Search Results

Search found 1552 results on 63 pages for 'homework'.

Page 35/63 | < Previous Page | 31 32 33 34 35 36 37 38 39 40 41 42  | Next Page >

  • What data stucture should I use for BigInt class

    - by user1086004
    I would like to implement a BigInt class which will be able to handle really big numbers. I want only to add and multiply numbers, however the class should also handle negative numbers. I wanted to represent the number as a string, but there is a big overhead with converting string to int and back for adding. I want to implement addition as on the high school, add corresponding order and if the result is bigger than 10, add the carry to next order. Then I thought that it would be better to handle it as a array of unsigned long long int and keep the sign separated by bool. With this I'm afraid of size of the int, as C++ standard as far as I know guarantees only that int < float < double. Correct me if I'm wrong. So when I reach some number I should move in array forward and start adding number to the next array position. Is there any data structure that is appropriate or better for this? Thanks in advance.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • what is the best algorithm to use for this problem

    - by slim
    Equilibrium index of a sequence is an index such that the sum of elements at lower indexes is equal to the sum of elements at higher indexes. For example, in a sequence A: A[0]=-7 A[1]=1 A[2]=5 A[3]=2 A[4]=-4 A[5]=3 A[6]=0 3 is an equilibrium index, because: A[0]+A[1]+A[2]=A[4]+A[5]+A[6] 6 is also an equilibrium index, because: A[0]+A[1]+A[2]+A[3]+A[4]+A[5]=0 (sum of zero elements is zero) 7 is not an equilibrium index, because it is not a valid index of sequence A. If you still have doubts, this is a precise definition: the integer k is an equilibrium index of a sequence if and only if and . Assume the sum of zero elements is equal zero. Write a function int equi(int[] A); that given a sequence, returns its equilibrium index (any) or -1 if no equilibrium indexes exist. Assume that the sequence may be very long.

    Read the article

  • Lexical Analyzer(Scanner) for Language G by using C/C++

    - by udsha
    int a = 20; int b =30; float c; c = 20 + a; if(c) { a = c*b + a; } else { c = a - b + c; } use C++ / C to Implement a Lexer. 1. Create Unambiguous grammer for language G. 2. Create Lexical Analyzer for Language G. 3. It should identified tokens and lexemes for that language. 4. create a parse tree. 5. to use attribute grammer on a parse tree the values of the intrinsic attributes should be available on the symbol table.

    Read the article

  • Why does this code sample produce a memory leak?

    - by citronas
    In the university we were given the following code sample and we were being told, that there is a memory leak when running this code. The sample should demonstrate that this is a situation where the garbage collector can't work. As far as my object oriented programming goes, the only codeline able to create a memory leak would be items=Arrays.copyOf(items,2 * size+1); The documentation says, that the elements are copied. Does that mean the reference is copied (and therefore another entry on the heap is created) or the object itself is being copied? As far as I know, Object and therefore Object[] are implemented as a reference type. So assigning a new value to 'items' would allow the garbage collector to find that the old 'item' is no longer referenced and can therefore be collected. In my eyes, this the codesample does not produce a memory leak. Could somebody prove me wrong? =) import java.util.Arrays; public class Foo { private Object[] items; private int size=0; private static final int ISIZE=10; public Foo() { items= new Object[ISIZE]; } public void push(final Object o){ checkSize(); items[size++]=o; } public Object pop(){ if (size==0) throw new ///... return items[--size]; } private void checkSize(){ if (items.length==size){ items=Arrays.copyOf(items,2 * size+1); } } }

    Read the article

  • Does python have a session variable concept???

    - by gizgok
    I have a datetime.date variable in python.I need to pass it to a function do operations according to the date given and then increment the date for the next set of operations.The problem is I have to do the operations in diff pages and hence I need the date as a variable which can go from page to page. Can we do this in python.......

