Search Results

Search found 13534 results on 542 pages for 'python 2 6'.

Page 365/542 | < Previous Page | 361 362 363 364 365 366 367 368 369 370 371 372  | Next Page >

  • I am trying to move a rectangle in Pygame using coordinates but won't work

    - by user1821449
    this is my code import pygame from pygame.locals import * import sys pygame.init() pygame.display.set_caption("*no current mission*") size = (1280, 750) screen = pygame.display.set_mode(size) clock = pygame.time.Clock() bg = pygame.image.load("bg1.png") guy = pygame.image.load("hero_stand.png") rect = guy.get_rect() x = 10 y = 10 while True: for event in pygame.event.get(): if event.type == pygame.QUIT: sys.exit() if event.type == KEYDOWN: _if event.key == K_RIGHT: x += 5 rect.move(x,y)_ rect.move(x,y) screen.blit(bg,(0,0)) screen.blit(guy, rect) pygame.display.flip() it is just a simple test to see if i can get a rectangle to move. Everything seems to work except the code I put in italic.

    Read the article

  • How do I use Django to insert a Geometry Field into the database?

    - by alex
    class LocationLog(models.Model): user = models.ForeignKey(User) utm = models.GeometryField(spatial_index=True) This is my database model. I would like to insert a row. I want to insert a circle at point -55, 333. With a radius of 10. How can I put this circle into the geometry field? Of course, then I would want to check which circles overlap a given circle. (my select statement)

    Read the article

  • Not able to pass multiple override parameters using nose-testconfig 0.6 plugin in nosetests

    - by Jaikit
    Hi, I am able to override multiple config parameters using nose-testconfig plugin only if i pass the overriding parameters on commandline. e.g. nosetests -c nose.cfg -s --tc=jack.env1:asl --tc=server2.env2:abc But when I define the same thing inside nose.cfg, than only the value for last parameter is modified. e.g. tc = server2.env2:abc tc = jack.env1:asl I checked the plugin code. It looks fine to me. I am pasting the part of plugin code below: parser.add_option( "--tc", action="append", dest="overrides", default = [], help="Option:Value specific overrides.") configure: if options.overrides: self.overrides = [] overrides = tolist(options.overrides) for override in overrides: keys, val = override.split(":") if options.exact: config[keys] = val else: ns = ''.join(['["%s"]' % i for i in keys.split(".") ]) # BUG: Breaks if the config value you're overriding is not # defined in the configuration file already. TBD exec('config%s = "%s"' % (ns, val)) Let me know if any one has any clue.

    Read the article

  • How to set the size of a wx.aui.AuiManager Pane that is centered?

    - by aF
    Hello, I have three panes with the InfoPane center option. I want to know how to set their size. Using this code: import wx import wx.aui class MyFrame(wx.Frame): def __init__(self, parent, id=-1, title='wx.aui Test', pos=wx.DefaultPosition, size=(800, 600), style=wx.DEFAULT_FRAME_STYLE): wx.Frame.__init__(self, parent, id, title, pos, size, style) self._mgr = wx.aui.AuiManager(self) # create several text controls text1 = wx.TextCtrl(self, -1, 'Pane 1 - sample text', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) text2 = wx.TextCtrl(self, -1, 'Pane 2 - sample text', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) text3 = wx.TextCtrl(self, -1, 'Main content window', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) # add the panes to the manager self._mgr.AddPane(text1, wx.CENTER) self._mgr.AddPane(text2, wx.CENTER) self._mgr.AddPane(text3, wx.CENTER) # tell the manager to 'commit' all the changes just made self._mgr.Update() self.Bind(wx.EVT_CLOSE, self.OnClose) def OnClose(self, event): # deinitialize the frame manager self._mgr.UnInit() # delete the frame self.Destroy() app = wx.App() frame = MyFrame(None) frame.Show() app.MainLoop() I want to know what is called when we change the size of the panes. If you tell me that, I can do the rest by myself :)

    Read the article

  • method __getattr__ is not inherited from parent class

    - by ??????
    Trying to subclass mechanize.Browser class: from mechanize import Browser class LLManager(Browser, object): IS_AUTHORIZED = False def __init__(self, login = "", passw = "", *args, **kwargs): super(LLManager, self).__init__(*args, **kwargs) self.set_handle_robots(False) But when I make something like this: lm["Widget[LinksList]_link_1_title"] = anc then I get an error: Traceback (most recent call last): File "<pyshell#8>", line 1, in <module> lm["Widget[LinksList]_link_1_title"] = anc TypeError: 'LLManager' object does not support item assignment Browser class have overridden method __getattr__ as shown: def __getattr__(self, name): # pass through _form.HTMLForm methods and attributes form = self.__dict__.get("form") if form is None: raise AttributeError( "%s instance has no attribute %s (perhaps you forgot to " ".select_form()?)" % (self.__class__, name)) return getattr(form, name) Why my class or instance don't get this method as in parent class?

