Search Results

Search found 18035 results on 722 pages for 'location bar'.

Page 35/722 | < Previous Page | 31 32 33 34 35 36 37 38 39 40 41 42  | Next Page >

• Kickstart installation from USB -- Kickstart location

  - by dooffas

  After managing to get a Fedora ISO to rebuild successfully (for a USB stick) after adding a kickstart file (http://serverfault.com/questions/548405/), I now have an issue with locating the kickstart file on the USB media. When this is done from a CDROM you can simply kickckstart by adding this parameter to boot: linux ks=cdrom This will kickstart (providing the kickstart file is named ks.cfg and is in the root of the disk). Now, obviously this will be different for the USB drive, so from my research, I assumed that this line would do the job: linux ks=hd:sdb1:/ks.cfg Evidently this does not work. I get an error informing me this drive is already mounted and cannot be remounted. EDIT: Actual error message: mount: /dev/sdb1 is already mounted or /run/install/tmpmnt0 busy Warning: Can't get kickstart from /dev/sdb1:/ks.cfg To test that the syntax was correct I placed the kickstart file on another USB stick and loaded the same command to grab ks.cfg from the new location: linux ks=hd:sdc1:/ks.cfg This does work (providing USB sticks are mounted in order, boot - sdb1, kickstart - sdc1). The install will kickstart and complete the install with no issue. Obviously having to use 2 pen drives is somewhat frustrating and unreliable. Is there a way around this?

  Read the article

• samba4 dc "network location cannot be reached"

  - by mitchell babies peters

  to clear the air centos 6.4? (maybe 6.3) as the server, running samba 4.0.10, trying to add a windows 7 client that has connectivity to the server. this is what windows shouts as me as it mocks my dependence on network infrastructure. "the network location cannot be reached." i have access to the domain contoller (dc) im using the dc as the domain name server (dns) already, and the name is correctly resolving, and it is correctly forwarding outbound traffic. i have nothing but self taught experience with active directory(ad) so if i am missing something obvious, please shout it out, but keep the verbal abuse to a minimum. i checked samba4DC + my error and found nothing relevant to my issue, if i missed something please point me in that direction. the weekend is just starting as i write this so i probably wont be back on to check this post for a day or three, but i might because this mystery is killing me. i followed the samba4 as a dc guide here and i supplimented gaps with this i have tested kerberos, ntp, and set my DC as the clock to sync to in my windows client and it appears to be a very small fraction of a second off so that shouldn't be it. also, firewall and selinux are both off for testing. i have also tried disabling ipv6, and cleared the registry of ipv6 records (allegedly the default samba4 as a DC runs as windows server 2003 which allegedly does not support or tolerate the existence of ipv6, fair warning, i heard this on the internet so it is probably a lie) i have tried a few other things that i have forgotten because i have been doing this for a day and a half now. ideas welcome. suggestions for alternatives are also welcome, as long as they are free. i was given a budget of $0 dollars and told to implement active directory (no prior knowledge of active directory at that point).

  Read the article

• Moving Farm to co-location hosting - network settings requirements

  - by Saariko

  I am moving my farm (2 Dell's R620) to a co-location hosting service. I am trying to figure out the secure way to have my network settings The requirements are: VM1 is the working HOST, includes: esxi 5.1, vSphere, 4 clients (w2008r2 all) VM2 has esxi 5.1 installed, and a single machine with Veeam Backup and copy 6.5 - keeping a copy of VM1 clients on the VM2 internal storage (this solution is due to a very small budget - in case of failure on Host 1 - can redirect IP's) Only 2 VM clients require network address and access from the WWAN - ISP provides IP's range for them (with Gateway and DNS) I need connection to the iDrac's from my office (option to create a VPN-SSL tunnel) Connection to the vSphere appliances I want to be able to RDP to the VM clients The current configuration is that each host has the iDrac dedicated nic connected , and another (NIC #1) connected - with a static IP on 192.168.3.x The iDrac's have a static IP from the same network range (19.168.3.x) It will look something like this: My thoughts: On NIC#2 of both hosts I will connected a crossed cable I will give each VM clients that needs internet access a 2ndry VM network with the assigned IP from the ISP open only to web - can not access from the My Question: Should I give IP's (external) to the machines who DO NOT require WWAN Access? - I can't see a way to RDP to them directly if not. Should I use the crossed cable? or just plug NIC #2 to the switch? Will this setup even work? What do I need to verify? What Virtual nic's and/or switches should I create on the Hosts?

