Search Results

Search found 1552 results on 63 pages for 'homework'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 33/63 | < Previous Page | 29 30 31 32 33 34 35 36 37 38 39 40  | Next Page >

  • java programming

    - by Baiba
    ok i have version of t code, please tell me what i need to do when i need to get out of program The INDEX NUMBER OF COLUMN IN WHICH ARE LEAST ZEROS? class Uzd{ public static void main(String args[]){ int mas[][]= {{3,4,7,5,0}, {4,5,3,0,1}, {8,2,4,0,3}, {7,0,2,0,1}, {0,0,1,3,0}}; int nul_mas[] = new int[5]; int nul=0; for(int j=0;j<5;j++){// nul=0; for(int i=0;i<5;i++){ if(mas[i][j]==0){ nul++; } } nul_mas[j]=nul; } for(int i=0;i<5;i++){ for(int j=0;j<5;j++){ System.out.print(mas[i][j]); } System.out.println(); } System.out.println();// atstarpe System.out.println("///zeros in each column///"); for(int i=0;i<5;i++){System.out.print(nul_mas[i]);} System.out.println(); }} and after running it shows: 34750 45301 82403 70201 00130 ///zeros in each column/// But i need not in each column but i need to get out index of column in which zeros are least! in this situation it is column nubmer 2!! 12032

    Read the article

  • Problem with python class

    - by Tasbeer
    Hi I am new to Python and as a part of my assignment I have written the following class import nltk.stem.api class BanglaStemmer(nltk.stem.api.StemmerI): suffixList = ['\xef\xbb\xbf\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbf\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa7\x87\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x8b\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbf\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa7\x87\n', '\xe0\xa7\x87\xe0\xa6\x9b\n', '\xe0\xa6\xa4\xe0\xa7\x87\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbf\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa7\x87\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbf\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa6\x9b\xe0\xa6\xbf\n', '\xe0\xa6\x9b\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\x9b\n', '\xe0\xa6\xa4\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa6\xa4\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa6\xb2\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa6\xb2\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\xa4\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\xac\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa7\x81\xe0\xa6\xa8\n', '\xe0\xa7\x81\xe0\xa6\x95\n', '\xe0\xa6\xb2\xe0\xa7\x87\n', '\xe0\xa6\xac\xe0\xa7\x87\n', '\xe0\xa6\xb2\xe0\xa6\xbf\n', '\xe0\xa6\xac\xe0\xa6\xbf\n', '\xe0\xa6\xa4\xe0\xa6\xbf\n', '\xe0\xa6\xb2\n', '\xe0\xa6\xa4\n', '\xe0\xa7\x8b\n', '\xe0\xa6\xbf\n', '\xe0\xa7\x87\n', '\xe0\xa7\x8d\n', '\xe0\xa6\x87\n', '\xe0\xa6\xac\n', '\xe0\xa6\xb8\n', '\xe0\xa6\xa8\n', '\xe0\xa6\x95\n', '\xe0\xa6\x93\n', '\xe0\xa7\x9f\n'] def stem(self,token): for suffix in suffixList: if token.endswith(suffix): return token[:-len(suffix)] return token The problem is that when I try to compile run it by creating an instance and calling the stem() function with a parameter , it says that the suffixList is not defined. Couldn't figure out what's the problem. Is there a different way in which the class variables have to be declared ? please help

    Read the article

  • fprintf() within a subprogram

    - by sergio
    Im stuck when trying to write to my file within my subprogram. void new_page(float *a, float *b, float *c, int *d){ fprintf(results,"\nPage Totals: %f\t%f\t%f\t%d", *a,*b,*c,*d); } I get a warning saying "Warning: incompatible implicit declaration of built-in function 'fprinf' [enabled by default]" "error: 'results' undeclared (first use in this function)" in main fprintf works fine, its just when it comes to the subprogram/function it wont work. from my understanding it thinks that results is undeclared, so do i have to pass the name or location of the file to make it work?