    Read the article

  • How to replace empty string with zero in comma-separated string?

    - by dsaccount1
    "8,5,,1,4,7,,,,7,,1,9,3,6,,,8,6,3,9,,2,5,4,,,,,3,2,,,7,4,1,1,,4,,6,9,,5,,,,5,,,1,,6,3,,,6,5,,,,7,4,,1,7,6,,,,8,,5,,,7,1,,3,9," I'm doing a programming challenge where i need to parse this sequence into my sudoku script. Need to get the above sequence into 8,5,0,1,4,7,0,0,0,7,0,1,9,3,6,0,0,8......... I tried re but without success, help is appreciated, thanks.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • SelfReferenceProperty vs. ListProperty Google App Engine

    - by John
    Hi All, I am experimenting with the Google App Engine and have a question. For the sake of simplicity, let's say my app is modeling a computer network (a fairly large corporate network with 10,000 nodes). I am trying to model my Node class as follows: class Node(db.Model): name = db.StringProperty() neighbors = db.SelfReferenceProperty() Let's suppose, for a minute, that I cannot use a ListProperty(). Based on my experiments to date, I can assign only a single entity to 'neighbors' - and I cannot use the "virtual" collection (node_set) to access the list of Node neighbors. So... my questions are: Does SelfReferenceProperty limit you to a single entity that you can reference? If I instead use a ListProperty, I believe I am limited to 5,000 keys, which I need to exceed. Thoughts? Thanks, John

    Read the article

  • Google App Engine with local Django 1.1 gets Intermittent Failures

    - by Jon Watte
    I'm using the Windows Launcher development environment for Google App Engine. I have downloaded Django 1.1.2 source, and un-tarrred the "django" subdirectory to live within my application directory (a peer of app.yaml) At the top of each .py source file, I do this: import settings import os os.environ["DJANGO_SETTINGS_MODULE"] = 'settings' In my file settings.py (which lives at the root of the app directory, as well), I do this: DEBUG = True TEMPLATE_DIRS = ('html') INSTALLED_APPS = ('filters') import os os.environ["DJANGO_SETTINGS_MODULE"] = 'settings' from google.appengine.dist import use_library use_library('django', '1.1') from django.template import loader Yes, this looks a bit like overkill, doesn't it? I only use django.template. I don't explicitly use any other part of django. However, intermittently I get one of two errors: 1) Django complains that DJANGO_SETTINGS_MODULE is not defined. 2) Django complains that common.html (a template I'm extending in other templates) doesn't exist. 95% of the time, these errors are not encountered, and they randomly just start happening. Once in that state, the local server seems "wedged" and re-booting it generally fixes it. What's causing this to happen, and what can I do about it? How can I even debug it? Here is the traceback from the error: Traceback (most recent call last): File "C:\code\kwbudget\edit_budget.py", line 34, in get self.response.out.write(t.render(template.Context(values))) File "C:\code\kwbudget\django\template\__init__.py", line 165, in render return self.nodelist.render(context) File "C:\code\kwbudget\django\template\__init__.py", line 784, in render bits.append(self.render_node(node, context)) File "C:\code\kwbudget\django\template\__init__.py", line 797, in render_node return node.render(context) File "C:\code\kwbudget\django\template\loader_tags.py", line 71, in render compiled_parent = self.get_parent(context) File "C:\code\kwbudget\django\template\loader_tags.py", line 66, in get_parent raise TemplateSyntaxError, "Template %r cannot be extended, because it doesn't exist" % parent TemplateSyntaxError: Template u'common.html' cannot be extended, because it doesn't exist And edit_budget.py starts with exactly the lines that I included up top. All templates live in a directory named "html" in my root directory, and "html/common.html" exists. I know the template engine finds them, because I start out with "html/edit_budget.html" which extends common.html. It looks as if the settings module somehow isn't applied (because that's what adds html to the search path for templates).