  Read the article

• Gray Progress Bar in Macbook Boot caused by Partition Fault

  - by Konstantin Bodnya

  Here's my problem: When I try to load my macbook it shows the gray progress bar. It takes a while to fill the whole progress and after it macbook just shuts down. I tried to boot from recovery partition and run Disk Utility to repair it. Disk Utility showed my "Macintosh HD" in a gray color and failed to repair it. I thought all my data was lost, but then I tried the following: So I booted into ubunto from live usb and it successfully mounted my macintosh hd hfs+ partition. Parted shows me the following partitions on my disk: Disk /dev/sda: 500GB Sector size (logical/physical): 512B/512B Partition Table: gpt Number Start End Size File system Name Flags 1 20.5kB 210MB 210MB fat32 EFI System Partition boot 2 210MB 499GB 499GB hfs+ Macintosh HD 3 499GB 500GB 650MB hfs+ Recovery HD Seems legit except for FAT32 for EFI System Partition. Since all my data is okay and backed up what should I do to recover the system. I don't really want to reinstall all the system though I believe there's a command to make it allright in linux. Thank you everyone!

  Read the article

• Subdomains and address bar

  - by Priednis

  I have a fairly noob question about how subdomains work. As I understand at first the DNS server specifies that a request for certain subdomain.domain.com has to go to the IP address of domain.com, and the webserver at domain.com further processes the request and displays the needed subdomain page. It is not entirely clear to me how (for example Apache) server does it. As I understand there can be entries in vhosts.conf file which specify folders that contain the subdomain data. Something like: <VirtualHost *> ServerName www.domain.com DocumentRoot /home/httpd/htdocs/ </VirtualHost> <VirtualHost *> ServerName subdomain.domain.com DocumentRoot /home/httpd/htdocs/subdomain/ </VirtualHost> and there also can be redirect entries in .htaccess files like rewritecond %{http_host} ^subdomain.domain.com [nc] rewriterule ^(.*)$ http://www.domain.com/subdomain/ [r=301,nc] however in this case the user gets directed to the directory which contains the subdomain data but the user gets "out" of the subdomain. I would like to know - how, when going to subdomain.domain.com the subdomain.domain.com, beginning of address remains visible in the address bar of the explorer? Can it be done by an alternate entry in .htaccess file? If a VirtualHost entry is specified in the vhosts.conf file, does it mean, that a new user account has to be specified for access to this directory?

  Read the article

• Volume licenced copy of MS Office 2007 shows "Non Commercial Use" in title bar

  - by Linker3000

  I have just removed the demo copy of Office 2007 preinstalled on a new laptop and replaced it with an install of the full professional edition downloaded from the MS Volume Licensing site and installed one of our volume licence keys, yet the apps (Word etc.) show "Non Commercial Use" in the title bar, which is what usually happens in the Home and Student edition. I have tried: Deleting the Office registration keys in the registry and using one of our other Office 2007 volume licence keys (we have 7) when prompted to re-register Uninstalling Office completely and reinstalling it from a newly-downloaded ISO burned to CD and also from a compressed file that installs from hard disk/USB stick (both from Microsoft - no dodgy stuff) Yet the non-commercial message persists. Although it's a cosmetic issue, the laptop is going to be used for customer presentations and so the sales person is rightly concerned about the image this portrays. I presume there may be something floating around the registry or in a file somewhere but I can't find it. Articles I have found elsewhere just refer to the message being related to the use of a Home and Student licence key, which is 100% not the case. Any thoughts? Thanks.