    Read the article

  • java programming

    - by Baiba
    ok i have version of t code, please tell me what i need to do when i need to get out of program The INDEX NUMBER OF COLUMN IN WHICH ARE LEAST ZEROS? class Uzd{ public static void main(String args[]){ int mas[][]= {{3,4,7,5,0}, {4,5,3,0,1}, {8,2,4,0,3}, {7,0,2,0,1}, {0,0,1,3,0}}; int nul_mas[] = new int[5]; int nul=0; for(int j=0;j<5;j++){// nul=0; for(int i=0;i<5;i++){ if(mas[i][j]==0){ nul++; } } nul_mas[j]=nul; } for(int i=0;i<5;i++){ for(int j=0;j<5;j++){ System.out.print(mas[i][j]); } System.out.println(); } System.out.println();// atstarpe System.out.println("///zeros in each column///"); for(int i=0;i<5;i++){System.out.print(nul_mas[i]);} System.out.println(); }} and after running it shows: 34750 45301 82403 70201 00130 ///zeros in each column/// But i need not in each column but i need to get out index of column in which zeros are least! in this situation it is column nubmer 2!! 12032

    Read the article

  • Can't get Jacobi algorithm to work in Objective-C

    - by Chris Long
    Hi, For some reason, I can't get this program to work. I've had other CS majors look at it and they can't figure it out either. This program performs the Jacobi algorithm (you can see step-by-step instructions and a MATLAB implementation here). BTW, it's different from the Wikipedia article of the same name. Since NSArray is one-dimensional, I added a method that makes it act like a two-dimensional C array. After running the Jacobi algorithm many times, the diagonal entries in the NSArray (i[0][0], i[1][1], etc.) are supposed to get bigger and the others approach 0. For some reason though, they all increase exponentially. For instance, i[2][4] should equal 0.0000009, not 9999999, while i[2][2] should be big. Thanks in advance, Chris NSArray+Matrix.m @implementation NSArray (Matrix) @dynamic offValue, transposed; - (double)offValue { double sum = 0.0; for ( MatrixItem *item in self ) if ( item.nonDiagonal ) sum += pow( item.value, 2.0 ); return sum; } - (NSMutableArray *)transposed { NSMutableArray *transpose = [[[NSMutableArray alloc] init] autorelease]; int i, j; for ( i = 0; i < 5; i++ ) { for ( j = 0; j < 5; j++ ) { [transpose addObject:[self objectAtRow:j andColumn:i]]; } } return transpose; } - (id)objectAtRow:(NSUInteger)row andColumn:(NSUInteger)column { NSUInteger index = 5 * row + column; return [self objectAtIndex:index]; } - (NSMutableArray *)multiplyWithMatrix:(NSArray *)array { NSMutableArray *result = [[NSMutableArray alloc] init]; int i = 0, j = 0, k = 0; double value; for ( i = 0; i < 5; i++ ) { value = 0.0; for ( j = 0; j < 5; j++ ) { for ( k = 0; k < 5; k++ ) { MatrixItem *firstItem = [self objectAtRow:i andColumn:k]; MatrixItem *secondItem = [array objectAtRow:k andColumn:j]; value += firstItem.value * secondItem.value; } MatrixItem *item = [[MatrixItem alloc] initWithValue:value]; item.row = i; item.column = j; [result addObject:item]; } } return result; } @end Jacobi_AlgorithmAppDelegate.m // ... - (void)jacobiAlgorithmWithEntry:(MatrixItem *)entry { MatrixItem *b11 = [matrix objectAtRow:entry.row andColumn:entry.row]; MatrixItem *b22 = [matrix objectAtRow:entry.column andColumn:entry.column]; double muPlus = ( b22.value + b11.value ) / 2.0; muPlus += sqrt( pow((b22.value - b11.value), 2.0) + 4.0 * pow(entry.value, 2.0) ); Vector *u1 = [[[Vector alloc] initWithX:(-1.0 * entry.value) andY:(b11.value - muPlus)] autorelease]; [u1 normalize]; Vector *u2 = [[[Vector alloc] initWithX:-u1.y andY:u1.x] autorelease]; NSMutableArray *g = [[[NSMutableArray alloc] init] autorelease]; for ( int i = 0; i <= 24; i++ ) { MatrixItem *item = [[[MatrixItem alloc] init] autorelease]; if ( i == 6*entry.row ) item.value = u1.x; else if ( i == 6*entry.column ) item.value = u2.y; else if ( i == ( 5*entry.row + entry.column ) || i == ( 5*entry.column + entry.row ) ) item.value = u1.y; else if ( i % 6 == 0 ) item.value = 1.0; else item.value = 0.0; [g addObject:item]; } NSMutableArray *firstResult = [[g.transposed multiplyWithMatrix:matrix] autorelease]; matrix = [firstResult multiplyWithMatrix:g]; } // ...

