Search Results

Search found 63197 results on 2528 pages for 'every answer gets a point'.

Page 37/2528 | < Previous Page | 33 34 35 36 37 38 39 40 41 42 43 44  | Next Page >

  • Web Projects gets auto check out on build.

    - by chugh97
    I am using VS2008 with TFS 2008 and I have a web application project which gets auto check out on build.How can this be avoided? I dont want to change my Source Control changes which are auto check out on edit. When I check in the file it says file are idential, no changes...Any pointers

    Read the article

  • Operator== in derived class never gets called.

    - by Robin Welch
    Can someone please put me out of my misery with this? I'm trying to figure out why a derived operator== never gets called in a loop. To simplify the example, here's my Base and Derived class: class Base { // ... snipped bool operator==( const Base& other ) const { return name_ == other.name_; } }; class Derived : public Base { // ... snipped bool operator==( const Derived& other ) const { return ( static_cast<const Base&>( *this ) == static_cast<const Base&>( other ) ? age_ == other.age_ : false ); }; Now when I instantiate and compare like this ... Derived p1("Sarah", 42); Derived p2("Sarah", 42); bool z = ( p1 == p2 ); ... all is fine. Here the operator== from Derived gets called, but when I loop over a list, comparing items in a list of pointers to Base objects ... list<Base*> coll; coll.push_back( new Base("fred") ); coll.push_back( new Derived("sarah", 42) ); // ... snipped // Get two items from the list. Base& obj1 = **itr; Base& obj2 = **itr2; cout << obj1.asString() << " " << ( ( obj1 == obj2 ) ? "==" : "!=" ) << " " << obj2.asString() << endl; Here asString() (which is virtual and not shown here for brevity) works fine, but obj1 == obj2 always calls the Base operator== even if the two objects are Derived. I know I'm going to kick myself when I find out what's wrong, but if someone could let me down gently it would be much appreciated.

    Read the article

  • Use GIS to get geographic info for a single point

    - by Patrick Scott
    I am not quite sure where to start with this. I only just started looking into this in the past week, but hopefully someone can help point me in the right direction. The goal of my project is to be able to take a geohash, decode it to latitude and longitude, check the point against some GIS data, and find out some information about that point such as the terrain(is this a body of water? A lake? An Ocean? Is this a mountainous area? Is this a field?), altitude, or other useful things. Then simply be able to display that information as a starter. What I have gathered so far is that I need to get some free GIS data (this is for school, so I have no money!). I would like to have world data, and I found some online (http://www.webgis.com/terraindata.html) but I don't know where to go from here. I saw some tools such as PostGIS as a database. I am currently using Java for some other parts of the project, so if possible I would like to stick to Java. Can someone help me out, or point me in the right direction?

    Read the article

  • Losing partitions after every reboot

    - by Winston Smith
    I have an Acer laptop with one hard disk, which up until yesterday had 4 partitions: Recovery Partition (13GB) C: (140GB) D: (130GB) OEM Partition (10GB) I read that the OEM partition has all the stuff needed to restore the laptop to the factory settings, but since I'd already created restore disks and I needed the space, I wanted to get rid of it. Yesterday, I used diskpart to do that. In diskpart, I selected the OEM partition and issued the delete partition override command which removed it. Then I extended the D: partition into the unused space using windows disk management. Everything worked fine, until I rebooted my laptop, at which point the D: drive vanished. Looking in windows disk management again, I can see that there's an OEM partition of 140GB, which is obviously my D: drive. So I used EASEUS Partition Master and assigned a drive letter to the 'OEM' partition and I was able to access my files again. However, every time I reboot, it reverts back. How do I fix this permanently?

    Read the article

  • Why does VirtualBox want my attention every morning?