  Read the article

• SkyDrive broken after upgrade to Windows 8.1: "This location can't be found, please try later"

  - by avo

  Upgrading from Windows 8 to Windows 8.1 via the Store upgrade path has screwed my SkyDrive. The C:\Users\<user name>\SkyDrive folder is empty (it only has single file desktop.ini). When I open the native (Store) SkyDrive app, I see "This location can't be found, please try later". I'm glad to still have my files alive online in my SkyDrive account. I tried disconneting from / reconnecting to my Microsoft Account with no luck. Anyone has an idea on how to fix this without reinstalling/refreshing Windows 8.1? From Event Viewer: Faulting application name: skydrive.exe, version: 6.3.9600.16412, time stamp: 0x5243d370 Faulting module name: unknown, version: 0.0.0.0, time stamp: 0x00000000 Exception code: 0x00000000 Fault offset: 0x0000000000000000 Faulting process ID: 0x4e8 Faulting application start time: 0x01cece256589c7ee Faulting application path: C:\Windows\System32\skydrive.exe Faulting module path: unknown Report ID: {...} Faulting package full name: Faulting package-relative application ID: Also: The machine-default permission settings do not grant Local Activation permission for the COM Server application with CLSID {C2F03A33-21F5-47FA-B4BB-156362A2F239} and APPID {316CDED5-E4AE-4B15-9113-7055D84DCC97} to the user NT AUTHORITY\LOCAL SERVICE SID (S-1-5-19) from address LocalHost (Using LRPC) running in the application container Unavailable SID (Unavailable). This security permission can be modified using the Component Services administrative tool. Never was a big fan of in-place upgrade anyway, but this time it was a machine which I use for work, with a lot of stuff already installed on it. Shouldn't have tried to upgrade it in the first place, but was convinced Windows 8.1 is a solid update. Another lesson learnt.

  Read the article

• Default /server-status location not inheriting in Apache

  - by rmalayter

  I'm having a problem getting /server-status to work Apache 2.2.14 on Ubuntu Server 10.04.1. The default symlinks for status.load and status.conf are present in /etc/apache2/mods-enabled. The status.conf does include the location /server-status and appropriate allow/deny directives. However, the only vhost I have in sites-enabled looks like this. The idea is to proxy anything with a Tomcat URL to a cluster of tomcats, and anything else to an IIS box. However, this seems to result in requests to /server-status being sent to IIS. Copying the /server-status in explicitly to the Vhost configuration doesn't seem to help, no matter what order I use. Is it possible to include /server-status do this within a vhost configuration that has a "default" proxy rule?: <VirtualHost *:80> ServerAdmin webmaster@localhost DocumentRoot /var/www Header add Set-Cookie "ROUTEID=.%{BALANCER_WORKER_ROUTE}e; path=/" env=BALANCER_ROUTE_CHANGED <Proxy balancer://tomcatCluster> BalancerMember ajp://qa-app1:8009 route=1 BalancerMember ajp://qa-app2:8009 route=2 ProxySet stickysession=ROUTEID </Proxy> <ProxyMatch "^/(mytomcatappA|mytomcatappB)/(.*)" > ProxyPassMatch balancer://tomcatCluster/$1/$2 </ProxyMatch> #proxy anything that's not a tomcat URL to IIS on port 80 <Proxy /> ProxyPass http://qa-web1/ </Proxy>

  Read the article

• Skyrim: Heavy Performance Issues after a couple of location changes

  - by Derija

  Okay, I've tried different solutions: ENB Series, removing certain mods, checking my FPS Rate, monitoring my resources, .ini tweaks. It's all just fine, I don't see what I'm missing. A couple of days ago, I bought Skyrim. Before I bought the game, I admit I had a pirated copy because my girlfriend actually wanted to buy me the game as a present, then said she didn't have enough money. Sick of waiting, I decided to buy the game by myself. The ridiculous part is, it worked better cracked than it does now uncracked. As the title suggests, after entering and leaving houses a couple of times, my performance obviously drops extremely. My build is just fine, Intel i5 quad core processor, NVIDIA GTX 560 Ti from Gigabyte, actually stock-OC, but manually downclocked to usual settings using appropriate Gigabyte software. This fixed the CTD issues I had before with both Skyrim and BF3. I have 4GB RAM. A website about Game Tweaks suggested that my HDD may be too slow. A screenshot of a Windows Performance Index sample with the subscription "This is likely to cause issues" showed the HDD with a performance index of 5.9, the exact same mine has, so I was playing with the thought to purchase an SSD instead, load games onto it that really need it like Skyrim, and hope it'd do the trick. Unfortunately, SSDs are likewise expensive, compared to "normal" HDDs... I'm really getting desperate about it. My save is gone because the patches made it impossible to load saves of the unpatched version and I already saved more than 80 times despite being only level 8, just because every time I interact with a door leading me to another location I'm scared the game will drop again. I can't even play for 30 mins straight anymore, it's just no fun at all. I've researched for a couple of days before I decided to post my question here. Any help is appreciated, I don't want to regret having bought the game... Since it actually is the best game I've played possibly for ever. Sincerely. P.S.: I don't think it's necessary to say, but still, of course I'm playing on PC. P.P.S.: After monitoring both my PC resources including CPU usage and HDD usage as well as the GPU usage, I don't see any changes even after the said event. P.P.P.S.: Original question posted here where I've been advised to ask here.

