im using python to make the sud in to a mud lol

    Read the article

  • Please help me in creating an update query

    - by Rajesh Rolen- DotNet Developer
    I have got a table which contains 5 column and query requirements: update row no 8 (or id=8) set its column 2, column 3's value from id 9th column 2, column 3 value. means all value of column 2, 3 should be shifted to column 2, 3 of upper row (start from row no 8) and value of last row's 2, 3 will be null For example, with just 3 rows, the first row is untouched, the second to N-1th rows are shifted once, and the Nth row has nulls. id math science sst hindi english 1 11 12 13 14 15 2 21 22 23 24 25 3 31 32 33 34 35 The result of query of id=2 should be: id math science sst hindi english 1 11 12 13 14 15 2 31 32 23 24 25 //value of 3rd row (col 2,3) shifted to row 2 3 null null 33 34 35 This process should run for all rows whose id 2 Please help me to create this update query I am using MS sqlserver 2005

    Read the article

  • Why does this code sample produce a memory leak?

    - by citronas
    In the university we were given the following code sample and we were being told, that there is a memory leak when running this code. The sample should demonstrate that this is a situation where the garbage collector can't work. As far as my object oriented programming goes, the only codeline able to create a memory leak would be items=Arrays.copyOf(items,2 * size+1); The documentation says, that the elements are copied. Does that mean the reference is copied (and therefore another entry on the heap is created) or the object itself is being copied? As far as I know, Object and therefore Object[] are implemented as a reference type. So assigning a new value to 'items' would allow the garbage collector to find that the old 'item' is no longer referenced and can therefore be collected. In my eyes, this the codesample does not produce a memory leak. Could somebody prove me wrong? =) import java.util.Arrays; public class Foo { private Object[] items; private int size=0; private static final int ISIZE=10; public Foo() { items= new Object[ISIZE]; } public void push(final Object o){ checkSize(); items[size++]=o; } public Object pop(){ if (size==0) throw new ///... return items[--size]; } private void checkSize(){ if (items.length==size){ items=Arrays.copyOf(items,2 * size+1); } } }

    Read the article

  • Is there a work around for invalid octal digit in an array?

    - by sircrisp
    I'm trying to create an array which will hold the hours in a day so I can loop through it for a clock. I have: int hourArray[24] = {12, 01, 02, 03, 04, 05, 06, 07, 08, 09, 10, 11, 12, 01, 02, 03, 04, 05, 06, 07, 08, 09, 10, 11}; I am getting the error on the following numbers in order 08, 09, 08, 09. It tells me: Error: invalid octal digit I've never run into this before and I'm wondering if there is any way around it?

    Read the article

  • Codesample with bufferoverflow (gets method). Why does it not behave as expected?

    - by citronas
    This an extract from an c program that should demonstrate a bufferoverflow. void foo() { char arr[8]; printf(" enter bla bla bla"); gets(arr); printf(" you entered %s\n", arr); } The question was "How many input chars can a user maximal enter without a creating a buffer overflow" My initial answer was 8, because the char-array is 8 bytes long. Although I was pretty certain my answer was correct, I tried a higher amount of chars, and found that the limit of chars that I can enter, before I get a segmentation fault is 11. (Im running this on A VirtualBox Ubuntu) So my question is: Why is it possible to enter 11 chars into that 8 byte array?

    Read the article

  • C# Finding 2 positions 1-dimArray

    - by Chris
    Hello, In a method i am calculating the longest row of elements. The 1-dim array is filled up with random values (0 or 1). The method looks up the longest row (being 0 or 1, whatever is the longest). Meaning in for example: 1110100 --> the longest row would be 3 (3 * 1) 0110000 --> the longest row would be 4 (4 * 0) My problem is i am trying to perform some type of linear search to show the position of the row in the array. The first example has the longest row of 3 elements (3 times 1). For 1110100 the position in the array would be 0 - 2 (index) For 0110000 the position in the array would be 3 - 6 (index) I have been trying with foreaches, for loops etc..but i cannot seem to get the proper indexes of both. Cannot seem to display both positions properly. For the first example the correct output wouldbe: The largest row of same elements of the array consists of 3 elements on the position 0 - 2. The longest row of elements gets of same elements get calculated as the following: public int BerekenDeelrij (int [] table) ( int count = 0; final int value = 0; int largest = 0; foreach (int value in table) ( if (value == last value) counter + +; else ( largest = Math.Max largest (largest, counter); final value = value count = 1; ) ) Math.Max return (largest, counter); ) Best Regards.

