Search Results

Search found 1552 results on 63 pages for 'homework'.

Page 33/63 | < Previous Page | 29 30 31 32 33 34 35 36 37 38 39 40  | Next Page >

  • c++ tables of unions and structures

    - by newbDeveloper
    I was told to write a program, that creates a union and structure, then creates two-element arrays of unions and structures and fills their fields. I have created a union and a structure, but how to fill their fields in arrays ? #include <iostream> #include <stdlib.h> #include <stdio.h> using namespace std; union complex; union complex{ int i1; long double ld1; } u; struct Person { char* name; int age; bool sex; void show(){ printf("name %s, age %2.0d, sex %1d\n", name , age, sex); }; } person; int main(void) { Person *o = new Person[2]; complex *un = new complex[2]; un[0]->i1=i; system("pause"); return 0; } I've tried un[0]-i1=i; but it's not the proper way to do this.

    Read the article

  • Sum of even fibonacci numbers

    - by user300484
    This is a Project Euler problem. If you don't want to see candidate solutions don't look here. Hello you all! im developping an application that will find the sum of all even terms of the fibonacci sequence. The last term of this sequence is 4,000,000 . There is something wrong in my code but I cannot find the problem since it makes sense to me. Can you please help me? using System.Collections.Generic; using System.Linq; using System.Text; namespace ConsoleApplication1 { class Program { static void Main(string[] args) { long[] arr = new long [1000000] ; long i= 2; arr[i-2]=1; arr[i-1]=2; long n= arr[i]; long s=0; for (i=2 ; n <= 4000000; i++) { arr[i] = arr[(i - 1)] + arr[(i - 2)]; } for (long f = 0; f <= arr.Length - 1; f++) { if (arr[f] % 2 == 0) s += arr[f]; } Console.Write(s); Console.Read(); } } }

    Read the article

  • Problem with python class

    - by Tasbeer
    Hi I am new to Python and as a part of my assignment I have written the following class import nltk.stem.api class BanglaStemmer(nltk.stem.api.StemmerI): suffixList = ['\xef\xbb\xbf\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbf\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa7\x87\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x8b\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbf\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa7\x87\n', '\xe0\xa7\x87\xe0\xa6\x9b\n', '\xe0\xa6\xa4\xe0\xa7\x87\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbf\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa7\x87\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbf\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa6\x9b\xe0\xa6\xbf\n', '\xe0\xa6\x9b\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\x9b\n', '\xe0\xa6\xa4\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa6\xa4\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa6\xb2\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa6\xb2\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\xa4\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\xac\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa7\x81\xe0\xa6\xa8\n', '\xe0\xa7\x81\xe0\xa6\x95\n', '\xe0\xa6\xb2\xe0\xa7\x87\n', '\xe0\xa6\xac\xe0\xa7\x87\n', '\xe0\xa6\xb2\xe0\xa6\xbf\n', '\xe0\xa6\xac\xe0\xa6\xbf\n', '\xe0\xa6\xa4\xe0\xa6\xbf\n', '\xe0\xa6\xb2\n', '\xe0\xa6\xa4\n', '\xe0\xa7\x8b\n', '\xe0\xa6\xbf\n', '\xe0\xa7\x87\n', '\xe0\xa7\x8d\n', '\xe0\xa6\x87\n', '\xe0\xa6\xac\n', '\xe0\xa6\xb8\n', '\xe0\xa6\xa8\n', '\xe0\xa6\x95\n', '\xe0\xa6\x93\n', '\xe0\xa7\x9f\n'] def stem(self,token): for suffix in suffixList: if token.endswith(suffix): return token[:-len(suffix)] return token The problem is that when I try to compile run it by creating an instance and calling the stem() function with a parameter , it says that the suffixList is not defined. Couldn't figure out what's the problem. Is there a different way in which the class variables have to be declared ? please help

