Search Results

Search found 1552 results on 63 pages for 'homework'.

Page 33/63 | < Previous Page | 29 30 31 32 33 34 35 36 37 38 39 40  | Next Page >

  • How do you determine using stat() whether a file is a symbolic link?

    - by hora
    I basically have to write a clone of the UNIX ls command for a class, and I've got almost everything working. One thing I can't seem to figure out how to do is check whether a file is a symbolic link or not. From the man page for stat(), I see that there is a mode_t value defined, S_IFLNK. This is how I'm trying to check whether a file is a sym-link, with no luck (note, stbuf is the buffer that stat() returned the inode data into): switch(stbuf.st_mode & S_IFMT){ case S_IFLNK: printf("this is a link\n"); break; case S_IFREG: printf("this is not a link\n"); break; } My code ALWAYS prints this is not a link even if it is, and I know for a fact that the said file is a symbolic link since the actual ls command says so, plus I created the sym-link... Can anyone spot what I may be doing wrong? Thanks for the help!

    Read the article

  • Sorting arrays in java

    - by user360706
    Write a static method in Java : public static void sortByFour (int[] arr) That receives as a paramater an array full of non-negative numbers (zero or positive) and sorts the array in the following way : In the beginning of the array all the numbers that devide by four without a remainder will appear. After them all the numbers in the array that devide by 4 with a remainder of 1 will appear. After them all the numbers in the array that devide by 4 with a remainder of 2 will appear. In the end of the array all the rest numbers (those who divide by 4 with the remainder 3) will appear. (The order of the numbers in each group doesn't matter) The method must be the most efficient it can. This is what I wrote but unfortunately it doesn't work well... :( public static void swap( int[] arr, int left, int right ) { int temp = arr[left]; arr[left] = arr[right]; arr[right] = temp; } public static void sortByFour( int[] arr ) { int left = 0; int right = ( arr.length - 1 ); int mid = ( arr.length / 2 ); while ( left < right ) { if ( ( arr[left] % 4 ) > ( arr[right] % 4 ) ) { swap( arr, left, right ); right--; } if ( ( arr[left] % 4 ) == ( arr[right] % 4 ) ) left++; else left++; } } Can someone please help me by fixing my code so that it will work well or rewriting it?

    Read the article

  • plane bombing problems- help

    - by peiska
    I'm training code problems, and on this one I am having problems to solve it, can you give me some tips how to solve it please. The problem is something like this: Your task is to find the sequence of points on the map that the bomber is expected to travel such that it hits all vital links. A link from A to B is vital when its absence isolates completely A from B. In other words, the only way to go from A to B (or vice versa) is via that link. Notice that if we destroy for example link (d,e), it becomes impossible to go from d to e,m,l or n in any way. A vital link can be hit at any point that lies in its segment (e.g. a hit close to d is as valid as a hit close to e). Of course, only one hit is enough to neutralize a vital link. Moreover, each bomb affects an exact circle of radius R, i.e., every segment that intersects that circle is considered hit. Due to enemy counter-attack, the plane may have to retreat at any moment, so the plane should follow, at each moment, to the closest vital link possible, even if in the end the total distance grows larger. Given all coordinates (the initial position of the plane and the nodes in the map) and the range R, you have to determine the sequence of positions in which the plane has to drop bombs. This sequence should start (takeoff) and finish (landing) at the initial position. Except for the start and finish, all the other positions have to fall exactly in a segment of the map (i.e. it should correspond to a point in a non-hit vital link segment). The coordinate system used will be UTM (Universal Transverse Mercator) northing and easting, which basically corresponds to a Euclidian perspective of the world (X=Easting; Y=Northing). Input Each input file will start with three floating point numbers indicating the X0 and Y0 coordinates of the airport and the range R. The second line contains an integer, N, indicating the number of nodes in the road network graph. Then, the next N (<10000) lines will each contain a pair of floating point numbers indicating the Xi and Yi coordinates (1 No two links will ever cross with each other. Output The program will print the sequence of coordinates (pairs of floating point numbers with exactly one decimal place), each one at a line, in the order that the plane should visit (starting and ending in the airport). Sample input 1 102.3 553.9 0.2 14 342.2 832.5 596.2 638.5 479.7 991.3 720.4 874.8 744.3 1284.1 1294.6 924.2 1467.5 659.6 1802.6 659.6 1686.2 860.7 1548.6 1111.2 1834.4 1054.8 564.4 1442.8 850.1 1460.5 1294.6 1485.1 17 1 2 1 3 2 4 3 4 4 5 4 6 6 7 7 8 8 9 8 10 9 10 10 11 6 11 5 12 5 13 12 13 13 14 Sample output 1 102.3 553.9 720.4 874.8 850.1 1460.5 102.3 553.9