    Read the article

  • How to create a simple Proxy to access web servers in C

    - by jesusiniesta
    Hi. I’m trying to create an small Web Proxy in C. First, I’m trying to get a webpage, sending a GET frame to the server. I don’t know what I have missed, but I am not receiving any response. I would really appreciate if you can help me to find what is missing in this code. int main (int argc, char** argv) { int cache_size, //size of the cache in KiB port, port_google = 80, dir, mySocket, socket_google; char google[] = "www.google.es", ip[16]; struct sockaddr_in socketAddr; char buffer[10000000]; if (GetParameters(argc,argv,&cache_size,&port) != 0) return -1; GetIP (google, ip); printf("ip2 = %s\n",ip); dir = inet_addr (ip); printf("ip3 = %i\n",dir); /* Creation of a socket with Google */ socket_google = conectClient (port_google, dir, &socketAddr); if (socket_google < 0) return -1; else printf("Socket created\n"); sprintf(buffer,"GET /index.html HTTP/1.1\r\n\r\n"); if (write(socket_google, (void*)buffer, LONGITUD_MSJ+1) < 0 ) return 1; else printf("GET frame sent\n"); strcpy(buffer,"\n"); read(socket_google, buffer, sizeof(buffer)); // strcpy(message,buffer); printf("%s\n", buffer); return 0; } And this is the code I use to create the socket. I think this part is OK, but I copy it just in case. int conectClient (int puerto, int direccion, struct sockaddr_in *socketAddr) { int mySocket; char error[1000]; if ( (mySocket = socket(AF_INET, SOCK_STREAM, 0)) == -1) { printf("Error when creating the socket\n"); return -2; } socketAddr->sin_family = AF_INET; socketAddr->sin_addr.s_addr = direccion; socketAddr->sin_port = htons(puerto); if (connect (mySocket, (struct sockaddr *)socketAddr,sizeof (*socketAddr)) == -1) { snprintf(error, sizeof(error), "Error in %s:%d\n", __FILE__, __LINE__); perror(error); printf("%s\n",error); printf ("-- Error when stablishing a connection\n"); return -1; } return mySocket; } Thanks!

    Read the article

  • How do I make software that preserves database integrity and correctness? Please help, confused.

    - by user287745
    i have made an application project in vs 08 c#, sql server from vs 08. the database has like 20 tables and many fields in each have made an interface for adding deleting editting and retrieving data according to predefined needs of the users. now i have to 1) make to project in to a software which i can deliver to professor. that is he can just double click the icon and the software simply starts. no vs 08 needed to start the debugging 2) the database will be on one powerful computer (dual core latest everything win xp) and the user will access it from another computer connected using LAN i am able to change the connection string to the shared database using vs 08/ debugger whenever the server changes but how am i supposed to do that when its a software? 3)there will by many clients am i supposed to give the same software to every one, so they all can connect to the database, how will the integrity and correctness of the database be maintained? i mean the db.mdf file will be in a folder which will be shared with read and write access. so its not necessary that only one user will write at a time. so is there any coding for this or? please help me out here i am stuck do not know what to do i have no practical experience, would appreciate all the help thank you

    Read the article

  • Returning multiple aggregate functions as rows

    - by SDLFunTimes
    I need some help formulating a select statement. I need to select the total quantity shipped for each part with a distinct color. So the result should be a row with the color name and the total. Here's my schema: create table s ( sno char(5) not null, sname char(20) not null, status smallint, city char(15), primary key (sno) ); create table p ( pno char(6) not null, pname char(20) not null, color char(6), weight smallint, city char(15), primary key (pno) ); create table sp ( sno char(5) not null, pno char(6) not null, qty integer not null, primary key (sno, pno) );

    Read the article

  • How do you determine using stat() whether a file is a symbolic link?

    - by hora
    I basically have to write a clone of the UNIX ls command for a class, and I've got almost everything working. One thing I can't seem to figure out how to do is check whether a file is a symbolic link or not. From the man page for stat(), I see that there is a mode_t value defined, S_IFLNK. This is how I'm trying to check whether a file is a sym-link, with no luck (note, stbuf is the buffer that stat() returned the inode data into): switch(stbuf.st_mode & S_IFMT){ case S_IFLNK: printf("this is a link\n"); break; case S_IFREG: printf("this is not a link\n"); break; } My code ALWAYS prints this is not a link even if it is, and I know for a fact that the said file is a symbolic link since the actual ls command says so, plus I created the sym-link... Can anyone spot what I may be doing wrong? Thanks for the help!