    Read the article

  • java programming

    - by Baiba
    ok i have version of t code, please tell me what i need to do when i need to get out of program The INDEX NUMBER OF COLUMN IN WHICH ARE LEAST ZEROS? class Uzd{ public static void main(String args[]){ int mas[][]= {{3,4,7,5,0}, {4,5,3,0,1}, {8,2,4,0,3}, {7,0,2,0,1}, {0,0,1,3,0}}; int nul_mas[] = new int[5]; int nul=0; for(int j=0;j<5;j++){// nul=0; for(int i=0;i<5;i++){ if(mas[i][j]==0){ nul++; } } nul_mas[j]=nul; } for(int i=0;i<5;i++){ for(int j=0;j<5;j++){ System.out.print(mas[i][j]); } System.out.println(); } System.out.println();// atstarpe System.out.println("///zeros in each column///"); for(int i=0;i<5;i++){System.out.print(nul_mas[i]);} System.out.println(); }} and after running it shows: 34750 45301 82403 70201 00130 ///zeros in each column/// But i need not in each column but i need to get out index of column in which zeros are least! in this situation it is column nubmer 2!! 12032

    Read the article

  • Returning multiple aggregate functions as rows

    - by SDLFunTimes
    I need some help formulating a select statement. I need to select the total quantity shipped for each part with a distinct color. So the result should be a row with the color name and the total. Here's my schema: create table s ( sno char(5) not null, sname char(20) not null, status smallint, city char(15), primary key (sno) ); create table p ( pno char(6) not null, pname char(20) not null, color char(6), weight smallint, city char(15), primary key (pno) ); create table sp ( sno char(5) not null, pno char(6) not null, qty integer not null, primary key (sno, pno) );

    Read the article

  • How do you determine using stat() whether a file is a symbolic link?

    - by hora
    I basically have to write a clone of the UNIX ls command for a class, and I've got almost everything working. One thing I can't seem to figure out how to do is check whether a file is a symbolic link or not. From the man page for stat(), I see that there is a mode_t value defined, S_IFLNK. This is how I'm trying to check whether a file is a sym-link, with no luck (note, stbuf is the buffer that stat() returned the inode data into): switch(stbuf.st_mode & S_IFMT){ case S_IFLNK: printf("this is a link\n"); break; case S_IFREG: printf("this is not a link\n"); break; } My code ALWAYS prints this is not a link even if it is, and I know for a fact that the said file is a symbolic link since the actual ls command says so, plus I created the sym-link... Can anyone spot what I may be doing wrong? Thanks for the help!

    Read the article

  • from loop to Nested loops ?

    - by WM
    I have this program that returns a factorial of N. For example, when entering 4,,, it will give 1! , 2! , 3! How could I convert this to use nested loops? public class OneForLoop { public static void main(String[] args) { Scanner input = new Scanner(System.in); System.out.print("Enter a number : "); int N = input.nextInt(); int factorial = 1; for(int i = 1; i < N; i++) { factorial *= i; System.out.println(i + "! = " + factorial); } } }

    Read the article

  • How do I make software that preserves database integrity and correctness? Please help, confused.

    - by user287745
    i have made an application project in vs 08 c#, sql server from vs 08. the database has like 20 tables and many fields in each have made an interface for adding deleting editting and retrieving data according to predefined needs of the users. now i have to 1) make to project in to a software which i can deliver to professor. that is he can just double click the icon and the software simply starts. no vs 08 needed to start the debugging 2) the database will be on one powerful computer (dual core latest everything win xp) and the user will access it from another computer connected using LAN i am able to change the connection string to the shared database using vs 08/ debugger whenever the server changes but how am i supposed to do that when its a software? 3)there will by many clients am i supposed to give the same software to every one, so they all can connect to the database, how will the integrity and correctness of the database be maintained? i mean the db.mdf file will be in a folder which will be shared with read and write access. so its not necessary that only one user will write at a time. so is there any coding for this or? please help me out here i am stuck do not know what to do i have no practical experience, would appreciate all the help thank you