    Read the article

  • Termite colony simulator using java

    - by ashii
    hi everyone, i hve to design a simulator that will maintain an environment, which consists of a collection of patches arranged in a rectangular grid of arbitrary size. Each patch contains zero or more wood chips. A patch may be occupied by one or more termites or predators, which are mobile entities that live within the world and behave according to simple rules. A TERMITE can pick up a wood chip from the patch that it is currently on, or drop a wood chip that it is carrying. Termites travel around the grid by moving randomly from their current patch to a neighbouring patch, in one of four possible directions. New termites may hatch from eggs, and this is simulated by the appearance of a new termite at a random patch within the environment. A PREDATOR moves in a similar way to termites, and if a predator moves onto a patch that is occupied by a termite, then the predator eats the termite. At initialization, the termites, predators, and wood chips are distributed randomly in the environment. Simulation then proceeds in a loop, and the new state of the environment is obtained at each iteration. i have designed the arena using jpanel but im not able to randomnly place wood,termite and predator in that arena. can any one help me out?? my code for the arena is as following: 01 import java.awt.*; 02 import javax.swing.*; 03 04 public class Arena extends JPanel 05 { 06 private static final int Rows = 8; 07 private static final int Cols = 8; 08 public void paint(Graphics g) 09 { 10 Dimension d = this.getSize(); 11 // don't draw both sets of squares, when you can draw one 12 // fill in the entire thing with one color 13 g.setColor(Color.WHITE); 14 // make the background 15 g.fillRect(0,0,d.width,d.height); 16 // draw only black 17 g.setColor(Color.BLACK); 18 // pick a square size based on the smallest dimension 19 int sqsize = ((d.width<d.height) ? d.width/Cols : d.height/Rows); 20 // loop for rows 21 for (int row=0; row<Rows; row++) 22 { 23 int y = row*sqsize; // y stays same for entire row, set here 24 int x = (row%2)*sqsize; // x starts at 0 or one square in 25 for (int i=0; i<Cols/2; i++) 26 { 27 // you will only be drawing half the squares per row 28 // draw square 29 g.fillRect(x,y,sqsize,sqsize); 30 // move two square sizes over 31 x += sqsize*2; 32 } 33 } 34 35 } 36 37 38 39 public void update(Graphics g) { paint(g); } 40 41 42 43 public static void main (String[] args) 44 { 45 46 JFrame frame = new JFrame("Arena"); 47 frame.setSize(600,400); 48 frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); 49 frame.setContentPane(new Arena()); 50 frame.setVisible(true); 51 } 52 53 }

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Please quickly help with this problem I got 52 minutes left.

    - by Hamish Grubijan
    Write a program that prints the numbers from 1 to 100. But for multiples of three print "Fizz" instead of the number and for the multiples of five print "Buzz". For numbers which are multiples of both three and five print "FizzBuzz". Woman said use any common language. Please make it short and test it. My screen is small. Thanks. P.S. I have test anxiety particularly after talking to people in suits. I also stayed up all night studying Java codes.

    Read the article

  • Passing an array of structs in C

    - by lelouch
    I'm having trouble passing an array of structs to a function in C. I've created the struct like this in main: int main() { struct Items { char code[10]; char description[30]; int stock; }; struct Items MyItems[10]; } I then access it like: MyItems[0].stock = 10; etc. I want to pass it to a function like so: ReadFile(MyItems); The function should read the array, and be able to edit it. Then I should be able to access the same array from other functions. I've tried heaps of declarations but none of them work. e.g. void ReadFile(struct Items[10]) I've had a look around for other questions, but the thing is they're all done different, with typedefs and asterisks. My teacher hasn't taught us pointers yet, so I'd like to do it with what I know. Any ideas? :S EDIT: Salvatore's answer is working after I fixed my prototype to: void ReadFile(struct Items[9]);

    Read the article

  • How to create initializeDB() method for java database

    - by Holly
    I am working on a Java project for class and have not worked much with incorporating databases into Java. I can't find much on the initializeDB() method, but if I could get some help I would really appreciate it. Below is the code being used for the intializeDB() method: private void initializeDB() { try { // Load the JDBC driver System.out.println("Driver loaded"); // Establish a connection System.out.println("Database connected"); // Create a statement // Create a SQL Query string // Execute the query to create a recordset } catch (Exception ex) { ex.printStackTrace(); } }