    Read the article

  • Finding the heaviest of N objects using M scales

    - by cpprulez
    We have N objects and M scales. It's up to us what the objects are, and we need to position the objects on the scales so that it is undoubtful which is the heaviest object. For example, if we have 3 objects: "a", "b", "c" and 2 scales, one possible solution is "a" "b", "b" = "c" (here "a" is the heaviest). I need an algorithm which generates such solutions given N and M. Also let's assume that "a" is always the heaviest object. I've lost a few hours figuring out how to do it, but no matter what I figure out, there's always cases which I miss. For example, another solution is: "a" + "c" = 2 * "b", "a" "c".

    Read the article

  • Excel Functions

    - by dwyane
    =MAX(SUM(A1:A5)) How do i incorporate the above formula into =IF( AND( $H$14<F22, F22<=($H$14+$H$15) ), $I$15, IF( AND( $H$14+$H$15<F22, F22<($H$14+$H$15+$H$16) ), $I$16, IF( AND( $H$14+$H$15+$H$16<F22, F22<=($H$14+$H$15+$H$16+$H$17) ), $I$17, $I$14 ) ) ) It keeps running a circular reference error. Help! The sum value shouldnt exceed 150. If exceed, then replace the cell with zero value.

    Read the article

  • MPI Odd/Even Compare-Split Deadlock

    - by erebel55
    I'm trying to write an MPI version of a program that runs an odd/even compare-split operation on n randomly generated elements. Process 0 should generated the elements and send nlocal of them to the other processes, (keeping the first nlocal for itself). From here, process 0 should print out it's results after running the CompareSplit algorithm. Then, receive the results from the other processes run of the algorithm. Finally, print out the results that it has just received. I have a large chunk of this already done, but I'm getting a deadlock that I can't seem to fix. I would greatly appreciate any hints that people could give me. Here is my code http://pastie.org/3742474 Right now I'm pretty sure that the deadlock is coming from the Send/Recv at lines 134 and 151. I've tried changing the Send to use "tag" instead of myrank for the tag parameter..but when I did that I just keep getting a "MPI_ERR_TAG: invalid tag" for some reason. Obviously I would also run the algorithm within the processors 0 but I took that part out for now, until I figure out what is going wrong. Any help is appreciated.

    Read the article

  • errorerror C2059: syntax error : ']', i cant figure out why this coming up in c++

    - by user320950
    void display_totals(); int exam1[100][3];// array that can hold 100 numbers for 1st column int exam2[100][3];// array that can hold 100 numbers for 2nd column int exam3[100][3];// array that can hold 100 numbers for 3rd column int main() { int go,go2,go3; go=read_file_in_array; go2= calculate_total(exam1[],exam2[],exam3[]); go3=display_totals; cout << go,go2,go3; return 0; } void display_totals() { int grade_total; grade_total=calculate_total(exam1[],exam2[],exam3[]); } int calculate_total(int exam1[],int exam2[],int exam3[]) { int calc_tot,above90=0, above80=0, above70=0, above60=0,i,j; calc_tot=read_file_in_array(exam[100][3]); exam1[][]=exam[100][3]; exam2[][]=exam[100][3]; exam3[][]=exam[100][3]; for(i=0;i<100;i++); { if(exam1[i] <=90 && exam1[i] >=100) { above90++; cout << above90; } } return exam1[i],exam2[i],exam3[i]; } int read_file_in_array(int exam[100][3]) { ifstream infile; int num, i=0,j=0; infile.open("grades.txt");// file containing numbers in 3 columns if(infile.fail()) // checks to see if file opended { cout << "error" << endl; } while(!infile.eof()) // reads file to end of line { for(i=0;i<100;i++); // array numbers less than 100 { for(j=0;j<3;j++); // while reading get 1st array or element infile >> exam[i][j]; cout << exam[i][j] << endl; } } infile.close(); return exam[i][j]; }

    Read the article

  • Codesample with bufferoverflow (gets method). Why does it not behave as expected?

