Search Results

Search found 1552 results on 63 pages for 'homework'.

Page 34/63 | < Previous Page | 30 31 32 33 34 35 36 37 38 39 40 41  | Next Page >

  • new >> how would i read a file that has 3 columns and each column contains 100 numbers into an array

    - by user320950
    int exam1[100];// array that can hold 100 numbers for 1st column int exam2[100];// array that can hold 100 numbers for 2nd column int exam3[100];// array that can hold 100 numbers for 3rd column void main() { ifstream infile; int num; infile.open("example.txt");// file containing numbers in 3 columns if(infile.fail()) // checks to see if file opended { cout << "error" << endl; } while(!infile.eof()) // reads file to end of line { for(i=0;i<100;i++); // array numbers less than 100 { while(infile >> [exam]); // while reading get 1st array or element ???// how will i go read the next number infile >> num; } } infile.close(); }

    Read the article

  • Is there a work around for invalid octal digit in an array?

    - by sircrisp
    I'm trying to create an array which will hold the hours in a day so I can loop through it for a clock. I have: int hourArray[24] = {12, 01, 02, 03, 04, 05, 06, 07, 08, 09, 10, 11, 12, 01, 02, 03, 04, 05, 06, 07, 08, 09, 10, 11}; I am getting the error on the following numbers in order 08, 09, 08, 09. It tells me: Error: invalid octal digit I've never run into this before and I'm wondering if there is any way around it?

    Read the article

  • pyschool is wrong ?

    - by geekkid
    I'm currently learning python and trying to do exercises at pyschools (if anyone knows what it is). Anyway, i have an exercise that asks me to do the following : Write a function percent(value, total) that takes in two numbers as arguments, and returns the percentage value as an integer. Here's my code: def percent(value, total): percent = value / total * 100 return int(percent) It works great in my Python Idle and it gives all the correct answers. however, when i run it in the pyschools website, it says that , for example , when the function is called with parameters 46 and 90 , the function returns 0. However, in my python idle , it correctly returns 51. What might be the problem ? Thank you very much for your help!

    Read the article

  • Constructors taking references in C++

    - by sasquatch
    I'm trying to create constructor taking reference to an object. After creating object using reference I need to prints field values of both objects. Then I must delete first object, and once again show values of fields of both objects. My class Person looks like this : class Person { char* name; int age; public: Person(){ int size=0; cout << "Give length of char*" << endl; cin >> size; name = new char[size]; age = 0; } ~Person(){ cout << "Destroying resources" << endl; delete[] name; delete age; } void init(char* n, int a) { name = n; age = a; } }; Here's my implementation (with the use of function show() ). My professor said that if this task is written correctly it will return an error. #include <iostream> using namespace std; class Person { char* name; int age; public: Person(){ int size=0; cout << "Give length of char*" << endl; cin >> size; name = new char[size]; age = 0; } Person(const Person& p){ name = p.name; age = p.age; } ~Person(){ cout << "Destroying resources" << endl; delete[] name; delete age; } void init(char* n, int a) { name = n; age = a; } void show(char* n, int a){ cout << "Name: " << name << "," << "age: " << age << "," << endl; } }; int main(void) { Person *p = new Person; p->init("Mary", 25); p->show(); Person &p = pRef; pRef->name = "Tom"; pRef->age = 18; Person *p2 = new Person(pRef); p->show(); p2->show(); system("PAUSE"); return 0; }

    Read the article

  • Convert integer to equivalent number of blank spaces.

    - by mike
    I was wondering what the easiest way is to convert an integer to the equivalent number of blank spaces. I need it for the spaces between nodes when printing a binary search tree. I tried this `int position = printNode.getPosition(); String formatter = "%1"+position+"s%2$s\n"; System.out.format(formatter, "", node.element);` But I am getting almost 3 times as many spaces compared to the int value of position. I'm not really sure if I am formatting the string right either. Any suggestions would be great! If it makes it clearer, say position = 6; I want 6 blank spaces printed before my node element.