    Read the article

  • Unresolved external symbol error in c++

    - by Crystal
    I am trying to do a simple hw problem involving namespace, static data members and functions. I am getting an unresolved external symbol error Error 1 error LNK2001: unresolved external symbol "private: static double JWong::SavingsAccount::annualInterestRate" (?annualInterestRate@SavingsAccount@JWong@@0NA) SavingsAccount.obj SavingsAccount And I don't see why I am getting this error. Maybe I don't know something about static variables compared to regular data members that is causing this error. Here is my code: SavingsAccount.h file #ifndef JWONG_SAVINGSACCOUNT_H #define JWONG_SAVINGSACCOUNT_H namespace JWong { class SavingsAccount { public: // default constructor SavingsAccount(); // constructor SavingsAccount(double savingsBalance); double getSavingsBalance(); void setSavingsBalance(double savingsBalance); double calculateMonthlyInterest(); // static functions static void modifyInterestRate(double newInterestRate); static double getAnnualInterestRest(); private: double savingsBalance; // static members static double annualInterestRate; }; } #endif SavingsAccount.cpp file #include <iostream> #include "SavingsAccount.h" // default constructor, set savingsBalance to 0 JWong::SavingsAccount::SavingsAccount() : savingsBalance(0) {} // constructor JWong::SavingsAccount::SavingsAccount(double savingsBalance) : savingsBalance(savingsBalance) {} double JWong::SavingsAccount::getSavingsBalance() { return savingsBalance; } void JWong::SavingsAccount::setSavingsBalance(double savingsBalance) { this->savingsBalance = savingsBalance; } // returns monthly interest and sets savingsBalance to new amount double JWong::SavingsAccount::calculateMonthlyInterest() { double monthlyInterest = savingsBalance * SavingsAccount::annualInterestRate / 12; setSavingsBalance(savingsBalance + monthlyInterest); return monthlyInterest; } void JWong::SavingsAccount::modifyInterestRate(double newInterestRate) { SavingsAccount::annualInterestRate = newInterestRate; } double JWong::SavingsAccount::getAnnualInterestRest() { return SavingsAccount::annualInterestRate; }

    Read the article

  • java programming

    - by Baiba
    ok i have version of t code, please tell me what i need to do when i need to get out of program The INDEX NUMBER OF COLUMN IN WHICH ARE LEAST ZEROS? class Uzd{ public static void main(String args[]){ int mas[][]= {{3,4,7,5,0}, {4,5,3,0,1}, {8,2,4,0,3}, {7,0,2,0,1}, {0,0,1,3,0}}; int nul_mas[] = new int[5]; int nul=0; for(int j=0;j<5;j++){// nul=0; for(int i=0;i<5;i++){ if(mas[i][j]==0){ nul++; } } nul_mas[j]=nul; } for(int i=0;i<5;i++){ for(int j=0;j<5;j++){ System.out.print(mas[i][j]); } System.out.println(); } System.out.println();// atstarpe System.out.println("///zeros in each column///"); for(int i=0;i<5;i++){System.out.print(nul_mas[i]);} System.out.println(); }} and after running it shows: 34750 45301 82403 70201 00130 ///zeros in each column/// But i need not in each column but i need to get out index of column in which zeros are least! in this situation it is column nubmer 2!! 12032

    Read the article

  • Help in C with integers

    - by inferno2991
    You need to use division and remainder by 10. Consider this example: 163 divided by 10 is 16 remainder 3 16 divided by 10 is 1 remainder 6 1 divided by 10 is 0 remainder 1 You'll notice the remainder is always the last digit of the number that's being divided. Now figure out a way to do this in C... How do i do it in c Help :(

    Read the article

  • Returning multiple aggregate functions as rows

    - by SDLFunTimes
    I need some help formulating a select statement. I need to select the total quantity shipped for each part with a distinct color. So the result should be a row with the color name and the total. Here's my schema: create table s ( sno char(5) not null, sname char(20) not null, status smallint, city char(15), primary key (sno) ); create table p ( pno char(6) not null, pname char(20) not null, color char(6), weight smallint, city char(15), primary key (pno) ); create table sp ( sno char(5) not null, pno char(6) not null, qty integer not null, primary key (sno, pno) );

    Read the article

  • Running a Java program with input from a file

    - by Katy
    I am writing a program that reads the input from a file and then prints it to the screen. When I run it without taking the input from the file, it works perfectly fine. However, every time I try to run it from the file it gives me an "Exception in thread "main" java.util.NoSuchElementException: No line found at" error that occurs every place the input is suppose to be read. I have no idea what is going on.

    Read the article

  • Can someone help with big O notation?