  Read the article

• filtering itunes library items by file location

  - by Cawas

  3 answers and unfortunately no solution yet. The Problem I've got way more than 1000 duplicated items in my iTunes Library pointing to a non-existant place (the "where" under "get info" window), along with other duplicated items and other MIAs (Missing In Action). Is there any simple way to just delete all of them and only them? From the library, of course. By that I mean some MIAs are pointing to /Volumes while some are pointing to .../music/Music/... or just .../music/.... I want to delete all pointing to /Volumes as to later I'll recover the rest. Check the image below. Some Background I tried searching for a specific key word on the path and creating smart play list, but with no result. Being able to just sort all library by path would be a perfect solution! I believe old iTunes could do that. PowerTunes can do it (sort by path) but I can't do anything with its list. I would also welcome any program able to handle this, then import and properly export back the iTunes library. Since this seems to just not be clear enough... AppleScript doesn't work That's because AppleScript just can't gather the missing info anywhere in iTunes Library. Maybe we could use AppleScript by opening the XML file, but that's a whole nother issue. Here's a quote from my conversation with Doug the man himself Adams last december: I don't think you do understand. There is no way to get the path to the file of a dead track because iTunes has "forgotten" it. That is, by definition, what a dead track is. Doug On Dec 21, 2010, at 7:08 AM, Caue Rego wrote: yes I understand that and have seem the script. but I'm not looking for the file. just the old broken path reference to it. Sent from my iPhone On 21/12/2010, at 10:00, Doug Adams wrote: You cannot locate missing files of dead tracks because, by definition, a dead track is one that doesn't have any file information. If you look at "Super Remove Dead Tracks", you will notice it looks for tracks that have "missing value" for the location property.

  Read the article

• How load WebView with another URL when navigated through tab bar viewController

  - by TechFusion

  Hello, I have created window based application, root controller as Tab bar controller. WebView is being loaded in Tab bar interfaced ViewController's View.WebView is created using IB.WebView object declared in ViewController as per below. //ViewController.h @interface ViewController:UIViewController{ IBOutlet UIWebview *Webview; } @property(nonatomic,retain)IBOutlet UIWebview *Webview; @end I am calling [WebView loadrequest] method in -viewDidLoad method and stopLoading will be called in -viewWillDisappear method. I am again reload it in -viewWillAppear:animated method to load it again when tab bar is pressed. //ViewController.m @implementation viewcontroller @synthesize Webview; -(void)viewDidLoad{ [super viewDidLoad]; [self.Webview loadRequest:[NSURLRequest requestWithURL:[NSURL URLWithString:@"www.apple.com"]]]; } -(void)viewWillAppear:(BOOL)animated{ [super viewWillAppear:animated]; [self.Webview reload]; } -(void)viewWillDisappear:(BOOL)animated{ [super viewWillDisappear:animated]; [self.Webview stopLoading]; } I am releasing WebView in -ViewDidUnload method -(void)viewDidUnload{ [super viewDidUnload]; [Webview release]; } -(void)dealloc{ [Webview release]; [super dealloc]; } Does Webview released correctly ? Here how to kill connection with URL when ViewWillDisappear method called ? How to load View with Different URL then it's loaded in -viewDidLoad method when ViewController interfaced tab is pressed ? Means if naviagated from one tab to another that ViewController interface tab which has WebView should load request with another URL. Does it correct to call [self.Webview loadRequest:[NSURLRequest requestWithURL:[NSURL URLWithString:@"www.stackoverflow.com"]]]; this method again in -viewWillAppear:animated method to load with another URL ? Thanks,

  Read the article

• .htaccess - RewriteRules working, but browser address bar displaying full (unfriendly) URL