    - by citronas
    This an extract from an c program that should demonstrate a bufferoverflow. void foo() { char arr[8]; printf(" enter bla bla bla"); gets(arr); printf(" you entered %s\n", arr); } The question was "How many input chars can a user maximal enter without a creating a buffer overflow" My initial answer was 8, because the char-array is 8 bytes long. Although I was pretty certain my answer was correct, I tried a higher amount of chars, and found that the limit of chars that I can enter, before I get a segmentation fault is 11. (Im running this on A VirtualBox Ubuntu) So my question is: Why is it possible to enter 11 chars into that 8 byte array?

    Read the article

  • problem with join SQL Server 2000

    - by eyalb
    I have 3 tables - Items, Props, Items_To_Props i need to return all items that match all properties that i send example items 1 2 3 4 props T1 T2 T3 items_to_props 1 T1 1 T2 1 T3 2 T1 3 T1 when i send T1,T2 i need to get only item 1

    Read the article

  • How can I match a phone number with a regex? [closed]

    - by Zerobu
    Possible Duplicate: A comprehensive regex for phone number validation I would like a regular expression in this format. It Must match one of the following formats: (###)###-#### ###-###-#### ###.###.#### ########## Strip all whitespace. Make sure it's a valid phone number, then (if necessary) translate it to the first format listed above.

    Read the article

  • A two player game over the intranet..

    - by Santwana
    Hi everybody.. I am a student of 3rd year engineering and only a novice in my programming skills. I need some help with my project.. I wish to develop a two player game to be played over the network (Intranet). I want to develop a simple website with a few html pages for this.My ideas for the project run as follows: 1.People can log in from different systems and check who ever is online on the network currently. the page also shows who is playing with whom. 2.If a person is interested in playing with a player who is currently online, he sends a request of which the other player is somehow notified( using a message or an alert on his profile page..) 3.If the player accepts the request, a game is started. This is exactly where I am clueless.. How can I make them play the game? I need to develop a turn based game with two players, eg chessboard.. how can I do this? The game has to be played live.. and it is time tracked. i need your help with coding the above.. the other features i wish to include are: 4.The game could not be abruptly terminated by any one if the users.The request to terminate the game should be sent to the other player first and only if he accepts can the game be terminated. Whoever wins the game would get a plus 10 on their credit and if he terminated he gets a minus 10. The credits remains constant even if he loses but the success percentage is reduced. 6.The player with highest winning percentage is projected as the player of the week on the home page and he can post a challenge to all others.. I only have an intermediate knowledge of core java and know the basics of Swing and Awt. I am not at all familiar with networking in java right now. I have 5 to 6 weeks of time for developing the project but I hope to learn the things before I start my project. i would prefer to use a lan to illustrate the project and I know only java,jsp,oracle,html and bit of xml to develop my proj. Also I wish to know if I can code this within 6 weeks, would it be too difficult or complicated? Please spare some time to tell me. Please.. please.. I need your suggestions and help.. thank you so much..

    Read the article

  • My PHP script for sending emails wont send

    - by James
    Well I'm working on a school project, and I uploaded my script to send emails. I'm pretty much using whats defined here: http://www.webcheatsheet.com/PHP/send_email_text_html_attachment.php . Now, all I really changed(other than the contents), is the receiver, to my email address. However, I'm not getting it in my inbox. Is there something else I need? Do I need to do something with the settings on the server(or have my school enable something)?

    Read the article

  • Please help me in creating an update query

    - by Rajesh Rolen- DotNet Developer
    I have got a table which contains 5 column and query requirements: update row no 8 (or id=8) set its column 2, column 3's value from id 9th column 2, column 3 value. means all value of column 2, 3 should be shifted to column 2, 3 of upper row (start from row no 8) and value of last row's 2, 3 will be null For example, with just 3 rows, the first row is untouched, the second to N-1th rows are shifted once, and the Nth row has nulls. id math science sst hindi english 1 11 12 13 14 15 2 21 22 23 24 25 3 31 32 33 34 35 The result of query of id=2 should be: id math science sst hindi english 1 11 12 13 14 15 2 31 32 23 24 25 //value of 3rd row (col 2,3) shifted to row 2 3 null null 33 34 35 This process should run for all rows whose id 2 Please help me to create this update query I am using MS sqlserver 2005

    Read the article

< Previous Page | 31 32 33 34 35 36 37 38 39 40 41 42  | Next Page >