    - by Dann
    void printScientificNotation(double value, int powerOfTen) { if (value >= 1.0 && value < 10.0) { System.out.println(value + " x 10^" + powerOfTen); } else if (value < 1.0) { printScientificNotation(value * 10, powerOfTen - 1); } else // value >= 10.0 { printScientificNotation(value / 10, powerOfTen + 1); } } I understand how the method goes but I cannot figure out a way to represent the method. For example, if value was 0.00000009 or 9e-8, the method will call on printScientificNotation(value * 10, powerOfTen - 1); eight times and System.out.println(value + " x 10^" + powerOfTen); once. So the it is called recursively by the exponent for e. But how do I represent this by big O notation? Thanks!

    Read the article

  • Write a C++ program to encrypt and decrypt certain codes.

    - by Amber
    Step 1: Write a function int GetText(char[],int); which fills a character array from a requested file. That is, the function should prompt the user to input the filename, and then read up to the number of characters given as the second argument, terminating when the number has been reached or when the end of file is encountered. The file should then be closed. The number of characters placed in the array is then returned as the value of the function. Every character in the file should be transferred to the array. Whitespace should not be removed. When testing, assume that no more than 5000 characters will be read. The function should be placed in a file called coding.cpp while the main will be in ass5.cpp. To enable the prototypes to be accessible, the file coding.h contains the prototypes for all the functions that are to be written in coding.cpp for this assignment. (You may write other functions. If they are called from any of the functions in coding.h, they must appear in coding.cpp where their prototypes should also appear. Do not alter coding.h. Any other functions written for this assignment should be placed, along with their prototypes, with the main function.) Step 2: Write a function int SimplifyText(char[],int); which simplifies the text in the first argument, an array containing the number of characters as given in the second argument, by converting all alphabetic characters to lower case, removing all non-alpha characters, and replacing multiple whitespace by one blank. Any leading whitespace at the beginning of the array should be removed completely. The resulting number of characters should be returned as the value of the function. Note that another array cannot appear in the function (as the file does not contain one). For example, if the array contained the 29 characters "The 39 Steps" by John Buchan (with the " appearing in the array), the simplified text would be the steps by john buchan of length 24. The array should not contain a null character at the end. Step 3: Using the file test.txt, test your program so far. You will need to write a function void PrintText(const char[],int,int); that prints out the contents of the array, whose length is the second argument, breaking the lines to exactly the number of characters in the third argument. Be warned that, if the array contains newlines (as it would when read from a file), lines will be broken earlier than the specified length. Step 4: Write a function void Caesar(const char[],int,char[],int); which takes the first argument array, with length given by the second argument and codes it into the third argument array, using the shift given in the fourth argument. The shift must be performed cyclicly and must also be able to handle negative shifts. Shifts exceeding 26 can be reduced by modulo arithmetic. (Is C++'s modulo operations on negative numbers a problem here?) Demonstrate that the test file, as simplified, can be coded and decoded using a given shift by listing the original input text, the simplified text (indicating the new length), the coded text and finally the decoded text. Step 5: The permutation cypher does not limit the character substitution to just a shift. In fact, each of the 26 characters is coded to one of the others in an arbitrary way. So, for example, a might become f, b become q, c become d, but a letter never remains the same. How the letters are rearranged can be specified using a seed to the random number generator. The code can then be decoded, if the decoder has the same random number generator and knows the seed. Write the function void Permute(const char[],int,char[],unsigned long); with the same first three arguments as Caesar above, with the fourth argument being the seed. The function will have to make up a permutation table as follows: To find what a is coded as, generate a random number from 1 to 25. Add that to a to get the coded letter. Mark that letter as used. For b, generate 1 to 24, then step that many letters after b, ignoring the used letter if encountered. For c, generate 1 to 23, ignoring a or b's codes if encountered. Wrap around at z. Here's an example, for only the 6 letters a, b, c, d, e, f. For the letter a, generate, from 1-5, a 2. Then a - c. c is marked as used. For the letter b, generate, from 1-4, a 3. So count 3 from b, skipping c (since it is marked as used) yielding the coding of b - f. Mark f as used. For c, generate, from 1-3, a 3. So count 3 from c, skipping f, giving a. Note the wrap at the last letter back to the first. And so on, yielding a - c b - f c - a d - b (it got a 2) e - d f - e Thus, for a given seed, a translation table is required. To decode a piece of text, we need the table generated to be re-arranged so that the right hand column is in order. In fact you can just store the table in the reverse way (e.g., if a gets encoded to c, put a opposite c is the table). Write a function called void DePermute(const char[],int,char[], unsigned long); to reverse the permutation cypher. Again, test your functions using the test file. At this point, any main program used to test these functions will not be required as part of the assignment. The remainder of the assignment uses some of these functions, and needs its own main function. When submitted, all the above functions will be tested by the marker's own main function. Step 6: If the seed number is unknown, decoding is difficult. Write a main program which: (i) reads in a piece of text using GetText; (ii) simplifies the text using SimplifyText; (iii) prints the text using PrintText; (iv) requests two letters to swap. If we think 'a' in the text should be 'q' we would type aq as input. The text would be modified by swapping the a's and q's, and the text reprinted. Repeat this last step until the user considers the text is decoded, when the input of the same letter twice (requesting a letter to be swapped with itself) terminates the program. Step 7: If we have a large enough sample of coded text, we can use knowledge of English to aid in finding the permutation. The first clue is in the frequency of occurrence of each letter. Write a function void LetterFreq(const char[],int,freq[]); which takes the piece of text given as the first two arguments (same as above) and returns in the 26 long array of structs (the third argument), the table of the frequency of the 26 letters. This frequency table should be in decreasing order of popularity. A simple Selection Sort will suffice. (This will be described in lectures.) When printed, this summary would look something like v x r s z j p t n c l h u o i b w d g e a q y k f m 168106 68 66 59 54 48 45 44 35 26 24 22 20 20 20 17 13 12 12 4 4 1 0 0 0 The formatting will require the use of input/output manipulators. See the header file for the definition of the struct called freq. Modify the program so that, before each swap is requested, the current frequency of the letters is printed. This does not require further calls to LetterFreq, however. You may use the traditional order of regular letter frequencies (E T A I O N S H R D L U) as a guide when deciding what characters to exchange. Step 8: The decoding process can be made more difficult if blank is also coded. That is, consider the alphabet to be 27 letters. Rewrite LetterFreq and your main program to handle blank as another character to code. In the above frequency order, space usually comes first.