    Read the article

  • Creating ActionEvent object for CustomButton in Java

    - by Crystal
    For a hw assignment, we were supposed to create a custom button to get familiar with swing and responding to events. We were also to make this button an event source which confuses me. I have an ArrayList to keep track of listeners that would register to listen to my CustomButton. What I am getting confused on is how to notify the listeners. My teacher hinted at having a notify and overriding actionPerformed which I tried doing, but then I wasn't sure how to create an ActionEvent object looking at the constructor documentation. The source, id, string all confuses me. Any help would be appreciated. Thanks! code: import java.awt.*; import java.awt.event.*; import javax.swing.*; import java.util.List; import java.util.ArrayList; public class CustomButton { public static void main(String[] args) { EventQueue.invokeLater(new Runnable() { public void run() { CustomButtonFrame frame = new CustomButtonFrame(); frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); frame.setVisible(true); } }); } public void addActionListener(ActionListener al) { listenerList.add(al); } public void removeActionListener(ActionListener al) { listenerList.remove(al); } public void actionPerformed(ActionEvent e) { System.out.println("Button Clicked!"); } private void notifyListeners() { ActionEvent event = new ActionEvent(CONFUSED HERE!!!!; for (ActionListener action : listenerList) { action.actionPerfomed(event); } } List<ActionListener> listenerList = new ArrayList<ActionListener>(); } class CustomButtonFrame extends JFrame { // constructor for CustomButtonFrame public CustomButtonFrame() { setTitle("Custom Button"); CustomButtonSetup buttonSetup = new CustomButtonSetup(); this.add(buttonSetup); this.pack(); } } class CustomButtonSetup extends JComponent { public CustomButtonSetup() { ButtonAction buttonClicked = new ButtonAction(); this.addMouseListener(buttonClicked); } // because frame includes borders and insets, use this method public Dimension getPreferredSize() { return new Dimension(200, 200); } public void paintComponent(Graphics g) { Graphics2D g2 = (Graphics2D) g; // first triangle coords int x[] = new int[TRIANGLE_SIDES]; int y[] = new int[TRIANGLE_SIDES]; x[0] = 0; y[0] = 0; x[1] = 200; y[1] = 0; x[2] = 0; y[2] = 200; Polygon firstTriangle = new Polygon(x, y, TRIANGLE_SIDES); // second triangle coords x[0] = 0; y[0] = 200; x[1] = 200; y[1] = 200; x[2] = 200; y[2] = 0; Polygon secondTriangle = new Polygon(x, y, TRIANGLE_SIDES); g2.drawPolygon(firstTriangle); g2.setColor(firstColor); g2.fillPolygon(firstTriangle); g2.drawPolygon(secondTriangle); g2.setColor(secondColor); g2.fillPolygon(secondTriangle); // draw rectangle 10 pixels off border int s1[] = new int[RECT_SIDES]; int s2[] = new int[RECT_SIDES]; s1[0] = 5; s2[0] = 5; s1[1] = 195; s2[1] = 5; s1[2] = 195; s2[2] = 195; s1[3] = 5; s2[3] = 195; Polygon rectangle = new Polygon(s1, s2, RECT_SIDES); g2.drawPolygon(rectangle); g2.setColor(thirdColor); g2.fillPolygon(rectangle); } private class ButtonAction implements MouseListener { public void mousePressed(MouseEvent e) { System.out.println("Click!"); firstColor = Color.GRAY; secondColor = Color.WHITE; repaint(); } public void mouseReleased(MouseEvent e) { System.out.println("Released!"); firstColor = Color.WHITE; secondColor = Color.GRAY; repaint(); } public void mouseEntered(MouseEvent e) {} public void mouseExited(MouseEvent e) {} public void mouseClicked(MouseEvent e) {} } public static final int TRIANGLE_SIDES = 3; public static final int RECT_SIDES = 4; private Color firstColor = Color.WHITE; private Color secondColor = Color.DARK_GRAY; private Color thirdColor = Color.LIGHT_GRAY; }