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • paintComponent method is not displaying anything on the panel

    - by Captain Gh0st
    I have been trying to debug this for hours. The program is supposed to be a grapher that graphs coordinates, but i cannot get anything to display not even a random line, but if i put a print statement there it works. It is a problem with the paintComponent Method. When I out print statement before g.drawLine then it prints, but it doesn't draw any lines even if i put a random line with coordinates (1,3), (2,4). import java.awt.*; import java.util.*; import javax.swing.*; public abstract class XYGrapher { abstract public Coordinate xyStart(); abstract public double xRange(); abstract public double yRange(); abstract public Coordinate getPoint(int pointNum); public class Paint extends JPanel { public void paintGraph(Graphics g, int xPixel1, int yPixel1, int xPixel2, int yPixel2) { super.paintComponent(g); g.setColor(Color.black); g.drawLine(xPixel1, yPixel1, xPixel2, yPixel2); } public void paintXAxis(Graphics g, int xPixel, int pixelsWide, int pixelsHigh) { super.paintComponent(g); g.setColor(Color.green); g.drawLine(xPixel, 0, xPixel, pixelsHigh); } public void paintYAxis(Graphics g, int yPixel, int pixelsWide, int pixelsHigh) { super.paintComponent(g); g.setColor(Color.green); g.drawLine(0, yPixel, pixelsWide, yPixel); } } public void drawGraph(int xPixelStart, int yPixelStart, int pixelsWide, int pixelsHigh) { JFrame frame = new JFrame(); Paint panel = new Paint(); panel.setPreferredSize(new Dimension(pixelsWide, pixelsHigh)); panel.setMinimumSize(new Dimension(pixelsWide, pixelsHigh)); panel.setMaximumSize(new Dimension(pixelsWide, pixelsHigh)); frame.setLocation(frame.getToolkit().getScreenSize().width / 2 - pixelsWide / 2, frame.getToolkit().getScreenSize().height / 2 - pixelsHigh / 2); frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); frame.setResizable(false); frame.add(panel); frame.pack(); frame.setVisible(true); double xRange = xRange(); double yRange = yRange(); Coordinate xyStart = xyStart(); int xPixel = xPixelStart - (int) (xyStart.getX() * (pixelsWide / xRange)); int yPixel = yPixelStart + (int) ((xyStart.getY() + yRange) * (pixelsHigh / yRange)); System.out.println(xPixel + " " + yPixel); if(yPixel > 0 && (yPixel < pixelsHigh)) { System.out.println("y"); panel.paintYAxis(panel.getGraphics(), yPixel, pixelsWide, pixelsHigh); } if(xPixel > 0 && (xPixel < pixelsHigh)) { System.out.println("x"); panel.paintXAxis(panel.getGraphics(), xPixel, pixelsWide, pixelsHigh); } for(int i = 0; i>=0; i++) { Coordinate point1 = getPoint(i); Coordinate point2 = getPoint(i+1); if(point2 == null) { break; } else { if(point1.drawFrom() && point2.drawTo()) { int xPixel1 = (int) (xPixelStart + (point1.getX() - xyStart.getX()) * (pixelsWide / xRange)); int yPixel1 = (int) (yPixelStart + (xyStart.getY() + yRange-point1.getY()) * (pixelsHigh / yRange)); int xPixel2 = (int) (xPixelStart + (point2.getX() - xyStart.getX()) * (pixelsWide / xRange)); int yPixel2 = (int) (yPixelStart + (xyStart.getY() + yRange - point2.getY()) * (pixelsHigh / yRange)); panel.paintGraph(panel.getGraphics(), xPixel1, yPixel1, xPixel2, yPixel2); } } } frame.pack(); } } This is how i am testing it is supposed to be a square, but nothing shows up. public class GrapherTester extends XYGrapher { public Coordinate xyStart() { return new Coordinate(-2,2); } public double xRange() { return 4; } public double yRange() { return 4; } public Coordinate getPoint(int pointNum) { switch(pointNum) { case 0: return new Coordinate(-1,-1); case 1: return new Coordinate(1,-1); case 2: return new Coordinate(1,1); case 3: return new Coordinate(-1,1); case 4: return new Coordinate(-1,-1); } return null; } public static void main(String[] args) { new GrapherTester().drawGraph(100, 100, 500, 500); } } Coordinate class so if any of you want to run and try it out. That is all you would need. public class Coordinate { float x; float y; boolean drawTo; boolean drawFrom; Coordinate(double x, double y) { this.x = (float) x; this.y = (float) y; drawFrom = true; drawTo = true; } Coordinate(double x, double y, boolean drawFrom, boolean drawTo) { this.x = (float) x; this.y = (float) y; this.drawFrom = drawFrom; this.drawTo = drawTo; } public double getX() { return x; } public double getY() { return y; } public boolean drawTo() { return drawTo; } public boolean drawFrom() { return drawFrom; } }