    Read the article

  • Java: How to check the random letters from a-z, out of 10 letters minimum 2 letter should be a vowel

    - by kalandar
    I am writing a program to validate the following scenarios: Scenario 1: I am using the Random class from java.util. The random class will generate 10 letters from a-z and within 10 letter, minimum 2 letters must be a vowels. Scenario 2: When the player 1 and player 2 form a word from A-Z, he will score some points. There will be a score for each letter. I have already assigned the values for A-Z. At the end of the game, the system should display a scores for player 1 and player 2. How do i do it? Please help. I will post my code here. Thanks a lot. =========================================== import java.util.Random; import java.util.Scanner; public class FindYourWords { public static void main(String[] args) { Random rand = new Random(); Scanner userInput = new Scanner(System.in); //==================Player object=============================================== Player playerOne = new Player(); playerOne.wordScore = 0; playerOne.choice = "blah"; playerOne.turn = true; Player playerTwo = new Player(); playerTwo.wordScore = 0; playerTwo.choice = "blah"; playerTwo.turn = false; //================== Alphabet ================================================== String[] newChars = { "a", "b", "c", "d", "e", "f", "g", "h", "i", "j", "k", "l", "m", "n", "o", "p", "q", "r", "s", "t", "u", "v", "w", "x", "y", "z" }; //values of the 26 alphabets to be used int [] letterScore = {1,3,3,2,1,4,2,4,1,8,5,1,3,1,1,3,10,1,1,1,1,4,4,8,4,10}; // to assign score to the player1 and player 2 String[] vowel = { "a", "e", "i", "o", "u" }; // values for vowels int vow=0; System.out.println("FINDYOURWORDS\n"); int[] arrayRandom = new int[10]; //int array for word limiter String[] randomLetter = new String[10]; //storing the letters in newChars into this array //=============================================================================== boolean cont = true; while (cont) { if (playerOne.turn) { System.out.print("Letters of Player 1: "); } else if (!playerOne.turn) { System.out.print("Letters of Player 2: "); } for (int i = 0; i < arrayRandom.length; i++) { //running through the array limiter int r = rand.nextInt(newChars.length); //assigning random nums to the array of letters randomLetter[i] = newChars[r]; System.out.print(randomLetter[i]+ " "); } //input section for player System.out.println(""); System.out.println("Enter your word (or '@' to pass or '!' to quit): "); if (playerOne.turn) { playerOne.choice = userInput.next(); System.out.println(playerOne.turn); playerOne.turn = false; } else if (!playerOne.turn){ playerTwo.choice = userInput.next(); System.out.println(playerOne.turn); playerOne.turn = true; } //System.out.println(choice); String[] wordList = FileUtil.readDictFromFile("words.txt"); //Still dunno what this is for if (playerOne.choice.equals("@")) { playerOne.turn = false; } else if (playerTwo.choice.equals("@")) { playerOne.turn = true; } else if (playerOne.choice.equals("!")) { cont = false; } for (int i = 0; i < wordList.length; i++) { //System.out.println(wordList[i]); if (playerOne.choice.equalsIgnoreCase(wordList[i]) || playerTwo.choice.equalsIgnoreCase(wordList[i])){ } } } }}