    Read the article

  • [java] Returning the element number of the longest string in an array

    - by JohnRoberts
    Hoookay, so. I'm trying to get the longestS method to take the user-inputted array of strings, then return the element number of the longest string in that array. I got it to the point where I was able to return the number of chars in the longest string, but I don't believe that will work for what I need. My problem is that I keep getting incompatible type errors when trying to figure this out. I don't understand the whole data type thing with strings yet. It's confusing me how I go about return a number of the array yet the array is of strings. The main method is fine, I got stuck on the ???? part. { public static void main(String [] args) { Scanner inp = new Scanner( System.in ); String [] responseArr= new String[4]; for (int i=0; i<4; i++) { System.out.println("Enter string "+(i+1)); responseArr[i] = inp.nextLine(); } int highest=longestS(responseArr); } public static int longestS(String[] values) { int largest=0 for( int i = 1; i < values.length; i++ ) { if ( ????? ) } return largest; } }

    Read the article

  • Linked lists in Java - help with assignment

    - by user368241
    Representation of a string in linked lists In every intersection in the list there will be 3 fields : The letter itself. The number of times it appears consecutively. A pointer to the next intersection in the list. The following class CharNode represents a intersection in the list : public class CharNode { private char _data; private int _value; private charNode _next; public CharNode (char c, int val, charNode n) { _data = c; _value = val; _next = n; } public charNode getNext() { return _next; } public void setNext (charNode node) { _next = node; } public int getValue() { return _value; } public void setValue (int v) { value = v; } public char getData() { return _data; } public void setData (char c) { _data = c; } } The class StringList represents the whole list : public class StringList { private charNode _head; public StringList() { _head = null; } public StringList (CharNode node) { _head = node; } } Add methods to the class StringList according to the details : (I will add methods gradually according to my specific questions) (Pay attention, these are methods from the class String and we want to fulfill them by the representation of a string by a list as explained above) public int indexOf (int ch) - returns the index in the string it is operated on of the first appeareance of the char "ch". If the char "ch" doesn't appear in the string, returns -1. If the value of fromIndex isn't in the range, returns -1. Pay attention to all the possible error cases. Write what is the time complexity and space complexity of every method that you wrote. Make sure the methods you wrote are effective. It is NOT allowed to use ready classes of Java. It is NOT allowed to move to string and use string operations. Here is my try to write the method indexOf (int ch). Kindly assist me with fixing the bugs so I can move on. public int indexOf (int ch) { int count = 0; charNode pose = _head; if (pose == null ) { return -1; } for (pose = _head; pose!=null && pose.getNext()!='ch'; pose = pose.getNext()) { count++; } if (pose!=null) return count; else return -1; }

    Read the article

  • Where can I find the transaction protocol used by Automated Teller Machines?

    - by Dave
    I'm doing a grad-school software engineering project and I'm looking for the protocol that governs communications between ATMs and bank networks. I've been googling for quite a while now, and though I'm finding all sorts of interesting information about ATMs, I'm surprised to find that there seems to be no industry standard for high-level communications. I'm not talking about 3DES or low-level transmission protocols, but something along the lines of an Interface Control Document; something that governs the sequence of events for various transactions: verify credentials, withdrawal, check balance, etc. Any ideas? Does anything like this even exist? I can't believe that after all this time the banks and ATM manufacturers are still just making this up as they go. A shorter question: if I wanted to go into the ATM software manufacturing business, where would I start looking for standards?

    Read the article

  • Can someone help with big O notation?

    - by Dann
    void printScientificNotation(double value, int powerOfTen) { if (value >= 1.0 && value < 10.0) { System.out.println(value + " x 10^" + powerOfTen); } else if (value < 1.0) { printScientificNotation(value * 10, powerOfTen - 1); } else // value >= 10.0 { printScientificNotation(value / 10, powerOfTen + 1); } } I understand how the method goes but I cannot figure out a way to represent the method. For example, if value was 0.00000009 or 9e-8, the method will call on printScientificNotation(value * 10, powerOfTen - 1); eight times and System.out.println(value + " x 10^" + powerOfTen); once. So the it is called recursively by the exponent for e. But how do I represent this by big O notation? Thanks!

    Read the article

  • Picking apples off a tree

    - by John Retallack
    I have the following problem: I am given a tree with N apples, for each apple I am given it's weight and height. I can pick apples up to a given height H, each time I pick an apple the height of every apple is increased with U. I have to find out the maximum weight of apples I can pick. 1 = N = 100000 0 < {H, U, apples' weight and height, maximum weight} < 231 Example: N=4 H=100 U=10 height weight 82 30 91 10 93 5 94 15 The answer is 45: first pick the apple with the weight of 15 then the one with the weight of 30. Could someone help me approach this problem?

    Read the article

  • Writing an Eval Procedure in Scheme?