    Read the article

  • Java: How to check the random letters from a-z, out of 10 letters minimum 2 letter should be a vowel

    - by kalandar
    I am writing a program to validate the following scenarios: Scenario 1: I am using the Random class from java.util. The random class will generate 10 letters from a-z and within 10 letter, minimum 2 letters must be a vowels. Scenario 2: When the player 1 and player 2 form a word from A-Z, he will score some points. There will be a score for each letter. I have already assigned the values for A-Z. At the end of the game, the system should display a scores for player 1 and player 2. How do i do it? Please help. I will post my code here. Thanks a lot. =========================================== import java.util.Random; import java.util.Scanner; public class FindYourWords { public static void main(String[] args) { Random rand = new Random(); Scanner userInput = new Scanner(System.in); //==================Player object=============================================== Player playerOne = new Player(); playerOne.wordScore = 0; playerOne.choice = "blah"; playerOne.turn = true; Player playerTwo = new Player(); playerTwo.wordScore = 0; playerTwo.choice = "blah"; playerTwo.turn = false; //================== Alphabet ================================================== String[] newChars = { "a", "b", "c", "d", "e", "f", "g", "h", "i", "j", "k", "l", "m", "n", "o", "p", "q", "r", "s", "t", "u", "v", "w", "x", "y", "z" }; //values of the 26 alphabets to be used int [] letterScore = {1,3,3,2,1,4,2,4,1,8,5,1,3,1,1,3,10,1,1,1,1,4,4,8,4,10}; // to assign score to the player1 and player 2 String[] vowel = { "a", "e", "i", "o", "u" }; // values for vowels int vow=0; System.out.println("FINDYOURWORDS\n"); int[] arrayRandom = new int[10]; //int array for word limiter String[] randomLetter = new String[10]; //storing the letters in newChars into this array //=============================================================================== boolean cont = true; while (cont) { if (playerOne.turn) { System.out.print("Letters of Player 1: "); } else if (!playerOne.turn) { System.out.print("Letters of Player 2: "); } for (int i = 0; i < arrayRandom.length; i++) { //running through the array limiter int r = rand.nextInt(newChars.length); //assigning random nums to the array of letters randomLetter[i] = newChars[r]; System.out.print(randomLetter[i]+ " "); } //input section for player System.out.println(""); System.out.println("Enter your word (or '@' to pass or '!' to quit): "); if (playerOne.turn) { playerOne.choice = userInput.next(); System.out.println(playerOne.turn); playerOne.turn = false; } else if (!playerOne.turn){ playerTwo.choice = userInput.next(); System.out.println(playerOne.turn); playerOne.turn = true; } //System.out.println(choice); String[] wordList = FileUtil.readDictFromFile("words.txt"); //Still dunno what this is for if (playerOne.choice.equals("@")) { playerOne.turn = false; } else if (playerTwo.choice.equals("@")) { playerOne.turn = true; } else if (playerOne.choice.equals("!")) { cont = false; } for (int i = 0; i < wordList.length; i++) { //System.out.println(wordList[i]); if (playerOne.choice.equalsIgnoreCase(wordList[i]) || playerTwo.choice.equalsIgnoreCase(wordList[i])){ } } } }}

    Read the article

  • Running a Java program with input from a file

    - by Katy
    I am writing a program that reads the input from a file and then prints it to the screen. When I run it without taking the input from the file, it works perfectly fine. However, every time I try to run it from the file it gives me an "Exception in thread "main" java.util.NoSuchElementException: No line found at" error that occurs every place the input is suppose to be read. I have no idea what is going on.