    Read the article

  • How to create a simple Proxy to access web servers in C

    - by jesusiniesta
    Hi. I’m trying to create an small Web Proxy in C. First, I’m trying to get a webpage, sending a GET frame to the server. I don’t know what I have missed, but I am not receiving any response. I would really appreciate if you can help me to find what is missing in this code. int main (int argc, char** argv) { int cache_size, //size of the cache in KiB port, port_google = 80, dir, mySocket, socket_google; char google[] = "www.google.es", ip[16]; struct sockaddr_in socketAddr; char buffer[10000000]; if (GetParameters(argc,argv,&cache_size,&port) != 0) return -1; GetIP (google, ip); printf("ip2 = %s\n",ip); dir = inet_addr (ip); printf("ip3 = %i\n",dir); /* Creation of a socket with Google */ socket_google = conectClient (port_google, dir, &socketAddr); if (socket_google < 0) return -1; else printf("Socket created\n"); sprintf(buffer,"GET /index.html HTTP/1.1\r\n\r\n"); if (write(socket_google, (void*)buffer, LONGITUD_MSJ+1) < 0 ) return 1; else printf("GET frame sent\n"); strcpy(buffer,"\n"); read(socket_google, buffer, sizeof(buffer)); // strcpy(message,buffer); printf("%s\n", buffer); return 0; } And this is the code I use to create the socket. I think this part is OK, but I copy it just in case. int conectClient (int puerto, int direccion, struct sockaddr_in *socketAddr) { int mySocket; char error[1000]; if ( (mySocket = socket(AF_INET, SOCK_STREAM, 0)) == -1) { printf("Error when creating the socket\n"); return -2; } socketAddr->sin_family = AF_INET; socketAddr->sin_addr.s_addr = direccion; socketAddr->sin_port = htons(puerto); if (connect (mySocket, (struct sockaddr *)socketAddr,sizeof (*socketAddr)) == -1) { snprintf(error, sizeof(error), "Error in %s:%d\n", __FILE__, __LINE__); perror(error); printf("%s\n",error); printf ("-- Error when stablishing a connection\n"); return -1; } return mySocket; } Thanks!

    Read the article

  • Enumeration trouble: redeclared as different kind of symbol

    - by Matt
    Hello all. I am writing a program that is supposed to help me learn about enumeration data types in C++. The current trouble is that the compiler doesn't like my enum usage when trying to use the new data type as I would other data types. I am getting the error "redeclared as different kind of symbol" when compiling my trangleShape function. Take a look at the relevant code. Any insight is appreciated! Thanks! (All functions are their own .cpp files.) header file #ifndef HEADER_H_INCLUDED #define HEADER_H_INCLUDED #include <iostream> #include <iomanip> using namespace std; enum triangleType {noTriangle, scalene, isoceles, equilateral}; //prototypes void extern input(float&, float&, float&); triangleType extern triangleShape(float, float, float); /*void extern output (float, float, float);*/ void extern myLabel(const char *, const char *); #endif // HEADER_H_INCLUDED main function //8.1 main // this progam... #include "header.h" int main() { float sideLength1, sideLength2, sideLength3; char response; do //main loop { input (sideLength1, sideLength2, sideLength3); triangleShape (sideLength1, sideLength2, sideLength3); //output (sideLength1, sideLength2, sideLength3); cout << "\nAny more triangles to analyze? (y,n) "; cin >> response; } while (response == 'Y' || response == 'y'); myLabel ("8.1", "2/11/2011"); return 0; } triangleShape shape # include "header.h" triangleType triangleShape(sideLenght1, sideLength2, sideLength3) { triangleType triangle; return triangle; }

