Search Results

Search found 13534 results on 542 pages for 'python 2 6'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 365/542 | < Previous Page | 361 362 363 364 365 366 367 368 369 370 371 372  | Next Page >

  • How to classify NN/NNP/NNS obtained from POS tagged document as a product feature

    - by Shweta .......
    I'm planning to perform sentiment analysis on reviews of product features (collected from Amazon dataset). I have extracted review text from the dataset and performed POS tagging on that. I'm able to extract NN/NNP as well. But my doubt is how do I come to know that extracted words classify as features of the products? I know there are classifiers in nltk but I don't know how I should use it for my project. I'm assuming there are 2 ways of finding whether the extracted word is a product feature or not. One is to compare with a bag of words and find out if my word exists in that. Doubt: How do I create/get bag of words? Second way is to implement some kind of apriori algorithm to find out frequently occurring words as features. I would like to know which method is good and how to go about implementing it. Some pointers to available softwares or code snippets would be helpful! Thanks!

    Read the article

  • SelfReferenceProperty vs. ListProperty Google App Engine

    - by John
    Hi All, I am experimenting with the Google App Engine and have a question. For the sake of simplicity, let's say my app is modeling a computer network (a fairly large corporate network with 10,000 nodes). I am trying to model my Node class as follows: class Node(db.Model): name = db.StringProperty() neighbors = db.SelfReferenceProperty() Let's suppose, for a minute, that I cannot use a ListProperty(). Based on my experiments to date, I can assign only a single entity to 'neighbors' - and I cannot use the "virtual" collection (node_set) to access the list of Node neighbors. So... my questions are: Does SelfReferenceProperty limit you to a single entity that you can reference? If I instead use a ListProperty, I believe I am limited to 5,000 keys, which I need to exceed. Thoughts? Thanks, John

    Read the article

  • twisted reactor stops too early

    - by pygabriel
    I'm doing a batch script to connect to a tcp server and then exiting. My problem is that I can't stop the reactor, for example: cmd = raw_input("Command: ") # custom factory, the protocol just send a line reactor.connectTCP(HOST,PORT, CommandClientFactory(cmd) d = defer.Deferred() d.addCallback(lambda x: reactor.stop()) reactor.callWhenRunning(d.callback,None) reactor.run() In this code the reactor stops before that the tcp connection is done and the cmd is passed. How can I stop the reactor after that all the operation are finished?

    Read the article

  • How can I draw a log-normalized imshow plot with a colorbar representing the raw data in matplotlib

    - by Adam Fraser
    I'm using matplotlib to plot log-normalized images but I would like the original raw image data to be represented in the colorbar rather than the [0-1] interval. I get the feeling there's a more matplotlib'y way of doing this by using some sort of normalization object and not transforming the data beforehand... in any case, there could be negative values in the raw image. import matplotlib.pyplot as plt import numpy as np def log_transform(im): '''returns log(image) scaled to the interval [0,1]''' try: (min, max) = (im[im > 0].min(), im.max()) if (max > min) and (max > 0): return (np.log(im.clip(min, max)) - np.log(min)) / (np.log(max) - np.log(min)) except: pass return im a = np.ones((100,100)) for i in range(100): a[i] = i f = plt.figure() ax = f.add_subplot(111) res = ax.imshow(log_transform(a)) # the colorbar drawn shows [0-1], but I want to see [0-99] cb = f.colorbar(res) I've tried using cb.set_array, but that didn't appear to do anything, and cb.set_clim, but that rescales the colors completely. Thanks in advance for any help :)

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Django says the "id may not be NULL" but why is it?

    - by Oli
    I'm going crazy today. I just tried to insert a new record and it threw back a "post_blogpost.id may not be NULL" error. Here's my model: class BlogPost(models.Model): title = models.CharField(max_length=100) slug = models.SlugField(max_length=100) who = models.ForeignKey(User, default=1) when = models.DateTimeField() intro = models.TextField(blank=True, null=True) content = models.TextField(blank=True, null=True) counter = models.PositiveIntegerField(default=0) published = models.BooleanField(default=False) css = models.TextField(blank=True, null=True) class Meta: ordering = ('-when', 'id') There are a number of functions beneath the model too but I won't include them in full here. Their names are: content_cache_key, clear_cache, __unicode__, reads, read, processed_content. I'm adding through the admin... And I'm running out of hair.