    Read the article

  • Creating ActionEvent object for CustomButton in Java

    - by Crystal
    For a hw assignment, we were supposed to create a custom button to get familiar with swing and responding to events. We were also to make this button an event source which confuses me. I have an ArrayList to keep track of listeners that would register to listen to my CustomButton. What I am getting confused on is how to notify the listeners. My teacher hinted at having a notify and overriding actionPerformed which I tried doing, but then I wasn't sure how to create an ActionEvent object looking at the constructor documentation. The source, id, string all confuses me. Any help would be appreciated. Thanks! code: import java.awt.*; import java.awt.event.*; import javax.swing.*; import java.util.List; import java.util.ArrayList; public class CustomButton { public static void main(String[] args) { EventQueue.invokeLater(new Runnable() { public void run() { CustomButtonFrame frame = new CustomButtonFrame(); frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); frame.setVisible(true); } }); } public void addActionListener(ActionListener al) { listenerList.add(al); } public void removeActionListener(ActionListener al) { listenerList.remove(al); } public void actionPerformed(ActionEvent e) { System.out.println("Button Clicked!"); } private void notifyListeners() { ActionEvent event = new ActionEvent(CONFUSED HERE!!!!; for (ActionListener action : listenerList) { action.actionPerfomed(event); } } List<ActionListener> listenerList = new ArrayList<ActionListener>(); } class CustomButtonFrame extends JFrame { // constructor for CustomButtonFrame public CustomButtonFrame() { setTitle("Custom Button"); CustomButtonSetup buttonSetup = new CustomButtonSetup(); this.add(buttonSetup); this.pack(); } } class CustomButtonSetup extends JComponent { public CustomButtonSetup() { ButtonAction buttonClicked = new ButtonAction(); this.addMouseListener(buttonClicked); } // because frame includes borders and insets, use this method public Dimension getPreferredSize() { return new Dimension(200, 200); } public void paintComponent(Graphics g) { Graphics2D g2 = (Graphics2D) g; // first triangle coords int x[] = new int[TRIANGLE_SIDES]; int y[] = new int[TRIANGLE_SIDES]; x[0] = 0; y[0] = 0; x[1] = 200; y[1] = 0; x[2] = 0; y[2] = 200; Polygon firstTriangle = new Polygon(x, y, TRIANGLE_SIDES); // second triangle coords x[0] = 0; y[0] = 200; x[1] = 200; y[1] = 200; x[2] = 200; y[2] = 0; Polygon secondTriangle = new Polygon(x, y, TRIANGLE_SIDES); g2.drawPolygon(firstTriangle); g2.setColor(firstColor); g2.fillPolygon(firstTriangle); g2.drawPolygon(secondTriangle); g2.setColor(secondColor); g2.fillPolygon(secondTriangle); // draw rectangle 10 pixels off border int s1[] = new int[RECT_SIDES]; int s2[] = new int[RECT_SIDES]; s1[0] = 5; s2[0] = 5; s1[1] = 195; s2[1] = 5; s1[2] = 195; s2[2] = 195; s1[3] = 5; s2[3] = 195; Polygon rectangle = new Polygon(s1, s2, RECT_SIDES); g2.drawPolygon(rectangle); g2.setColor(thirdColor); g2.fillPolygon(rectangle); } private class ButtonAction implements MouseListener { public void mousePressed(MouseEvent e) { System.out.println("Click!"); firstColor = Color.GRAY; secondColor = Color.WHITE; repaint(); } public void mouseReleased(MouseEvent e) { System.out.println("Released!"); firstColor = Color.WHITE; secondColor = Color.GRAY; repaint(); } public void mouseEntered(MouseEvent e) {} public void mouseExited(MouseEvent e) {} public void mouseClicked(MouseEvent e) {} } public static final int TRIANGLE_SIDES = 3; public static final int RECT_SIDES = 4; private Color firstColor = Color.WHITE; private Color secondColor = Color.DARK_GRAY; private Color thirdColor = Color.LIGHT_GRAY; }