    Read the article

  • paintComponent method is not displaying anything on the panel

    - by Captain Gh0st
    I have been trying to debug this for hours. The program is supposed to be a grapher that graphs coordinates, but i cannot get anything to display not even a random line, but if i put a print statement there it works. It is a problem with the paintComponent Method. When I out print statement before g.drawLine then it prints, but it doesn't draw any lines even if i put a random line with coordinates (1,3), (2,4). import java.awt.*; import java.util.*; import javax.swing.*; public abstract class XYGrapher { abstract public Coordinate xyStart(); abstract public double xRange(); abstract public double yRange(); abstract public Coordinate getPoint(int pointNum); public class Paint extends JPanel { public void paintGraph(Graphics g, int xPixel1, int yPixel1, int xPixel2, int yPixel2) { super.paintComponent(g); g.setColor(Color.black); g.drawLine(xPixel1, yPixel1, xPixel2, yPixel2); } public void paintXAxis(Graphics g, int xPixel, int pixelsWide, int pixelsHigh) { super.paintComponent(g); g.setColor(Color.green); g.drawLine(xPixel, 0, xPixel, pixelsHigh); } public void paintYAxis(Graphics g, int yPixel, int pixelsWide, int pixelsHigh) { super.paintComponent(g); g.setColor(Color.green); g.drawLine(0, yPixel, pixelsWide, yPixel); } } public void drawGraph(int xPixelStart, int yPixelStart, int pixelsWide, int pixelsHigh) { JFrame frame = new JFrame(); Paint panel = new Paint(); panel.setPreferredSize(new Dimension(pixelsWide, pixelsHigh)); panel.setMinimumSize(new Dimension(pixelsWide, pixelsHigh)); panel.setMaximumSize(new Dimension(pixelsWide, pixelsHigh)); frame.setLocation(frame.getToolkit().getScreenSize().width / 2 - pixelsWide / 2, frame.getToolkit().getScreenSize().height / 2 - pixelsHigh / 2); frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); frame.setResizable(false); frame.add(panel); frame.pack(); frame.setVisible(true); double xRange = xRange(); double yRange = yRange(); Coordinate xyStart = xyStart(); int xPixel = xPixelStart - (int) (xyStart.getX() * (pixelsWide / xRange)); int yPixel = yPixelStart + (int) ((xyStart.getY() + yRange) * (pixelsHigh / yRange)); System.out.println(xPixel + " " + yPixel); if(yPixel > 0 && (yPixel < pixelsHigh)) { System.out.println("y"); panel.paintYAxis(panel.getGraphics(), yPixel, pixelsWide, pixelsHigh); } if(xPixel > 0 && (xPixel < pixelsHigh)) { System.out.println("x"); panel.paintXAxis(panel.getGraphics(), xPixel, pixelsWide, pixelsHigh); } for(int i = 0; i>=0; i++) { Coordinate point1 = getPoint(i); Coordinate point2 = getPoint(i+1); if(point2 == null) { break; } else { if(point1.drawFrom() && point2.drawTo()) { int xPixel1 = (int) (xPixelStart + (point1.getX() - xyStart.getX()) * (pixelsWide / xRange)); int yPixel1 = (int) (yPixelStart + (xyStart.getY() + yRange-point1.getY()) * (pixelsHigh / yRange)); int xPixel2 = (int) (xPixelStart + (point2.getX() - xyStart.getX()) * (pixelsWide / xRange)); int yPixel2 = (int) (yPixelStart + (xyStart.getY() + yRange - point2.getY()) * (pixelsHigh / yRange)); panel.paintGraph(panel.getGraphics(), xPixel1, yPixel1, xPixel2, yPixel2); } } } frame.pack(); } } This is how i am testing it is supposed to be a square, but nothing shows up. public class GrapherTester extends XYGrapher { public Coordinate xyStart() { return new Coordinate(-2,2); } public double xRange() { return 4; } public double yRange() { return 4; } public Coordinate getPoint(int pointNum) { switch(pointNum) { case 0: return new Coordinate(-1,-1); case 1: return new Coordinate(1,-1); case 2: return new Coordinate(1,1); case 3: return new Coordinate(-1,1); case 4: return new Coordinate(-1,-1); } return null; } public static void main(String[] args) { new GrapherTester().drawGraph(100, 100, 500, 500); } } Coordinate class so if any of you want to run and try it out. That is all you would need. public class Coordinate { float x; float y; boolean drawTo; boolean drawFrom; Coordinate(double x, double y) { this.x = (float) x; this.y = (float) y; drawFrom = true; drawTo = true; } Coordinate(double x, double y, boolean drawFrom, boolean drawTo) { this.x = (float) x; this.y = (float) y; this.drawFrom = drawFrom; this.drawTo = drawTo; } public double getX() { return x; } public double getY() { return y; } public boolean drawTo() { return drawTo; } public boolean drawFrom() { return drawFrom; } }