  - by axol

  Hey there, Haven't been able to find a solution to this around the net or these forums - apologise if I've missed something! My .htaccess RewriteRules are working well - have search-engine and user -friendly links in my web pages, and unfriendly database URLs running hidden in the background. Except when I added a RewriteRule to add "www." to the front of URLs if the user didn't enter it - to ensure only one appears in search engines. Here's what now happening, and I can't figure out why! My friendly URL structure for content is like this, and the database query string uses the first "importantword": www.example.com/importantword-nonimportantword/ .htaccess snippet: Options +FollowSymLinks Options -Indexes RewriteEngine on RewriteOptions MaxRedirects=10 RewriteBase / RewriteRule ^/$ index.php [L] RewriteRule ^(.*)-(.*)/overview/$ detail.php?categoryID=$1 [L] RewriteCond %{HTTP_HOST} !^www.example.com$ RewriteRule ^(.*)$ http://www.example.com/$1 [L] What's happening since I added the last 2 lines: CASE 1: user types (or clicks) www.example.com/honda-vehicle/overview/ - Works correctly - They are taken to the correct page and the browser URL bar says: www.example.com/honda-vehicles/overview/ CASE 2: user types example.com - Works correctly - They are taken to www.example.com and the browser URL bar says: www.example.com CASE 3: user types (or clicks) example.com/honda-vehicles/overview/ i.e. without the prefix "www" - Does NOT work correctly - They are taken to the right page, but the browser URL bar displays the unfriendly URL: www.example.com/detail.php?categoryID=honda I figure there's some issue with the order of the RewriteRules, but it's doing my head in trying to logically step through it and figure it out! Any assistance at all or pointers would be most appreciated!

  Read the article

• Update the Progress bar using winforms c#

  - by karthik

  There is a functionality in my module, where the user can scan the number of serial ports in the system and when the user clicks "Auto scan" button, the code will have to go through each serial port and send a test message and wait for the reply. I am using Progress bar control to show process of autoscan. For which i need to pass the value to "x" and "Y" in my code to update the bar. How can i pass the value since my code is already in a foreach loop for getting the serialports. Y = should pass the value of total number of serial ports X = should iterate through each port and pass the value Hope i am clear with req. private void backgroundWorker1_DoWork(object sender, DoWorkEventArgs e) { string strAckData = ""; foreach (SerialPort sp in comPortsList) { sp.Open(); string sendData = "Auto scan"; sp.Write(sendData); strAckData += "Connection live on port " + sp.ReadExisting() + "\n"; sp.Close(); double dIndex = (double)x; **//How to pass the value here ?** double dTotal = (double)y; **//How to pass the value here ?** double dProgressPercentage = (dIndex / dTotal); int iProgressPercentage = (int)(dProgressPercentage * 100); // update the progress bar backgroundWorker1.ReportProgress(iProgressPercentage); } richTextBox1.Invoke(new MethodInvoker(delegate { richTextBox1.Text = strAckData; })); } private void backgroundWorker1_ProgressChanged(object sender, ProgressChangedEventArgs e) { ProgressBar.Value = e.ProgressPercentage; } private void backgroundWorker1_RunWorkerCompleted(object sender, RunWorkerCompletedEventArgs e) { StatusLabel.Text = "Auto Scan completed"; }

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• Android Custom Adapter with Bar Progress

  - by xger86x

  Hi, i have a custom adapter for an arraylist. <?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:layout_width="wrap_content" android:layout_height="wrap_content" android:orientation="horizontal"> <ProgressBar android:id="@+id/downloadprogress" style="?android:attr/progressBarStyleHorizontal" android:layout_width="200dip" android:layout_height="wrap_content" android:max="100" android:progress="50" android:secondaryProgress="75" /> <TextView android:id="@+id/tripsname" android:layout_width="wrap_content" android:layout_height="wrap_content"/> </LinearLayout> but when i try to access to the progress bar in the adapter private class MyAdapter extends ArrayAdapter<Trip> { int resource; public MyAdapter(Context context, int resource, ArrayList<Trip> items) { super(context, resource,items); this.resource=resource; } @Override public View getView(int position, View convertView, ViewGroup parent) { LinearLayout tripListItemView; final Trip t = getItem(position); String name = t.getName(); boolean offline = t.isOffline() ; if(convertView==null) { tripListItemView = new LinearLayout(getContext()); String inflater = Context.LAYOUT_INFLATER_SERVICE; LayoutInflater vi; vi = (LayoutInflater)getContext().getSystemService(inflater); vi.inflate(resource, tripListItemView, true); } else { tripListItemView = (LinearLayout) convertView; } setProgressBarVisibility(true); View v = findViewById(R.id.downloadprogress); ProgressBar progressHorizontal = (ProgressBar) findViewById(R.id.downloadprogress); it always return null, like it doesn't find the progress bar. However, the progress bar is shown in the list, but i need to access to it inside the adapter. Anybody knows the solution? Thanks

  Read the article

• Different location of assemblies stoped the type casting.