    Read the article

  • Not able to pass multiple override parameters using nose-testconfig 0.6 plugin in nosetests

    - by Jaikit
    Hi, I am able to override multiple config parameters using nose-testconfig plugin only if i pass the overriding parameters on commandline. e.g. nosetests -c nose.cfg -s --tc=jack.env1:asl --tc=server2.env2:abc But when I define the same thing inside nose.cfg, than only the value for last parameter is modified. e.g. tc = server2.env2:abc tc = jack.env1:asl I checked the plugin code. It looks fine to me. I am pasting the part of plugin code below: parser.add_option( "--tc", action="append", dest="overrides", default = [], help="Option:Value specific overrides.") configure: if options.overrides: self.overrides = [] overrides = tolist(options.overrides) for override in overrides: keys, val = override.split(":") if options.exact: config[keys] = val else: ns = ''.join(['["%s"]' % i for i in keys.split(".") ]) # BUG: Breaks if the config value you're overriding is not # defined in the configuration file already. TBD exec('config%s = "%s"' % (ns, val)) Let me know if any one has any clue.

    Read the article

  • Filter zipcodes by proximity in Django with the Spherical Law of Cosines

    - by spiffytech
    I'm trying to handle proximity search for a basic store locater in Django. Rather than haul PostGIS around with my app just so I can use GeoDjango's distance filter, I'd like to use the Spherical Law of Cosines distance formula in a model query. I'd like all of the calculations to be done in the database in one query, for efficiency. An example MySQL query from The Internet implementing the Spherical Law of Cosines like this: SELECT id, ( 3959 * acos( cos( radians(37) ) * cos( radians( lat ) ) * cos( radians( lng ) - radians(-122) ) + sin( radians(37) ) * sin( radians( lat ) ) ) ) AS distance FROM stores HAVING distance < 25 ORDER BY distance LIMIT 0 , 20; The query needs to reference the Zipcode ForeignKey for each store's lat/lng values. How can I make all of this work in a Django model query?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Dynamically setting the queryset of a ModelMultipleChoiceField to a custom recordset

    - by Daniel Quinn
    I've seen all the howtos about how you can set a ModelMultipleChoiceField to use a custom queryset and I've tried them and they work. However, they all use the same paradigm: the queryset is just a filtered list of the same objects. In my case, I'm trying to get the admin to draw a multiselect form that instead of using usernames as the text portion of the , I'd like to use the name field from my account class. Here's a breakdown of what I've got: # models.py class Account(models.Model): name = models.CharField(max_length=128,help_text="A display name that people understand") user = models.ForeignKey(User, unique=True) # Tied to the User class in settings.py class Organisation(models.Model): administrators = models.ManyToManyField(User) # admin.py from django.forms import ModelMultipleChoiceField from django.contrib.auth.models import User class OrganisationAdminForm(forms.ModelForm): def __init__(self, *args, **kwargs): from ethico.accounts.models import Account self.base_fields["administrators"] = ModelMultipleChoiceField( queryset=User.objects.all(), required=False ) super(OrganisationAdminForm, self).__init__(*args, **kwargs) class Meta: model = Organisation This works, however, I want queryset above to draw a selectbox with the Account.name property and the User.id property. This didn't work: queryset=Account.objects.all().order_by("name").values_list("user","name") It failed with this error: 'tuple' object has no attribute 'pk' I figured that this would be easy, but it's turned into hours of dead-ends. Anyone care to shed some light?

    Read the article

  • SQLAlchemy - SQLite for testing and Postgresql for devlopment - How to port?

    - by StackUnderflow
    I want to use sqlite memory database for all my testing and Postgresql for my development/production server. But the SQL syntax is not same in both dbs. for ex: SQLite has autoincrement, and Postgresql has serial Is it easy to port the SQL script from sqlite to postgresql... what are your solutions? If you want me to use standard SQL, how should I go about generating primary key in both the databases?