    Read the article

  • toString() Method question

    - by cdominguez13
    I've been working on this assignemnt here's code: public class Student { private String fname; private String lname; private String studentId; private double gpa; public Student(String studentFname,String studentLname,String stuId,double studentGpa) { fname = studentFname; lname = studentLname; studentId = stuId; gpa = studentGpa; } public double getGpa() { return gpa; } public String getStudentId() { return studentId; } public String getName() { return lname + ", " + fname; } public void setGpa(double gpaReplacement) { if (gpaReplacement >= 0.0 && gpaReplacement <= 4.0) gpa = gpaReplacement; else System.out.println("Invalid GPA! Please try again."); System.exit(0); } } Now I need to create a toString() method that returns a String formatted something like this: Name: Wilson, Mary Ann ID number: 12345 GPA: 3.5

    Read the article

  • Need help with basic optimization problem

    - by ??iu
    I know little of optimization problems, so hopefully this will be didactic for me: rotors = [1, 2, 3, 4...] widgets = ['a', 'b', 'c', 'd' ...] assert len(rotors) == len(widgets) part_values = [ (1, 'a', 34), (1, 'b', 26), (1, 'c', 11), (1, 'd', 8), (2, 'a', 5), (2, 'b', 17), .... ] Given a fixed number of widgets and a fixed number of rotors, how can you get a series of widget-rotor pairs that maximizes the total value where each widget and rotor can only be used once?

    Read the article

  • Can someone help with big O notation?

    - by Dann
    void printScientificNotation(double value, int powerOfTen) { if (value >= 1.0 && value < 10.0) { System.out.println(value + " x 10^" + powerOfTen); } else if (value < 1.0) { printScientificNotation(value * 10, powerOfTen - 1); } else // value >= 10.0 { printScientificNotation(value / 10, powerOfTen + 1); } } I understand how the method goes but I cannot figure out a way to represent the method. For example, if value was 0.00000009 or 9e-8, the method will call on printScientificNotation(value * 10, powerOfTen - 1); eight times and System.out.println(value + " x 10^" + powerOfTen); once. So the it is called recursively by the exponent for e. But how do I represent this by big O notation? Thanks!

    Read the article

  • plane bombing problems- help

    - by peiska
    I'm training code problems, and on this one I am having problems to solve it, can you give me some tips how to solve it please. The problem is something like this: Your task is to find the sequence of points on the map that the bomber is expected to travel such that it hits all vital links. A link from A to B is vital when its absence isolates completely A from B. In other words, the only way to go from A to B (or vice versa) is via that link. Notice that if we destroy for example link (d,e), it becomes impossible to go from d to e,m,l or n in any way. A vital link can be hit at any point that lies in its segment (e.g. a hit close to d is as valid as a hit close to e). Of course, only one hit is enough to neutralize a vital link. Moreover, each bomb affects an exact circle of radius R, i.e., every segment that intersects that circle is considered hit. Due to enemy counter-attack, the plane may have to retreat at any moment, so the plane should follow, at each moment, to the closest vital link possible, even if in the end the total distance grows larger. Given all coordinates (the initial position of the plane and the nodes in the map) and the range R, you have to determine the sequence of positions in which the plane has to drop bombs. This sequence should start (takeoff) and finish (landing) at the initial position. Except for the start and finish, all the other positions have to fall exactly in a segment of the map (i.e. it should correspond to a point in a non-hit vital link segment). The coordinate system used will be UTM (Universal Transverse Mercator) northing and easting, which basically corresponds to a Euclidian perspective of the world (X=Easting; Y=Northing). Input Each input file will start with three floating point numbers indicating the X0 and Y0 coordinates of the airport and the range R. The second line contains an integer, N, indicating the number of nodes in the road network graph. Then, the next N (<10000) lines will each contain a pair of floating point numbers indicating the Xi and Yi coordinates (1 No two links will ever cross with each other. Output The program will print the sequence of coordinates (pairs of floating point numbers with exactly one decimal place), each one at a line, in the order that the plane should visit (starting and ending in the airport). Sample input 1 102.3 553.9 0.2 14 342.2 832.5 596.2 638.5 479.7 991.3 720.4 874.8 744.3 1284.1 1294.6 924.2 1467.5 659.6 1802.6 659.6 1686.2 860.7 1548.6 1111.2 1834.4 1054.8 564.4 1442.8 850.1 1460.5 1294.6 1485.1 17 1 2 1 3 2 4 3 4 4 5 4 6 6 7 7 8 8 9 8 10 9 10 10 11 6 11 5 12 5 13 12 13 13 14 Sample output 1 102.3 553.9 720.4 874.8 850.1 1460.5 102.3 553.9