    Read the article

  • paintComponent method is not displaying anything on the panel

    - by Captain Gh0st
    I have been trying to debug this for hours. The program is supposed to be a grapher that graphs coordinates, but i cannot get anything to display not even a random line, but if i put a print statement there it works. It is a problem with the paintComponent Method. When I out print statement before g.drawLine then it prints, but it doesn't draw any lines even if i put a random line with coordinates (1,3), (2,4). import java.awt.*; import java.util.*; import javax.swing.*; public abstract class XYGrapher { abstract public Coordinate xyStart(); abstract public double xRange(); abstract public double yRange(); abstract public Coordinate getPoint(int pointNum); public class Paint extends JPanel { public void paintGraph(Graphics g, int xPixel1, int yPixel1, int xPixel2, int yPixel2) { super.paintComponent(g); g.setColor(Color.black); g.drawLine(xPixel1, yPixel1, xPixel2, yPixel2); } public void paintXAxis(Graphics g, int xPixel, int pixelsWide, int pixelsHigh) { super.paintComponent(g); g.setColor(Color.green); g.drawLine(xPixel, 0, xPixel, pixelsHigh); } public void paintYAxis(Graphics g, int yPixel, int pixelsWide, int pixelsHigh) { super.paintComponent(g); g.setColor(Color.green); g.drawLine(0, yPixel, pixelsWide, yPixel); } } public void drawGraph(int xPixelStart, int yPixelStart, int pixelsWide, int pixelsHigh) { JFrame frame = new JFrame(); Paint panel = new Paint(); panel.setPreferredSize(new Dimension(pixelsWide, pixelsHigh)); panel.setMinimumSize(new Dimension(pixelsWide, pixelsHigh)); panel.setMaximumSize(new Dimension(pixelsWide, pixelsHigh)); frame.setLocation(frame.getToolkit().getScreenSize().width / 2 - pixelsWide / 2, frame.getToolkit().getScreenSize().height / 2 - pixelsHigh / 2); frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); frame.setResizable(false); frame.add(panel); frame.pack(); frame.setVisible(true); double xRange = xRange(); double yRange = yRange(); Coordinate xyStart = xyStart(); int xPixel = xPixelStart - (int) (xyStart.getX() * (pixelsWide / xRange)); int yPixel = yPixelStart + (int) ((xyStart.getY() + yRange) * (pixelsHigh / yRange)); System.out.println(xPixel + " " + yPixel); if(yPixel > 0 && (yPixel < pixelsHigh)) { System.out.println("y"); panel.paintYAxis(panel.getGraphics(), yPixel, pixelsWide, pixelsHigh); } if(xPixel > 0 && (xPixel < pixelsHigh)) { System.out.println("x"); panel.paintXAxis(panel.getGraphics(), xPixel, pixelsWide, pixelsHigh); } for(int i = 0; i>=0; i++) { Coordinate point1 = getPoint(i); Coordinate point2 = getPoint(i+1); if(point2 == null) { break; } else { if(point1.drawFrom() && point2.drawTo()) { int xPixel1 = (int) (xPixelStart + (point1.getX() - xyStart.getX()) * (pixelsWide / xRange)); int yPixel1 = (int) (yPixelStart + (xyStart.getY() + yRange-point1.getY()) * (pixelsHigh / yRange)); int xPixel2 = (int) (xPixelStart + (point2.getX() - xyStart.getX()) * (pixelsWide / xRange)); int yPixel2 = (int) (yPixelStart + (xyStart.getY() + yRange - point2.getY()) * (pixelsHigh / yRange)); panel.paintGraph(panel.getGraphics(), xPixel1, yPixel1, xPixel2, yPixel2); } } } frame.pack(); } } This is how i am testing it is supposed to be a square, but nothing shows up. public class GrapherTester extends XYGrapher { public Coordinate xyStart() { return new Coordinate(-2,2); } public double xRange() { return 4; } public double yRange() { return 4; } public Coordinate getPoint(int pointNum) { switch(pointNum) { case 0: return new Coordinate(-1,-1); case 1: return new Coordinate(1,-1); case 2: return new Coordinate(1,1); case 3: return new Coordinate(-1,1); case 4: return new Coordinate(-1,-1); } return null; } public static void main(String[] args) { new GrapherTester().drawGraph(100, 100, 500, 500); } } Coordinate class so if any of you want to run and try it out. That is all you would need. public class Coordinate { float x; float y; boolean drawTo; boolean drawFrom; Coordinate(double x, double y) { this.x = (float) x; this.y = (float) y; drawFrom = true; drawTo = true; } Coordinate(double x, double y, boolean drawFrom, boolean drawTo) { this.x = (float) x; this.y = (float) y; this.drawFrom = drawFrom; this.drawTo = drawTo; } public double getX() { return x; } public double getY() { return y; } public boolean drawTo() { return drawTo; } public boolean drawFrom() { return drawFrom; } }

    Read the article

  • fprintf() within a subprogram

    - by sergio
    Im stuck when trying to write to my file within my subprogram. void new_page(float *a, float *b, float *c, int *d){ fprintf(results,"\nPage Totals: %f\t%f\t%f\t%d", *a,*b,*c,*d); } I get a warning saying "Warning: incompatible implicit declaration of built-in function 'fprinf' [enabled by default]" "error: 'results' undeclared (first use in this function)" in main fprintf works fine, its just when it comes to the subprogram/function it wont work. from my understanding it thinks that results is undeclared, so do i have to pass the name or location of the file to make it work?