    - by Ken
    I'm running Vista 64-bit Ultimate on this PC. On it, I've installed VirtualBox, and in that I'm running Linux. Everything's working great. I leave it running all the time. When I come in in the morning, every time, the "Sun VirtualBox" item in the Windows taskbar is bright orange, like it's trying to get my attention. What would cause this? I'm curious both if somebody has an idea of something VirtualBox might do that warrants this attention-grab, or what to look for in the VB logs to find out what causes this. I'm sure it's harmless, but I'd like to stop it if I can.

    Read the article

  • Help me find the offending process waking my Windows 7 PC from hibernate every night

    - by DavidGugick
    Recently my Windows 7 64-bit PC has started waking every night from hibernation around 3:30am. I have done the following to try and figure out what is causing the issue with no luck: Examined the Windows Event logs. Nothing is noted Ran powercfg -lastwake and that reports nothing c:\powercfg -lastwake Wake History Count - 1 Wake History [0] Wake Source Count - 0 Ran powercfg to find what devices are armed for wake. Interestingly, this reports two items (I've already unchecked the "Allow this device to wake the computer" in device manager): The keyboard and something called the "eHome Infrared Receiver (USBCIR)". This is a desktop PC and it does not have an Infrared received, so I'm not sure what that device is. Suffice to say it does not have the option to "Allow device to wake..." available in Device Manager. C:\powercfg -devicequery wake_armed eHome Infrared Receiver (USBCIR) HID Keyboard Device My next step is to disable the Keyboard from wake, but I'm not convined that's the problem. This is on a Dell XPS435 if that helps anyone.

    Read the article

  • Why an ASP.NET web site gets recompiled when renaming or deleting a folder inside

    - by amartynov
    Hi everybody, I develop a simple file manager inside an ASP.NET Web site (not web application). I notice that every time I rename or delete a folder, the site gets recompiled - i.e. the very next web request after delete or rename operation takes considerably much time to execute. It's only true for folders, not for files. Why does this occur? P.S. I use WebDev server (Cassini), haven't tested in on IIS yet.

    Read the article

  • IIS needs to be restarted every morning

    - by Kevin
    In one of my Application and DB Server , SSIS package runs at night. Every morning i need to reset IIS to work the Application Fast and smoothly. One day i tried to SKIP the SSIS Package and next day i hvnt Done the IIS reset. What could be the problem. Is there any alternate Solution for IIS reset. How can i schedule and make sure the IIS is RESTARTED through Batch File / s. Application is developed in .NET and DB is SQL latest version. The application is hostes on cloud server. Your prompt reply will be helpful for me.

    Read the article

  • belkin wireless router connection drops for ~60sec every ~15 mins

    - by j j
    Hi, I have a belkin wireless-g router, model F5D7230-4. about every 10-15 minutes, for about 1-1.5 mins I won't be able to browse any web sites. during this period, I usually get replys from "ping google.com". maybe 4/5 times I'll get a reply, 1/5 times i don't. I have changed the router DNS entries from "get DNS server from ISP" to 8.8.8.8, google's DNS and that hasn't fixed the situation. This happens on several computers, running windows7, xp, ubuntu, and a mac, so it is definitely NOT an issue with a computer configuration. any ideas?

    Read the article

  • automatically switch from display 1 to display 2 every x minutes

    - by Jean-Pierre
    I am not that good with programmation, but I guess you are. we are planning to install 2 display monitor in the back of the other one. There will be 1 computer that will display a different application on each display monitor. I want to be able to switch display 1 to 2 and display 2 to display 1 to show what is on the other monitor without having to move themselve on the back of the monitor to see the opposite monitor. I need a script that will switch display every x times. How can I do that ?