    Read the article

  • Spinning a circle in J2ME using a Canvas.

    - by JohnQPublic
    Hello all! I have a problem where I need to make a multi-colored wheel spin using a Canvas in J2ME. What I need to do is have the user increase the speed of the spin or slow the spin of the wheel. I have it mostly worked out (I think) but can't think of a way for the wheel to spin without causing my cellphone to crash. Here is what I have so far, it's close but not exactly what I need. class MyCanvas extends Canvas{ //wedgeOne/Two/Three define where this particular section of circle begins to be drawn from int wedgeOne; int wedgeTwo; int wedgeThree; int spinSpeed; MyCanvas(){ wedgeOne = 0; wedgeTwo = 120; wedgeThree = 240; spinSpeed = 0; } //Using the paint method to public void paint(Graphics g){ //Redraw the circle with the current wedge series. g.setColor(255,0,0); g.fillArc(getWidth()/2, getHeight()/2, 100, 100, wedgeOne, 120); g.setColor(0,255,0); g.fillArc(getWidth()/2, getHeight()/2, 100, 100, wedgeTwo, 120); g.setColor(0,0,255); g.fillArc(getWidth()/2, getHeight()/2, 100, 100, wedgeThree, 120); } protected void keyPressed(int keyCode){ switch (keyCode){ //When the 6 button is pressed, the wheel spins forward 5 degrees. case KEY_NUM6: wedgeOne += 5; wedgeTwo += 5; wedgeThree += 5; repaint(); break; //When the 4 button is pressed, the wheel spins backwards 5 degrees. case KEY_NUM4: wedgeOne -= 5; wedgeTwo -= 5; wedgeThree -= 5; repaint(); } } I have tried using a redraw() method that adds the spinSpeed to each of the wedge values while(spinSpeed0) and calls the repaint() method after the addition, but it causes a crash and lockup (I assume due to an infinite loop). Does anyone have any tips or ideas how I could automate the spin so you do not have the press the button every time you want it to spin? (P.S - I have been lurking for a while, but this is my first post. If it's too general or asking for too much info (sorry if it is) and I either remove it or fix it. Thank you!)