    Read the article

  • My PHP script for sending emails wont send

    - by James
    Well I'm working on a school project, and I uploaded my script to send emails. I'm pretty much using whats defined here: http://www.webcheatsheet.com/PHP/send_email_text_html_attachment.php . Now, all I really changed(other than the contents), is the receiver, to my email address. However, I'm not getting it in my inbox. Is there something else I need? Do I need to do something with the settings on the server(or have my school enable something)?

    Read the article

  • Does python have a session variable concept???

    - by gizgok
    I have a datetime.date variable in python.I need to pass it to a function do operations according to the date given and then increment the date for the next set of operations.The problem is I have to do the operations in diff pages and hence I need the date as a variable which can go from page to page. Can we do this in python.......

    Read the article

  • Need help with basic optimization problem

    - by ??iu
    I know little of optimization problems, so hopefully this will be didactic for me: rotors = [1, 2, 3, 4...] widgets = ['a', 'b', 'c', 'd' ...] assert len(rotors) == len(widgets) part_values = [ (1, 'a', 34), (1, 'b', 26), (1, 'c', 11), (1, 'd', 8), (2, 'a', 5), (2, 'b', 17), .... ] Given a fixed number of widgets and a fixed number of rotors, how can you get a series of widget-rotor pairs that maximizes the total value where each widget and rotor can only be used once?

    Read the article

  • Finding the heaviest of N objects using M scales

    - by cpprulez
    We have N objects and M scales. It's up to us what the objects are, and we need to position the objects on the scales so that it is undoubtful which is the heaviest object. For example, if we have 3 objects: "a", "b", "c" and 2 scales, one possible solution is "a" "b", "b" = "c" (here "a" is the heaviest). I need an algorithm which generates such solutions given N and M. Also let's assume that "a" is always the heaviest object. I've lost a few hours figuring out how to do it, but no matter what I figure out, there's always cases which I miss. For example, another solution is: "a" + "c" = 2 * "b", "a" "c".

    Read the article

  • m:n relationship must have properties?

    - by nax
    I'm doing a E/R model for a project. I finished the ER model and, for me, all is okay. Maybe not perfect, but it's okay. When I gave the ER model to my teacher, he told me this: "the m:n relations MUST HAVE some properties" He said if the m:n relationship doesn't have the properties it will be wrong. In my opinion m:n doesn't need forcer attributes to the relationship, but if you have someone that can fit in it, just put there. What do you think? Who is wrong in this, me, or my teacher? NOTE: Reading again, it seems what he said was not due to my ER diagram, but was a general statement. The diagram I gave him doesn't have relations yet, so there where just entities and atributes.

    Read the article

  • Filtering string in Python

    - by Ecce_Homo
    I am making algorithm for checking the string (e-mail) - like "E-mail addres is valid" but their are rules. First part of e-mail has to be string that has 1-8 characters (can contain alphabet, numbers, underscore [ _ ]...all the parts that e-mail contains) and after @ the second part of e-mail has to have string that has 1-12 characters (also containing all legal expressions) and it has to end with top level domain .com EDIT email = raw_input ("Enter the e-mail address:") length = len (email) if length > 20 print "Address is too long" elif lenght < 5: print "Address is too short" if not email.endswith (".com"): print "Address doesn't contain correct domain ending" first_part = len (splitting[0]) second_part = len(splitting[1]) account = splitting[0] domain = splitting[1] for c in account: if c not in "abcdefghijklmopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ0123456789_.": print "Invalid char", "->", c,"<-", "in account name of e-mail" for c in domain: if c not in "abcdefghijklmopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ0123456789_.": print "Invalid char", "->", c,"<-", "in domain of e-mail" if first_part == 0: print "You need at least 1 character before the @" elif first_part> 8: print "The first part is too long" if second_part == 4: print "You need at least 1 character after the @" elif second_part> 16: print "The second part is too long" else: # if everything is fine return this print "E-mail addres is valid" EDIT: After reproting what is wrong with our input, now I need to make Python recognize valid address and return ("E-mail adress is valid") This is the best i can do with my knowledge....and we cant use regular expressions, teacher said we are going to learn them later.

    Read the article

  • Constructor/Destructor involving a class and a struct

    - by Bogdan Maier
    I am working on a program and need to make an array of objects, specifically I have a 31x1 array where each position is an object, (each object is basically built out of 6 ints). Here is what I have but something is wrong and i could use some help thank you. 31x1 struct header" const int days=31; struct Arr{ int days; int *M; }; typedef Arr* Array; 31x1 matrix constructor: void constr(){ int *M; M = new Expe[31]; // Expe is the class class header: class Expe { private: //0-HouseKeeping, 1-Food, 2-Transport, 3-Clothing, 4-TelNet, 5-others int *obj; } Class object constructor: Expe::Expe() { this->obj=new int[6]; } help please... because i`m pretty lost.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 31 32 33 34 35 36 37 38 39 40 41 42  | Next Page >