  - by smwikipedia

  I am writing a custom Control class in C# for my main project. There're 2 projects, one for my Control and one for my main project. These 2 projects are in the same solution. I add a reference from my main project to my Control project. I notice that the first time after I drag my Control from the Tool Panel onto my main winform, an assembly folder was generated at the C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and the folder name is something like "jlebh-py01". The first build is always OK, but after I rebuild my Control class or whole solution, a new assembly folder will be generated at C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and then problem arises, my Control fails to behave well because Visual Studio says that the two types "originates from different location". The error message is as below: [A]MyControl.TypeXXX cannot be cast to [B]MyControl.TypeXXX. Type A orginates from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\jlebh-py01\MyControl.dll' Type B originats from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\ue4i-z3j01\MyControl.dll' If I reference the Control DLL directly instead of through project reference, or never rebuild the Control project after use my Control in the main project, things seem to be OK. Does anyone knows why? Is it the proper way to develop a control and a main project within the same solution? Many thanks...

  Read the article

• Flex 3 - Scroll bar issue

  - by Emma

  Im currently learning Flex, and Im having the hardest time getting scroll bars to work. In short Im pretty much just making a giant form for users to fill out, contained within a viewstack component, the user will type up information in one view, and it will be displayed in the other. But right now in the first canvas i have components that run of the screen and flex doesnt seem to automate a scroll bar, so i added in 'verticalScrollPolicy="on"' to my canvas, now while it gives me a scroll bar, it gives me an empty scroll bar, I still cannot move it up or down, meaning components are still trapped off the bottom of my screen. Im I missing something amazingly simple? Edit - Sorry, Im using Adobe Flex Builder 3, and the components it lets you drag in. http://img12.imageshack.us/img12/218/problem1f.jpg This is a picture of the problem, and i guess relavent code would be. <mx:Application xmlns:mx="adobe.com/2006/mxml"; layout="absolute" width="830" height="835"> <mx:ViewStack x="10" y="72" id="viewstack1" width="790" height="751" > <mx:Canvas label="Design Mode" width="100%" height="100%" verticalScrollPolicy="on" horizontalScrollPolicy="on" > (Components inside) </mx:Canvas> Sorry if Im using this site wrong, still very new

  Read the article

• longitude and latitude for current location returned from CLLocationManager in UK region is not corr

  - by bond

  Hi I am getting latitude and longitude of current location from CLLocationManager delegate method. It works fine for some region but its giving problem in UK region. When it is used in UK region, the current location longitude and latitude returned from CLLocationManager is not proper. Thanks heres a part of the logic i am using. -(void)viewWillAppear:(BOOL)animated { [super viewWillAppear:animated]; self.locationManager = [[CLLocationManager alloc] init]; if(self.locationManager.locationServicesEnabled) { self.locationManager.delegate = self; self.locationManager.distanceFilter = kCLDistanceFilterNone; self.locationManager.desiredAccuracy = kCLLocationAccuracyBest; } } -(void)locationManager:(CLLocationManager *)manager didUpdateToLocation:(CLLocation *)newLocation fromLocation:(CLLocation *)oldLocation { NSLog(@"Updating"); //if the time interval returned from core location is more than 15 seconds //we ignore it because it might be from an old session if ( abs([newLocation.timestamp timeIntervalSinceDate: [NSDate date]]) < 15) { self.latitude = newLocation.coordinate.latitude; self.longitude = newLocation.coordinate.longitude; NSLog(@"longitude=%f-- latitude=%f--",self.longitude,self.latitude); [self.locationManager stopUpdatingLocation]; [self removeActivityIndicator]; [[self locationSaved] setHidden:NO]; [[self viewLocationInMap] setEnabled:YES]; }}

  Read the article

• when updating location.hash in Chrome the jQuery animation "freezes" for a second