    Read the article

  • Lexical Analyzer(Scanner) for Language G by using C/C++

    - by udsha
    int a = 20; int b =30; float c; c = 20 + a; if(c) { a = c*b + a; } else { c = a - b + c; } use C++ / C to Implement a Lexer. 1. Create Unambiguous grammer for language G. 2. Create Lexical Analyzer for Language G. 3. It should identified tokens and lexemes for that language. 4. create a parse tree. 5. to use attribute grammer on a parse tree the values of the intrinsic attributes should be available on the symbol table.

    Read the article

  • plane bombing problems- help

    - by peiska
    I'm training code problems, and on this one I am having problems to solve it, can you give me some tips how to solve it please. The problem is something like this: Your task is to find the sequence of points on the map that the bomber is expected to travel such that it hits all vital links. A link from A to B is vital when its absence isolates completely A from B. In other words, the only way to go from A to B (or vice versa) is via that link. Notice that if we destroy for example link (d,e), it becomes impossible to go from d to e,m,l or n in any way. A vital link can be hit at any point that lies in its segment (e.g. a hit close to d is as valid as a hit close to e). Of course, only one hit is enough to neutralize a vital link. Moreover, each bomb affects an exact circle of radius R, i.e., every segment that intersects that circle is considered hit. Due to enemy counter-attack, the plane may have to retreat at any moment, so the plane should follow, at each moment, to the closest vital link possible, even if in the end the total distance grows larger. Given all coordinates (the initial position of the plane and the nodes in the map) and the range R, you have to determine the sequence of positions in which the plane has to drop bombs. This sequence should start (takeoff) and finish (landing) at the initial position. Except for the start and finish, all the other positions have to fall exactly in a segment of the map (i.e. it should correspond to a point in a non-hit vital link segment). The coordinate system used will be UTM (Universal Transverse Mercator) northing and easting, which basically corresponds to a Euclidian perspective of the world (X=Easting; Y=Northing). Input Each input file will start with three floating point numbers indicating the X0 and Y0 coordinates of the airport and the range R. The second line contains an integer, N, indicating the number of nodes in the road network graph. Then, the next N (<10000) lines will each contain a pair of floating point numbers indicating the Xi and Yi coordinates (1 No two links will ever cross with each other. Output The program will print the sequence of coordinates (pairs of floating point numbers with exactly one decimal place), each one at a line, in the order that the plane should visit (starting and ending in the airport). Sample input 1 102.3 553.9 0.2 14 342.2 832.5 596.2 638.5 479.7 991.3 720.4 874.8 744.3 1284.1 1294.6 924.2 1467.5 659.6 1802.6 659.6 1686.2 860.7 1548.6 1111.2 1834.4 1054.8 564.4 1442.8 850.1 1460.5 1294.6 1485.1 17 1 2 1 3 2 4 3 4 4 5 4 6 6 7 7 8 8 9 8 10 9 10 10 11 6 11 5 12 5 13 12 13 13 14 Sample output 1 102.3 553.9 720.4 874.8 850.1 1460.5 102.3 553.9

    Read the article

  • toString() Method question

    - by cdominguez13
    I've been working on this assignemnt here's code: public class Student { private String fname; private String lname; private String studentId; private double gpa; public Student(String studentFname,String studentLname,String stuId,double studentGpa) { fname = studentFname; lname = studentLname; studentId = stuId; gpa = studentGpa; } public double getGpa() { return gpa; } public String getStudentId() { return studentId; } public String getName() { return lname + ", " + fname; } public void setGpa(double gpaReplacement) { if (gpaReplacement >= 0.0 && gpaReplacement <= 4.0) gpa = gpaReplacement; else System.out.println("Invalid GPA! Please try again."); System.exit(0); } } Now I need to create a toString() method that returns a String formatted something like this: Name: Wilson, Mary Ann ID number: 12345 GPA: 3.5