    Read the article

  • Help with shopping cart in javascript

    - by user228390
    Hey guys, I'm having problems with my shopping cart. What I am trying to do is make a function that will add an item the cart and then and function that will view the cart and show the details. But what I have got so far does not do that, it just simply adds and goes straight to view cart. Also I wanted to store the name of each items in different global arrays (name, price and sum) but I can't get it work that way. Can any help me overcome this problem? Edit: I've tried to get it to work by adding some more items and attaching it to another html page, but now the code does not seem to work at all , before it showed the price and total and now I get nothing . javascript code function round_total (c) { var pennies = c * 100; pennies = Math.round(pennies); var strPennies = "" + pennies; var len = strPennies.length; return parseFloat(strPennies.substring(0, len - 2) + "." + strPennies.substring(len - 2, len)); } // End of round_total function. /* Start of generate_page function. */ function generate_page (form) { tax = 0.08; delivery_p = 2.99; var odate = new Date(); var qty = form.quantity.value; var product_v = new String(form.product.value); var total_price = product_v.substr(product_v.indexOf("$") + 1, product_v.length - product_v.indexOf("$")); var price_without_tax = round_total(qty * total_price); var ttax = round_total(price_without_tax * tax); var delivery = round_total(qty * delivery_p); var total_p = round_total(price_without_tax + ttax + delivery); document.writeln("Quantity: " + qty + "<br>"); document.writeln("Price: $" + total_price + "<br>"); document.writeln("Delivery: $" + delivery + "<br>"); document.writeln("Total: $" + total_p + "<br>"); document.writeln("Order placed on: " + odate.toGMTString()); } function calculate() { round_total (c)(); generate_page (form)(); } HTML code: Shopping cart Welcome, Guest Login Sign Up Stay Updated: Subscribe via RSS Email Updates <div id="header"> <div id="branding" class="container"> <h1>The Finest Toy<br /> Store Online</h1> <p class="desc">If you're looking for a toy shop then look no further.<br/> Go on, treat the kids with our huge selection of<br/>online toy shops selling toys for all ages.</p> </div><!-- end branding --> <div id="navigation"> <ul id="menu" class="container"> <li><a href="#">HOME</a></li> <li><a href="#">ABOUT</a></li> <li><a href="#">Online Store</a></li> <li><a href="#">CONTACT</a></li> </ul> </div><!-- end navigation --> </div><!-- end header --> Shopping Cart Nintendo DS Xbox Product: Console £149.99 Console + Games £169.99 Quantity: Product: Console £149.99 Console + Games £169.99 Quantity:     Playstation 3 Wii Product: Console £149.99 Console + Games £169.99 Quantity:   Product: Console £149.99 Console + Games £169.99 Quantity:        <input type="submit" value="Add to cart" name="submit" onClick="cart()";/><input , type="reset" value="Reset" name="reset" Copyright © 2010 shopping cart. Content and Header © |Back to top Do I need to show my CSS as well? (Sorry about the coding its not working properly for me, its not showing up the way it should be)

    Read the article

  • c++ tables of unions and structures

    - by newbDeveloper
    I was told to write a program, that creates a union and structure, then creates two-element arrays of unions and structures and fills their fields. I have created a union and a structure, but how to fill their fields in arrays ? #include <iostream> #include <stdlib.h> #include <stdio.h> using namespace std; union complex; union complex{ int i1; long double ld1; } u; struct Person { char* name; int age; bool sex; void show(){ printf("name %s, age %2.0d, sex %1d\n", name , age, sex); }; } person; int main(void) { Person *o = new Person[2]; complex *un = new complex[2]; un[0]->i1=i; system("pause"); return 0; } I've tried un[0]-i1=i; but it's not the proper way to do this.

    Read the article

  • A two player game over the intranet..

    - by Santwana
    Hi everybody.. I am a student of 3rd year engineering and only a novice in my programming skills. I need some help with my project.. I wish to develop a two player game to be played over the network (Intranet). I want to develop a simple website with a few html pages for this.My ideas for the project run as follows: 1.People can log in from different systems and check who ever is online on the network currently. the page also shows who is playing with whom. 2.If a person is interested in playing with a player who is currently online, he sends a request of which the other player is somehow notified( using a message or an alert on his profile page..) 3.If the player accepts the request, a game is started. This is exactly where I am clueless.. How can I make them play the game? I need to develop a turn based game with two players, eg chessboard.. how can I do this? The game has to be played live.. and it is time tracked. i need your help with coding the above.. the other features i wish to include are: 4.The game could not be abruptly terminated by any one if the users.The request to terminate the game should be sent to the other player first and only if he accepts can the game be terminated. Whoever wins the game would get a plus 10 on their credit and if he terminated he gets a minus 10. The credits remains constant even if he loses but the success percentage is reduced. 6.The player with highest winning percentage is projected as the player of the week on the home page and he can post a challenge to all others.. I only have an intermediate knowledge of core java and know the basics of Swing and Awt. I am not at all familiar with networking in java right now. I have 5 to 6 weeks of time for developing the project but I hope to learn the things before I start my project. i would prefer to use a lan to illustrate the project and I know only java,jsp,oracle,html and bit of xml to develop my proj. Also I wish to know if I can code this within 6 weeks, would it be too difficult or complicated? Please spare some time to tell me. Please.. please.. I need your suggestions and help.. thank you so much..

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 29 30 31 32 33 34 35 36 37 38 39 40  | Next Page >