    Read the article

  • Returning Database Blobs in TurboGears 2.x / FCGI / Lighttpd extremely slow

    - by Tom
    Hey everyone, I am running a TG2 App on lighttpd via flup/fastcgi. We are reading images (~30kb each) from BlobFields in a MySQL database and return those images with a custom mime type via a controller method. Caching these images on the hard disk makes no sense because they change with every request, the only reason we cache these in the DB is that creating these images is quite expensive and the data used to create the images is also present in plain text on the website. Now to the problem itself: When returning such an image, things get extremely slow. The code runs totally fine on paster itself with no visible delay, but as soon as its running via fcgi/lighttpd the described phenomenon happens. I profiled the method of my controller that returns my blob, and the entire method runs in a few miliseconds, but when "return" executes, the entire app hangs for roughly 10 seconds. We could not reproduce the same error with PHP on FCGI. This only seems to happen with Turbogears or Pylons. Here for your consideration the concerned piece of source code: @expose(content_type=CUSTOM_CONTENT_TYPE) def return_img(self, img_id): """ Return a DB persisted image when requested """ img = model.Images.by_id(img_id) #get image from DB response.headers['content-type'] = 'image/png' return img.data # this causes the app to hang for 10 seconds

    Read the article

  • Why does my buffered GraphicsContext application have a flickering problem?

    - by Bibendum
    import wx class MainFrame(wx.Frame): def __init__(self,parent,title): wx.Frame.__init__(self, parent, title=title, size=(640,480)) self.mainPanel=DoubleBufferTest(self,-1) self.Show(True) class DoubleBufferTest(wx.Panel): def __init__(self,parent=None,id=-1): wx.Panel.__init__(self,parent,id,style=wx.FULL_REPAINT_ON_RESIZE) self.SetBackgroundColour("#FFFFFF") self.timer = wx.Timer(self) self.timer.Start(100) self.Bind(wx.EVT_TIMER, self.update, self.timer) self.Bind(wx.EVT_PAINT,self.onPaint) def onPaint(self,event): event.Skip() dc = wx.MemoryDC() dc.SelectObject(wx.EmptyBitmap(640, 480)) gc = wx.GraphicsContext.Create(dc) gc.PushState() gc.SetBrush(wx.Brush("#CFCFCF")) bgRect=gc.CreatePath() bgRect.AddRectangle(0,0,640,480) gc.FillPath(bgRect) gc.PopState() dc2=wx.PaintDC(self) dc2.Blit(0,0,640,480,dc,0,0) def update(self,event): self.Refresh() app = wx.App(False) f=MainFrame(None,"Test") app.MainLoop() I've come up with this code to draw double buffered GraphicsContext content onto a panel, but there's a constant flickering across the window. I've tried different kinds of paths, like lines and curves but it's still there and I don't know what's causing it.

    Read the article

  • Unable to control requests for static files on Google App Engine

    - by dan
    My simple GAE app is not redirecting to the /static directory for requests when url is multiple levels. Dir structure: /app/static/css/main.css App: I have two handlers one for /app and one for /app/new app.yaml: handlers: - url: /static static_dir: static - url: /app/static/(.*) static_dir: static\1 - url: /app/.* script: app.py login: required HTML: Description: When page is loaded from /app HTTP request for main.css is successful GET /static/css/main.css But when page is loaded from /app/new I see the following request: GET /app/static/css/main.cs That's when I tried adding the /app/static/(.*) in the app.yaml but it is not having any effect.

    Read the article

  • In Django, why is user.is_authenticated a method and not a member variable like is_staff

    - by luc
    Hello all, I've lost some time with a bug in my app due to user authentication. I think that it's a bit confusing but maybe someone can explain the reason and it will appear to me very logical. The user.is_staff is a member variable while user.is_authenticated is a method. However is_authenticated only returns True or False depending if the class is User or AnonymousUser (see http://docs.djangoproject.com/en/dev/topics/auth/) Is there a reason for that? Why user.is_authenticated is a method? Thanks in advance

    Read the article

  • Is django orm & templates thread safe?

    - by Piotr Czapla
    I'm using django orm and templates to create a background service that is ran as management command. Do you know if django is thread safe? I'd like to use threads to speed up processing. The processing is blocked by I/O not CPU so I don't care about performance hit caused by GIL.

    Read the article

  • need help in site classification

    - by goh
    hi guys, I have to crawl the contents of several blogs. The problem is that I need to classify whether the blogs the authors are from a specific school and is talking about the school's stuff. May i know what's the best approach in doing the crawling or how should i go about the classification?

    Read the article

  • How do I use django settings in my logging.ini file?

    - by slypete
    I have a BASE_DIR setting in my settings.py file: BASE_DIR = os.path.dirname(os.path.abspath(__file__)) I need to use this variable in my logging.ini file to setup my file handler paths. The initialization of logging happens in the same file, the settings.py file, below my BASE_DIR variable: LOG_INIT_DONE=False if not LOG_INIT_DONE: logging.config.fileConfig(LOGGING_INI) LOG_INIT_DONE=True Thanks, Pete