    Read the article

  • re.sub emptying list

    - by jmau5
    def process_dialect_translation_rules(): # Read in lines from the text file specified in sys.argv[1], stripping away # excess whitespace and discarding comments (lines that start with '##'). f_lines = [line.strip() for line in open(sys.argv[1], 'r').readlines()] f_lines = filter(lambda line: not re.match(r'##', line), f_lines) # Remove any occurances of the pattern '\s*<=>\s*'. This leaves us with a # list of lists. Each 2nd level list has two elements: the value to be # translated from and the value to be translated to. Use the sub function # from the re module to get rid of those pesky asterisks. f_lines = [re.split(r'\s*<=>\s*', line) for line in f_lines] f_lines = [re.sub(r'"', '', elem) for elem in line for line in f_lines] This function should take the lines from a file and perform some operations on the lines, such as removing any lines that begin with ##. Another operation that I wish to perform is to remove the quotation marks around the words in the line. However, when the final line of this script runs, f_lines becomes an empty lines. What happened? Requested lines of original file: ## English-Geek Reversible Translation File #1 ## (Moderate Geek) ## Created by Todd WAreham, October 2009 "TV show" <=> "STAR TREK" "food" <=> "pizza" "drink" <=> "Red Bull" "computer" <=> "TRS 80" "girlfriend" <=> "significant other"

    Read the article

  • Enumeration trouble: redeclared as different kind of symbol

    - by Matt
    Hello all. I am writing a program that is supposed to help me learn about enumeration data types in C++. The current trouble is that the compiler doesn't like my enum usage when trying to use the new data type as I would other data types. I am getting the error "redeclared as different kind of symbol" when compiling my trangleShape function. Take a look at the relevant code. Any insight is appreciated! Thanks! (All functions are their own .cpp files.) header file #ifndef HEADER_H_INCLUDED #define HEADER_H_INCLUDED #include <iostream> #include <iomanip> using namespace std; enum triangleType {noTriangle, scalene, isoceles, equilateral}; //prototypes void extern input(float&, float&, float&); triangleType extern triangleShape(float, float, float); /*void extern output (float, float, float);*/ void extern myLabel(const char *, const char *); #endif // HEADER_H_INCLUDED main function //8.1 main // this progam... #include "header.h" int main() { float sideLength1, sideLength2, sideLength3; char response; do //main loop { input (sideLength1, sideLength2, sideLength3); triangleShape (sideLength1, sideLength2, sideLength3); //output (sideLength1, sideLength2, sideLength3); cout << "\nAny more triangles to analyze? (y,n) "; cin >> response; } while (response == 'Y' || response == 'y'); myLabel ("8.1", "2/11/2011"); return 0; } triangleShape shape # include "header.h" triangleType triangleShape(sideLenght1, sideLength2, sideLength3) { triangleType triangle; return triangle; }

    Read the article

  • Please help me in creating an update query

    - by Rajesh Rolen- DotNet Developer
    I have got a table which contains 5 column and query requirements: update row no 8 (or id=8) set its column 2, column 3's value from id 9th column 2, column 3 value. means all value of column 2, 3 should be shifted to column 2, 3 of upper row (start from row no 8) and value of last row's 2, 3 will be null For example, with just 3 rows, the first row is untouched, the second to N-1th rows are shifted once, and the Nth row has nulls. id math science sst hindi english 1 11 12 13 14 15 2 21 22 23 24 25 3 31 32 33 34 35 The result of query of id=2 should be: id math science sst hindi english 1 11 12 13 14 15 2 31 32 23 24 25 //value of 3rd row (col 2,3) shifted to row 2 3 null null 33 34 35 This process should run for all rows whose id 2 Please help me to create this update query I am using MS sqlserver 2005

    Read the article

  • Can someone help with big O notation?

    - by Dann
    void printScientificNotation(double value, int powerOfTen) { if (value >= 1.0 && value < 10.0) { System.out.println(value + " x 10^" + powerOfTen); } else if (value < 1.0) { printScientificNotation(value * 10, powerOfTen - 1); } else // value >= 10.0 { printScientificNotation(value / 10, powerOfTen + 1); } } I understand how the method goes but I cannot figure out a way to represent the method. For example, if value was 0.00000009 or 9e-8, the method will call on printScientificNotation(value * 10, powerOfTen - 1); eight times and System.out.println(value + " x 10^" + powerOfTen); once. So the it is called recursively by the exponent for e. But how do I represent this by big O notation? Thanks!