    Read the article

  • Read from file in eclipse

    - by Buzkie
    I'm trying to read from a text file to input data to my java program. However, eclipse continuosly gives me a Source not found error no matter where I put the file. I've made an additional sources folder in the project directory, the file in question is in both it and the bin file for the project and it still can't find it. I even put a copy of it on my desktop and tried pointing eclipse there when it asked me to browse for the source lookup path. No matter what I do it can't find the file. here's my code in case it's pertinent: System.out.println(System.getProperty("user.dir")); File file = new File("file.txt"); Scanner scanner = new Scanner(file); in addition, it says the user directory is the project directory and there is a copy there too. I have no clue what to do. Thanks, Alex after attempting the suggestion below and refreshing again, I was greeted by a host of errors. FileNotFoundException(Throwable).<init>(String) line: 195 FileNotFoundException(Exception).<init>(String) line: not available FileNotFoundException(IOException).<init>(String) line: not available FileNotFoundException.<init>(String) line: not available URLClassPath$JarLoader.getJarFile(URL) line: not available URLClassPath$JarLoader.access$600(URLClassPath$JarLoader, URL) line: not available URLClassPath$JarLoader$1.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] URLClassPath$JarLoader.ensureOpen() line: not available URLClassPath$JarLoader.<init>(URL, URLStreamHandler, HashMap) line: not available URLClassPath$3.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] URLClassPath.getLoader(URL) line: not available URLClassPath.getLoader(int) line: not available URLClassPath.access$000(URLClassPath, int) line: not available URLClassPath$2.next() line: not available URLClassPath$2.hasMoreElements() line: not available ClassLoader$2.hasMoreElements() line: not available CompoundEnumeration<E>.next() line: not available CompoundEnumeration<E>.hasMoreElements() line: not available ServiceLoader$LazyIterator.hasNext() line: not available ServiceLoader$1.hasNext() line: not available LocaleServiceProviderPool$1.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] LocaleServiceProviderPool.<init>(Class<LocaleServiceProvider>) line: not available LocaleServiceProviderPool.getPool(Class<LocaleServiceProvider>) line: not available NumberFormat.getInstance(Locale, int) line: not available NumberFormat.getNumberInstance(Locale) line: not available Scanner.useLocale(Locale) line: not available Scanner.<init>(Readable, Pattern) line: not available Scanner.<init>(ReadableByteChannel) line: not available Scanner.<init>(File) line: not available code used: System.out.println(System.getProperty("user.dir")); File file = new File(System.getProperty("user.dir") + "/file.txt"); Scanner scanner = new Scanner(file);

    Read the article

  • Linked Lists in Java - Help with assignment

    - by doron2010
    I have been trying to solve this assignment all day, please help me. I'm completely lost. Representation of a string in linked lists In every intersection in the list there will be 3 fields : The letter itself. The number of times it appears consecutively. A pointer to the next intersection in the list. The following class CharNode represents a intersection in the list : public class CharNode { private char _data; private int _value; private charNode _next; public CharNode (char c, int val, charNode n) { _data = c; _value = val; _next = n; } public charNode getNext() { return _next; } public void setNext (charNode node) { _next = node; } public int getValue() { return _value; } public void setValue (int v) { value = v; } public char getData() { return _data; } public void setData (char c) { _data = c; } } The class StringList represents the whole list : public class StringList { private charNode _head; public StringList() { _head = null; } public StringList (CharNode node) { _head = node; } } Add methods to the class StringList according to the details : (Pay attention, these are methods from the class String and we want to fulfill them by the representation of a string by a list as explained above) public char charAt (int i) - returns the char in the place i in the string. Assume that the value of i is in the right range. public StringList concat (String str) - returns a string that consists of the string that it is operated on and in its end the string "str" is concatenated. public int indexOf (int ch) - returns the index in the string it is operated on of the first appeareance of the char "ch". If the char "ch" doesn't appear in the string, returns -1. If the value of fromIndex isn't in the range, returns -1. public int indexOf (int ch, int fromIndex) - returns the index in the string it is operated on of the first appeareance of the char "ch", as the search begins in the index "fromIndex". If the char "ch" doesn't appear in the string, returns -1. public boolean equals (String str) - returns true if the string that it is operated on is equal to the string str. Otherwise returns false. This method must be written in recursion, without using loops at all. public int compareTo (String str) - compares between the string that the method is operated on to the string "str" that is in the parameter. The method returns 0 if the strings are equal. If the string in the object is smaller lexicographic from the string "str" in the paramater, a negative number will be returned. And if the string in the object is bigger lexicographic from the string "str", a positive number will be returned. public StringList substring (int i) - returns the list of the substring that starts in the place i in the string on which it operates. Meaning, the sub-string from the place i until the end of the string. Assume the value of i is in the right range. public StringList substring (int i, int j) - returns the list of the substring that begins in the place i and ends in the place j (not included) in the string it operates on. Assume the values of i, j are in the right range. public int length() - will return the length of the string on which it operates. Pay attention to all the possible error cases. Write what is the time complexity and space complexity of every method that you wrote. Make sure the methods you wrote are effective. It is NOT allowed to use ready classes of Java. It is NOT allowed to move to string and use string operations.

    Read the article

< Previous Page | 29 30 31 32 33 34 35 36 37 38 39 40  | Next Page >