    Read the article

  • Problem with anchor tags in Django after using lighttpd + fastcgi

    - by Drew A
    I just started using lighttpd and fastcgi for my django site, but I've noticed my anchor links are no longer working. I used the anchor links for sorting links on the page, for example I use an anchor to sort links by the number of points (or votes) they have received. For example: the code in the html template: ... {% load sorting_tags %} ... {% ifequal sort_order "points" %} {% trans "total points" %} {% trans "or" %} {% anchor "date" "date posted" %} {% order_by_votes links request.direction %} {% else %} {% anchor "points" "total points" %} {% trans "or" %} {% trans "date posted" %} ... The anchor link on "www.mysite.com/my_app/" for total points will be directed to "my_app/?sort=points" But the correct URL should be "www.mysite.com/my_app/?sort=points" All my other links work, the problem is specific to anchor links. The {% anchor %} tag is taken from django-sorting, the code can be found at http://github.com/directeur/django-sorting Specifically in django-sorting/templatetags/sorting_tags.py Thanks in advance.

    Read the article

  • Trouble with encoding and urllib

    - by Ockonal
    Hello, I'm loading web-page using urllib. Ther eis russian symbols, but page encoding is 'utf-8' 1 pageData = unicode(requestHandler.read()).decode('utf-8') UnicodeDecodeError: 'ascii' codec can't decode byte 0xd0 in position 262: ordinal not in range(128) 2 pageData = requestHandler.read() soupHandler = BeautifulSoup(pageData) print soupHandler.findAll(...) UnicodeEncodeError: 'ascii' codec can't encode characters in position 340-345: ordinal not in range(128)

    Read the article

  • A graph-based tuple merge?

    - by user1644030
    I have paired values in tuples that are related matches (and technically still in CSV files). Neither of the paired values are necessarily unique. tupleAB = (A####, B###), (A###, B###), (A###, B###)... tupleBC = (B####, C###), (B###, C###), (B###, C###)... tupleAC = (A####, C###), (A###, C###), (A###, C###)... My ideal output would be a dictionary with a unique ID and a list of "reinforced" matches. The way I try to think about it is in a graph-based context. For example, if: tupleAB[x] = (A0001, B0012) tupleBC[y] = (B0012, C0230) tupleAC[z] = (A0001, C0230) This would produce: output = {uniquekey0001, [A0001, B0012, C0230]} Ideally, this would also be able to scale up to more than three tuples (for example, adding a "D" match that would result in an additional three tuples - AD, BD, and CD - and lists of four items long; and so forth). In regards to scaling up to more tuples, I am open to having "graphs" that aren't necessarily fully connected, i.e., every node connected to every other node. My hunch is that I could easily filter based on the list lengths. I am open to any suggestions. I think, with a few cups of coffee, I could work out a brute force solution, but I thought I'd ask the community if anyone was aware of a more elegant solution. Thanks for any feedback.

    Read the article

  • How to allow resizing of QMessageBox in PyQt4

    - by Simeon Fitch
    I'm using the nice feature in QMessageBox to optionally show detailed text to the user. However, the window after expansion is still fairly small, and one immediately tries to resize the window so more of the details are visible. Even after setting what I think are the proper settings it won't allow resizing. Here's the relevant snippet of PyQt4 code: mb = QMessageBox() mb.setText("Results written to '%s'" % filename) mb.setDetailedText(str(myData)) mb.setSizePolicy(QSizePolicy.Expanding, QSizePolicy.Expanding) mb.setSizeGripEnabled(True) Am I missing a step and/or is this at all possible?

    Read the article

  • Locating file path from a <InMemoryUploadedFile> Djnago object

    - by PirosB3
    Hi all I have a Django app which, submitting a package, should return values that are inside it.. Submitted the form to a view called "insert": request.FILES['file'] returns the file objects, but it is of kind < InMemoryUploadedFile. What i need is a way to get the absolute path of the uploaded file, so that i can feed it to a method that will return the values needed Anyone know how i can accomplish this? Thanks

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 361 362 363 364 365 366 367 368 369 370 371 372  | Next Page >