    Read the article

  • Condition checking vs. Exception handling

    - by Aidas Bendoraitis
    When is exception handling more preferable than condition checking? There are many situations where I can choose using one or the other. For example, this is a summing function which uses a custom exception: # module mylibrary class WrongSummand(Exception): pass def sum_(a, b): """ returns the sum of two summands of the same type """ if type(a) != type(b): raise WrongSummand("given arguments are not of the same type") return a + b # module application using mylibrary from mylibrary import sum_, WrongSummand try: print sum_("A", 5) except WrongSummand: print "wrong arguments" And this is the same function, which avoids using exceptions # module mylibrary def sum_(a, b): """ returns the sum of two summands if they are both of the same type """ if type(a) == type(b): return a + b # module application using mylibrary from mylibrary import sum_ c = sum_("A", 5) if c is not None: print c else: print "wrong arguments" I think that using conditions is always more readable and manageable. Or am I wrong? What are the proper cases for defining APIs which raise exceptions and why?

    Read the article

  • How come my South migrations doesn't work for Django?

    - by TIMEX
    First, I create my database. create database mydb; I add "south" to installed Apps. Then, I go to this tutorial: http://south.aeracode.org/docs/tutorial/part1.html The tutorial tells me to do this: $ py manage.py schemamigration wall --initial >>> Created 0001_initial.py. You can now apply this migration with: ./manage.py migrate wall Great, now I migrate. $ py manage.py migrate wall But it gives me this error... django.db.utils.DatabaseError: (1146, "Table 'fable.south_migrationhistory' doesn't exist") So I use Google (which never works. hence my 870 questions asked on Stackoverflow), and I get this page: http://groups.google.com/group/south-users/browse_thread/thread/d4c83f821dd2ca1c Alright, so I follow that instructions >> Drop database mydb; >> Create database mydb; $ rm -rf ./wall/migrations $ py manage.py syncdb But when I run syncdb, Django creates a bunch of tables. Yes, it creates the south_migrationhistory table, but it also creates my app's tables. Synced: > django.contrib.admin > django.contrib.auth > django.contrib.contenttypes > django.contrib.sessions > django.contrib.sites > django.contrib.messages > south > fable.notification > pagination > timezones > fable.wall > mediasync > staticfiles > debug_toolbar Not synced (use migrations): - (use ./manage.py migrate to migrate these) Cool....now it tells me to migrate these. So, I do this: $ py manage.py migrate wall The app 'wall' does not appear to use migrations. Alright, so fine. I'll add wall to initial migrations. $ py manage.py schemamigration wall --initial Then I migrate: $ py manage.py migrate wall You know what? It gives me this BS: _mysql_exceptions.OperationalError: (1050, "Table 'wall_content' already exists") Sorry, this is really pissing me off. Can someone help ? thanks. How do I get South to work and sync correctly with everything?

    Read the article

  • How can I draw a log-normalized imshow plot with a colorbar representing the raw data in matplotlib

    - by Adam Fraser
    I'm using matplotlib to plot log-normalized images but I would like the original raw image data to be represented in the colorbar rather than the [0-1] interval. I get the feeling there's a more matplotlib'y way of doing this by using some sort of normalization object and not transforming the data beforehand... in any case, there could be negative values in the raw image. import matplotlib.pyplot as plt import numpy as np def log_transform(im): '''returns log(image) scaled to the interval [0,1]''' try: (min, max) = (im[im > 0].min(), im.max()) if (max > min) and (max > 0): return (np.log(im.clip(min, max)) - np.log(min)) / (np.log(max) - np.log(min)) except: pass return im a = np.ones((100,100)) for i in range(100): a[i] = i f = plt.figure() ax = f.add_subplot(111) res = ax.imshow(log_transform(a)) # the colorbar drawn shows [0-1], but I want to see [0-99] cb = f.colorbar(res) I've tried using cb.set_array, but that didn't appear to do anything, and cb.set_clim, but that rescales the colors completely. Thanks in advance for any help :)

    Read the article

  • How to create instances of a class from a static method?

    - by Pierre
    Hello. Here is my problem. I have created a pretty heavy readonly class making many database calls with a static "factory" method. The goal of this method is to avoid killing the database by looking in a pool of already-created objects if an identical instance of the same object (same type, same init parameters) already exists. If something was found, the method will just return it. No problem. But if not, how may I create an instance of the object, in a way that works with inheritance? >>> class A(Object): >>> @classmethod >>> def get_cached_obj(self, some_identifier): >>> # Should do something like `return A(idenfier)`, but in a way that works >>> class B(A): >>> pass >>> A.get_cached_obj('foo') # Should do the same as A('foo') >>> A().get_cached_obj('foo') # Should do the same as A('foo') >>> B.get_cached_obj('bar') # Should do the same as B('bar') >>> B().get_cached_obj('bar') # Should do the same as B('bar') Thanks.

    Read the article

< Previous Page | 361 362 363 364 365 366 367 368 369 370 371 372  | Next Page >