    - by Planeman
    My problem isn't with the built-in eval procedure but how to create a simplistic version of it. Just for starters I would like to be able to take this in '(+ 1 2) and have it evaluate the expression + where the quote usually takes off the evaluation. I have been thinking about this and found a couple things that might be useful: Unquote: , (quasiquote) (apply) My main problem is regaining the value of + as a procedure and not a symbol. Once I get that I think I should just be able to use it with the other contents of the list. Any tips or guidance would be much appreciated.

    Read the article

  • consts and other animals

    - by bks
    Hello i have a cpp code wich i'm having trouble reading. a class B is defined now, i understand the first two lines, but the rest isn't clear enough. is the line "B const * pa2 = pa1" defines a const variable of type class B? if so, what does the next line do? B a2(2); B *pa1 = new B(a2); B const * pa2 = pa1; B const * const pa3 = pa2; also, i'm having trouble figuring out the difference between these two: char const *cst = “abc”; const int ci = 15; thank you

    Read the article

  • Sum of even fibonacci numbers

    - by user300484
    This is a Project Euler problem. If you don't want to see candidate solutions don't look here. Hello you all! im developping an application that will find the sum of all even terms of the fibonacci sequence. The last term of this sequence is 4,000,000 . There is something wrong in my code but I cannot find the problem since it makes sense to me. Can you please help me? using System.Collections.Generic; using System.Linq; using System.Text; namespace ConsoleApplication1 { class Program { static void Main(string[] args) { long[] arr = new long [1000000] ; long i= 2; arr[i-2]=1; arr[i-1]=2; long n= arr[i]; long s=0; for (i=2 ; n <= 4000000; i++) { arr[i] = arr[(i - 1)] + arr[(i - 2)]; } for (long f = 0; f <= arr.Length - 1; f++) { if (arr[f] % 2 == 0) s += arr[f]; } Console.Write(s); Console.Read(); } } }

    Read the article

  • single user dungeon

    - by mario estes
    hey dudes, my first question anyway, i have made a single user dungeon and am looking to change it in to a multi user dungoen how can i do this by the way im using python to make the sud in to a mud lol

    Read the article

  • How is it possible to legally write ::: in C++ and ??? in C#?

    - by daveny
    These questions are a kind of game, and I did not find the solution for them. It is possible to write ::: in C++ without using quotes or anything like this and the compiler will accept it (macros are prohibited too). And the same is true for C# too, but in C#, you have to write ???. I think C++ will use the :: scope operator and C# will use ? : , but I do not know the answers to them. Any idea?

    Read the article

  • Finding the heaviest of N objects using M scales

    - by cpprulez
    We have N objects and M scales. It's up to us what the objects are, and we need to position the objects on the scales so that it is undoubtful which is the heaviest object. For example, if we have 3 objects: "a", "b", "c" and 2 scales, one possible solution is "a" "b", "b" = "c" (here "a" is the heaviest). I need an algorithm which generates such solutions given N and M. Also let's assume that "a" is always the heaviest object. I've lost a few hours figuring out how to do it, but no matter what I figure out, there's always cases which I miss. For example, another solution is: "a" + "c" = 2 * "b", "a" "c".

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • How do I make software that preserves database integrity and correctness? Please help, confused.

    - by user287745
    i have made an application project in vs 08 c#, sql server from vs 08. the database has like 20 tables and many fields in each have made an interface for adding deleting editting and retrieving data according to predefined needs of the users. now i have to 1) make to project in to a software which i can deliver to professor. that is he can just double click the icon and the software simply starts. no vs 08 needed to start the debugging 2) the database will be on one powerful computer (dual core latest everything win xp) and the user will access it from another computer connected using LAN i am able to change the connection string to the shared database using vs 08/ debugger whenever the server changes but how am i supposed to do that when its a software? 3)there will by many clients am i supposed to give the same software to every one, so they all can connect to the database, how will the integrity and correctness of the database be maintained? i mean the db.mdf file will be in a folder which will be shared with read and write access. so its not necessary that only one user will write at a time. so is there any coding for this or? please help me out here i am stuck do not know what to do i have no practical experience, would appreciate all the help thank you

    Read the article

  • Excel Functions

    - by dwyane
    =MAX(SUM(A1:A5)) How do i incorporate the above formula into =IF( AND( $H$14<F22, F22<=($H$14+$H$15) ), $I$15, IF( AND( $H$14+$H$15<F22, F22<($H$14+$H$15+$H$16) ), $I$16, IF( AND( $H$14+$H$15+$H$16<F22, F22<=($H$14+$H$15+$H$16+$H$17) ), $I$17, $I$14 ) ) ) It keeps running a circular reference error. Help! The sum value shouldnt exceed 150. If exceed, then replace the cell with zero value.