  - by ubunut

  I'm trying to create a sort of "virtual gallery". I'm using Coda Slider 2.0 & jQuery v1.4.2 It behaves perfectly in IE, FF & Safari, but Chrome seems to reload/hang for a second when setting location.hash. This causes the jQuery animation to freeze for a second :S Example: http://hardyernst.dk/gallery.html try clicking on the navigation links above the pictures. The jQuery code that is being executed when clicking a navigation link: $('#coda-nav-' + sliderCount + ' a').each(function(z) { // What happens when a nav link is clicked $(this).bind("click", function() { offset = -(panelWidth*z); navClicks++; $(this).addClass('current').parents('ul').find('a').not($(this)).removeClass('current'); alterPanelHeight(z); currentPanel = z + 1; $('.panel-container', slider).stop().animate({ left: offset }, settings.slideEaseDuration, settings.slideEaseFunction, function(){ if (!settings.crossLinking) { return false; } // Don't change the URL hash unless cross-linking is specified }); }); }); if I add return false; at the end of the function. The animation will slide smoothly :)... BUT as you might have guessed the location.hash value remains unchanged :( I have tried setting the location.hash earlier in the function alas it did not change the behavior in Chrome Would be immensely grateful for any help :) Regards Ubunut

  Read the article

• How to download .exe file with progress bar - VB 2012

  - by user2839828

  I am trying to create an updater for my program which automatically download's the latest version of my program from the web. Now I want this process to be done using a progress bar (so when the download progress is at 50% the progress bar is half-way through). This is my code: Private Sub client_ProgressChanged(ByVal sender As Object, ByVal e As DownloadProgressChangedEventArgs) Dim bytesIn As Double = Double.Parse(e.BytesReceived.ToString()) Dim totalBytes As Double = Double.Parse(e.TotalBytesToReceive.ToString()) Dim percentage As Double = bytesIn / totalBytes * 100 client.Value = Int32.Parse(Math.Truncate(percentage).ToString()) End Sub Private Sub Button1_Click(sender As Object, e As EventArgs) Handles Button1.Click Dim url As String = "MY DOWNLOAD LINK" 'Download Dim client As WebClient = New WebClient AddHandler client.DownloadProgressChanged, AddressOf client_ProgressChanged AddHandler client.DownloadFileCompleted, AddressOf client_DownloadCompleted client.DownloadFileAsync(New Uri(url), "C:\Users\User\Desktop\BACKUP\TESTING\New folder\1.exe") End Sub End Class Now I know that the place where the file is saved has been inputed manually by me , but I will change that later. My problem currently is that the file is not being downloaded. However when I change the DownloadFileAsync method to DownloadFile , my program downloads the file. However with the DownloadFile method I will not be able to use the progress bar to track the download progress. Any help is much appreciated :-)

  Read the article

• JQuery Progress Bar Inline Text

  - by Craig

  Hello, I am trying to use the basic progress bar however I am unable to figure out the css/command to actually put some text inside the bar. I am using this progress bar: http://docs.jquery.com/UI/Progressbar however I am open to other ones if they are just as simple to implement. I want it to display in the left corner some static information and then a percentage of complete somewhere in the right section. All css I attempted to do just made the information display below or to the side of. As well I am unsure how to actually have this CSS change based on a JQuery method (new to JQuery). below is my actual JQuery. Don't try to understand the url value just assume it returns 0-100. <script type="text/javascript"> var url = "%%$protocol_url%%/bin/task_status?id=%%$tid%%&cmd=percent_done"; $(function() { var progress = 0; //alert("some value" + value, value); $("#progressbar").progressbar({ progress: 0 }); setTimeout(updateProgress, 500); }); function updateProgress() { var progress; $.get(url, function(data) { // data contains whatever that page returns if (data < 100) { $("#progressbar") .progressbar("option", "value", data); setTimeout(updateProgress, 500); } else { $("#progressbar") .progressbar("option", "value", 100); } }); } Thanks

  Read the article

• iPhone xcode - Activity Indicator with tab bar controller and multi table view controllers