    Read the article

  • Wireless router not connection -> AP Not associated

    - by candido
    I can not connect to internet by wireless router after some months with ubuntu 10.04. I can connect with the same portable but with win OS. My SO is ubuntu 10.04 linux 2.6.32-41 arch SMP i686. The internet wireless network controller is Atheros AR9285 chipset (pci express) Kernel module ath9k I have tried a command line connection: $ sudo /etc/init.d/network-manager stop #stop gui network manager $ iwconfig wlan0 essid WLAN_3C key s:C001D20550B3C $ ifconfig Access Point: NOT-ASSOCIATED $dmesg ... AP 00:1a:2b:08:60:49 associated Is the SO has connected to router for booting long ( associated message), after boot and login why the connection to router is not possible by network-manager or command line (NOT associated message)? Thanks in advance

    Read the article

  • OS X Terminal using default ANSI colours for every theme

    - by FrogBot
    For some reason, every theme I palette I've had installed for the OS X Terminal.app has reverted to using the default ANSI colours. The themes have been working fine up until this point and I can't seem to determine what could have caused them to revert in this way. For reference, my standard Solarized Dark colour scheme should look like this … … but it currently looks like this: A quick look in the preferences panel shows that all the colours are correct save for the ANSI colours which have reverted to their defaults. I don't know what other information would be helpful but if you need any other info to help me troubleshoot just ask and I'll update as quickly as I can.

    Read the article

  • Server reboots every 4.5-5.5 minutes...

    - by Andy
    Hi, I've recently installed a server in colocation, and my server is rebooting every 4.5-5.5 minutes. Regardless of the OS I run, it reboots. I have all ECC memory in the server, so it should correct errors if there is a bad bit in the memory, right? It's weird because it always happens about 4.5-5.5 minutes after bootup. My motherboard is a Supermicro X8DTL-iF. I read on a blog that another person had the problem, and supermicro recommended to do a BIOS update. Is this the right course of action?

    Read the article

  • Point subdirectory to another domain is IIS 6

    - by Liviu
    Is it possible to rewrite somehow www.mysite.com/Pictures to point to test.mysite.com/Pictures or even more broadly www.someothersite.com/Pictures ? Note: www.mysite.com and test.mysite.com are on separate machines and built with different technologies (one is ASP.NET and the other is PHP) but I have access to both of them. I want that when I reference a picture like www.mysite.com/Pictures/pic12345.png the picture to display correctly, even though there is not /Pictures folder on that server and the pictures has to be retrieved by going to test.mysite.com/Picture/pic12345.png Ideally I want to do this in IIS6 to test it. However I am interested if it possible to do in any webserver (Apache, IIS7)

    Read the article

  • Copying single files into a folder that changes name every time the batch file is executed

    - by Daniel Jochem
    Can you please help, I am using this to put the text files made by the batch file into the folder created by the batch file as well. but my problem is that the name is changed of the new folder every time because it is named by the date and time it was created. This is the code: @echo off for /F " tokens=1,2,3* delims=/, " %%i IN ('date /T') DO ( set CUR_DAY_OF_WEEK=%%i set CUR_MONTH=%%j set CUR_DAY=%%k set CUR_YEAR=%%l) for /F " tokens=1,2,3* delims=:, " %%i IN ('time /T') DO ( set CUR_HOUR=%%i set CUR_MIN=%%j set AM_PM=%%k) if not exist E:\Private goto :F cd E:\Private md "E:\Private\%CUR_HOUR%.%CUR_MIN%%AM_PM% %j%%CUR_MONTH%-%CUR_DAY%-%CUR_YEAR%" goto :start :F if not exist F:\Private goto :G cd F:\Private md "F:\Private\%CUR_HOUR%.%CUR_MIN%%AM_PM% %j%%CUR_MONTH%-%CUR_DAY%-%CUR_YEAR%" goto :start :G cd G:\Private md "G:\Private\%CUR_HOUR%.%CUR_MIN%%AM_PM% %j%%CUR_MONTH%-%CUR_DAY%-%CUR_YEAR%" goto :start :start start /min A /stext A.txt start /min B /stext B.txt start /min C /stext C.txt start /min D /stext D.txt (As the directory (E:-G:) changes, how can I check all without an error? And once that is found, then put all these text files into the date folder.

    Read the article

  • Why can't decimal numbers be represented exactly in binary?