    Read the article

  • Getter/Setter (composition, Java, HW)

    - by Crystal
    I have one class called Person that basically looks like: public class Person { String firstName; String lastName; String telephone; String email; public Person() { firstName = ""; lastName = ""; telephone = ""; email = ""; } public Person(String firstName, String lastName, String telephone, String email) { this.firstName = firstName; this.lastName = lastName; this.telephone = telephone; this.email = email; } public String getFirstName() { return firstName; } public void setFirstName(String firstName) { this.firstName = firstName; } .... Using that class, I setup an abstract class called Loan that looks like: public abstract class Loan { public void setClient(Person client) { this.client = client; } public Person getClient() { return client; } public void setLoanId(int nextId) { loanId = nextId; nextId++; } public int getLoanId() { return loanId; } public void setInterestRate(double interestRate) { this.interestRate = interestRate; } public double getInterestRate() { return interestRate; } public void setLoanLength(int loanLength) { this.loanLength = loanLength; } public int getLoanLength() { return loanLength; } public void setLoanAmount(double loanAmount) { this.loanAmount = loanAmount; } public double getLoanAmount(double loanAmount) { return loanAmount; } private Person client; private int loanId; private double interestRate; private int loanLength; private double loanAmount; private static int nextId = 1; } I have to extend the Loan class with CarLoan and it looks like: public class CarLoan extends Loan { public CarLoan(Person client, double vehiclePrice, double downPayment, double salesTax, double interestRate, CAR_LOAN_TERMS length) { super.setClient(client); super.setInterestRate(interestRate); this.client = client; this.vehiclePrice = vehiclePrice; this.downPayment = downPayment; this.salesTax = salesTax; this.length = length; } public void setVehiclePrice(double vehiclePrice) { this.vehiclePrice = vehiclePrice; } public double getVehiclePrice() { return vehiclePrice; } public void setDownPayment(double downPayment) { this.downPayment = downPayment; } public double getDownPayment() { return downPayment; } public void setSalesTax(double salesTax) { this.salesTax = salesTax; } public double getSalesTax() { return salesTax; } public String toString() { return getClass().getName() + "[vehiclePrice = " + vehiclePrice + '\n' + "downPayment = " + downPayment + '\n' + "salesTax = " + salesTax + "]"; } public enum CAR_LOAN_TERMS {TWO_YEAR, THREE_YEAR, SIX_YEAR}; private double vehiclePrice; private double downPayment; private double salesTax; Few questions. (a) Is what I did in the Loan class to setClient correct given what I have in the Person class? (e.g.this.client = client) (b) Can I call super twice in a method? I have to set two attributes from the Loan class from the constructor in the CarLoan class and I thought that would be a way to do it. (c) Do you have to set attributes for enumeration types differently in a constructor or getter/setter methods? I get an error for (this.length = length) in my CarLoan class and I was unsure of how enumeration values should be set. Thanks!

    Read the article

  • Why does this code sample produce a memory leak?

    - by citronas
    In the university we were given the following code sample and we were being told, that there is a memory leak when running this code. The sample should demonstrate that this is a situation where the garbage collector can't work. As far as my object oriented programming goes, the only codeline able to create a memory leak would be items=Arrays.copyOf(items,2 * size+1); The documentation says, that the elements are copied. Does that mean the reference is copied (and therefore another entry on the heap is created) or the object itself is being copied? As far as I know, Object and therefore Object[] are implemented as a reference type. So assigning a new value to 'items' would allow the garbage collector to find that the old 'item' is no longer referenced and can therefore be collected. In my eyes, this the codesample does not produce a memory leak. Could somebody prove me wrong? =) import java.util.Arrays; public class Foo { private Object[] items; private int size=0; private static final int ISIZE=10; public Foo() { items= new Object[ISIZE]; } public void push(final Object o){ checkSize(); items[size++]=o; } public Object pop(){ if (size==0) throw new ///... return items[--size]; } private void checkSize(){ if (items.length==size){ items=Arrays.copyOf(items,2 * size+1); } } }

    Read the article

< Previous Page | 30 31 32 33 34 35 36 37 38 39 40 41  | Next Page >