    Read the article

  • i see the file but when i open it nothing is in it in c++ i/o stream and dont know why

    - by user320950
    #include<iostream> #include<fstream> #include<cstdlib> #include<iomanip> using namespace std; int main() { ifstream in_stream; // reads ITEMSLIST.txt ofstream out_stream1; // writes in listWititems.txt ifstream in_stream2; // reads PRICELIST.txt ofstream out_stream3;// writes in listWitprices.txt ifstream in_stream4;// read display.txt ofstream out_stream5;// write showitems.txt double p1=0.0,p2=0.0; int wrong=0; int count =0; char next; in_stream.open("ITEMLIST.txt", ios::in); // list of avaliable items /*if( in_stream.fail() )// check to see if itemlist.txt is open { wrong++; // counts number of errors cout << " the error occured here0, you have " << wrong++ << " errors" << endl; cout << "Error opening the file\n" << endl; exit(1); } else{ cout << " System ran correctly " << endl; } */ out_stream1.open("listWititems.txt", ios::out); // list of avaliable items /* if( out_stream1.fail() )// check to see if itemlist.txt is open { wrong++; cout << " the error occured here0, you have " << wrong++ << " errors" << endl; cout << "Error opening the file\n" << endl; exit(1); } else{ cout << " System ran correctly " << endl; } */ in_stream2.open("PRICELIST.txt", ios::in); /*if( in_stream2.fail() )// check to see if itemlist.txt is open { wrong++; cout << " the error occured here0, you have " << wrong++ << " errors" << endl; cout << "Error opening the file\n" << endl; exit(1); } else{ cout << " System ran correctly " << endl; } */ out_stream3.open("listWitdollars.txt", ios::out); /*if( out_stream3.fail() )// check to see if itemlist.txt is open { wrong++; cout << " the error occured here0, you have " << wrong++ << " errors" << endl; cout << "Error opening the file\n" << endl; exit(1); } else{ cout << " System ran correctly " << endl; } */ in_stream4.open("display.txt", ios::in); /*if( in_stream4.fail() )// check to see if itemlist.txt is open { wrong++; cout << " the error occured here0, you have " << wrong++ << " errors" << endl; cout << "Error opening the file\n" << endl; exit(1); } else{ cout << " System ran correctly " << endl; } */ out_stream5.open("showitems.txt", ios::out); /*if( out_stream5.fail() )// check to see if itemlist.txt is open { wrong++; cout << " the error occured here0, you have " << wrong++ << " errors" << endl; cout << "Error opening the file\n" << endl; exit(1); } else{ cout << " System ran correctly " << endl; }*/ in_stream.setf(ios::fixed); while(!in_stream.eof()) // reads to end of file and gets p1 which is itemnum, clears and gets next character { in_stream >> p1; cin.clear(); cin >> next; } out_stream1.setf(ios::fixed); while (!out_stream1.eof()) { out_stream1 << p1; cin.clear(); cin >> next; } in_stream2.setf(ios::fixed); in_stream2.setf(ios::showpoint); in_stream2.precision(2); while(!in_stream2.eof()) // reads file to end of file { in_stream2 >> p1 >> p2 >> count; // gets p1,p2, and count which is current total in_stream2 >> p2; p1 += p2; p2++; cin.clear(); // allows more reading cin >> next; return p1, p2; } out_stream3.setf(ios::fixed); out_stream3.setf(ios::showpoint); out_stream3.precision(2); while(!out_stream3.eof()) // reads file to end of file { out_stream3 << p1 << p2 << count; out_stream3 << p2; p1 += p2; p2++; cin.clear(); // allows more reading cin >> next; return p1, p2; } in_stream4.setf(ios::fixed); in_stream4.setf(ios::showpoint); in_stream4.precision(2); while (!in_stream4.eof()) { in_stream4 >> p1 >> p2 >> count; cin.clear(); cin >> next; } out_stream5.setf(ios::fixed); out_stream5.setf(ios::showpoint); out_stream5.precision(2); out_stream5 <<setw(5)<< " itemnum " <<setw(5)<<" price "<<setw(5)<<" curr_total " <<endl; // sends items and prices to receipt.txt out_stream5 << setw(5) << p1 << setw(5) <<p2 << setw(5)<< count; // sends items and prices to receipt.txt out_stream5 << " You have a total of " << wrong++ << " errors " << endl; in_stream.close(); // closing files. out_stream1.close(); in_stream2.close(); out_stream3.close(); in_stream4.close(); out_stream5.close(); system("pause"); }

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

< Previous Page | 29 30 31 32 33 34 35 36 37 38 39 40  | Next Page >