  - by Frames84

  I've looked for a tutorial and can't seem to find one for a activity indicator in a table view nav bar. in my mainWindow.xib I have a Tab Bar Controller with 4 Tabs controllers each containing a table view. each load JSON feeds using the framework hosted at Google. In one of my View Controller I can add an activity indicator to the nav bar by using: UIActivityIndicatorView *activityIndcator = [[UIActivityIndicatorView alloc] initWithFrame:CGRectMake(0,0,20,20)]; [activityIndcator startAnimating]; UIBarButtonItem *activityItem = [[UIBarButtonItem alloc] initWithCustomView:activityIndcator]; self.navigationItem.rightBarButtonItem = activityItem; however and can turn it off by using: self.navigationItem.rightBarButtonItem.enabled = FALSE; But if i place this in my viewDidLoad event it shows all the time. I only want it to show when I select a row in my table view. so I added it at the top of didSelectRowAtIndexPath and the stop line after I load a feed. it shows but takes a second or two and only shows for about half a second. is the an event that firers before the didSelectRowAtIndexPath event a type of loading event? if not what is the standard menthord for implementing such functionality?

  Read the article

• DataGridView: Scroll bar does not refreshed

  - by David.Chu.ca

  I am working (fixing bugs) on a project which was written in VS 2005. There is one DataGridView control on a form. When it is first time loaded, the control's data grid is populated with rows of data from a collection manually or in codes. Actually, there is method PopulateDataGrid() do the job. There is also another control on the form. When control is changed, the data grid will be cleared first and then rows are repopulated again through PopulateDataGrid(). The problem is that when the grid is refreshed, the vertical scroll bar does not get reset correctly. I thought it should be. Since the scroll bar is not reset, when I tried to click on grid and move down, I got exception: the max value of scroll bar was exceeded. All the settings for grid control are default values. For example, the ScrollBars is Both. The following is the only related place to set row auto size property: poDataGridView.AutoSizeRowsMode = DataGridViewAutoSizeRowsMode.DisplayedCellsExceptHeaders; I am not sure if there is any property I have to set in designer?

  Read the article

• Where to prompt for required file location at start of Win Forms application

  - by Murph

  I have an application that uses a file to store its data. I store the location of the file in the app settings so have two tests at startup: Do I have a setting for the file and Does the file (if I have a setting) exist If I fail either test I want to prompt the user for the file location - the mechanics of the are not the problem, I can read and write the app settings, fire off dialogs and otherwise request the data. If the user refuses to choose a file (or at least a file location) I want to exit the app. My problem is where to do this i.e. at what point in the flow of code. In an ideal world you start the app, show a splash screen, load the main form and run from there... I'm looking for a general pattern that allows me to slot the test for parameters into the right place so that I can prompt the user for whatever (and allowing that I have to worry about the fact that my splash screen is currently topmost for my app). I appreciate that this is a bit vague so will update this with code as we go along.

  Read the article

• Leftover Nav Bar in Landscape View

  - by Rob Bonner

  Hello, I am working to force a view into landscape mode, and have picked up all kinds of cool tips to make this happen, but am stuck on one item that is left on the screen. I have my XIB file laid out in landscape, and in my code I create the view controller normally: RedeemViewController *aViewController = [[RedeemViewController alloc] initWithNibName:@"RedeemViewController" bundle:nil]; aViewController.hidesBottomBarWhenPushed = YES; aViewController.wantsFullScreenLayout = YES; [[self navigationController] pushViewController:aViewController animated:YES]; Inside the controller viewDidLoad I complete the following: [[UIApplication sharedApplication] setStatusBarOrientation:UIInterfaceOrientationLandscapeRight]; [[self navigationController] setNavigationBarHidden:YES animated:YES]; [UIView beginAnimations:@"View Flip" context:nil]; [UIView setAnimationDuration:.75]; [UIView setAnimationCurve:UIViewAnimationCurveEaseInOut]; if (self.interfaceOrientation == UIInterfaceOrientationPortrait) { self.view.transform = CGAffineTransformIdentity; self.view.transform = CGAffineTransformMakeRotation(degreesToRadian(90)); self.view.bounds = CGRectMake(0.0, 0.0, 480, 320); } [UIView commitAnimations]; What I end up with is a perfectly rotated view, with a grey vertical bar on the left side (see pic). So to the question, how do I get rid of the bar? Edit: I am pretty sure this is the navigation bar that is not being hidden. This is a duplicate of another post, with some modified code, the other question was being answered with the bug.

  Read the article

< Previous Page | 31 32 33 34 35 36 37 38 39 40 41 42  | Next Page >