    - by Barry Brown
    There have been several questions posted to SO about floating-point representation. For example, the decimal number 0.1 doesn't have an exact binary representation, so it's dangerous to use the == operator to compare it to another floating-point number. I understand the principles behind floating-point representation. What I don't understand is why, from a mathematical perspective, are the numbers to the right of the decimal point any more "special" that the ones to the left? For example, the number 61.0 has an exact binary representation because the integral portion of any number is always exact. But the number 6.10 is not exact. All I did was move the decimal one place and suddenly I've gone from Exactopia to Inexactville. Mathematically, there should be no intrinsic difference between the two numbers -- they're just numbers. By contrast, if I move the decimal one place in the other direction to produce the number 610, I'm still in Exactopia. I can keep going in that direction (6100, 610000000, 610000000000000) and they're still exact, exact, exact. But as soon as the decimal crosses some threshold, the numbers are no longer exact. What's going on? Edit: to clarify, I want to stay away from discussion about industry-standard representations, such as IEEE, and stick with what I believe is the mathematically "pure" way. In base 10, the positional values are: ... 1000 100 10 1 1/10 1/100 ... In binary, they would be: ... 8 4 2 1 1/2 1/4 1/8 ... There are also no arbitrary limits placed on these numbers. The positions increase indefinitely to the left and to the right.

    Read the article

  • Setting a wireless access point on Ubuntu server 11.10

    - by Solignis
    I am trying to setup a wifi access point with my Ubuntu server. I have managed to get my phone to connect the wireless and now it get a DHCP lease. Though it still cannot ping out or get pinged by anything on my network. I am prety sure my problem is iptables, but I not sure what would be wrong. Here is what my rules look like. (The ones pertaining to the bridge interface) # Allow traffic to / from wireless bridge interface iptables -A INPUT -i br0 -j ACCEPT iptables -A OUTPUT -o br0 -j ACCEPT I am guessing my rules are a little lean, the bridge exists on the same subnet as everything else on my network, I am using a 10.0.0.0/24 subnet. EDIT Oh yeah I should mention also, when I do a ping test, I get Destination Host Unreachable as the error.

    Read the article

  • Make backups of Dropbox folder every week

    - by ilansch
    I have a Dropbox folder which is shared by couple of users. I would like to make a backup of this folder that will occur every week and store this backup on another hard drive. I can simply copy the entire folder each time and this will be the backup, but I would like to copy only the files that have been changed or created during that week. I thought of creating a batch script that will check each file in the Dropbox folder recursively and see its modified date. If that date is later then a given one (current backup date) it will copy the file to a folder named BackUP[Date]. Do you think this solution is OK?

    Read the article

  • Cron Script to Delete Folder Contents Every 5 Minutes on Media Temple

    - by Brian Iannone
    I'm not familiar with server-side scripting, but I'm currently using a PHP application on Media Temple to cache JPEGs from four webcams hosted on a server located in the middle of the Indian Ocean. (Hence my reason for caching them in the US.) The webcams are updated every five minutes. The PHP application stores the cached images in http://static.rigic.co/cache/. I would like to create a cron script to automatically delete the contents of "cache" (not the folder itself; just the files inside) at a regular interval.

    Read the article

  • Using a 3g usb dongle as Cisco router access point

    - by beakersoft
    We have an office opening, and we aren't going to have comms into the building when management want the building to open. Our only option (I think) Is to try and hook up a 3/4g dongle to something to act as the access point, and send all the traffic via that. The model of router we use wont support the usb dongle, so we need some sort of 'bridge' My idea was to build a Linux box, plug the dongle into that and then via the Ethernet ports plug the router in. We need the Cisco router in the equation as we create VPN connections over that back to head office. My question is will this work?

    Read the article

  • Different BSOD every time I turn on computer

    - by Gemboz
    Please help. Every time I turn on computer I receive a different BSOD. I can't even give my computer info because I haven't been able to stay on it long enough. The following are the BSOD that I just received in the last hour. IRQL_NOT_LESS_OR_EQUAL PAGE_FAULT_IN_NONPAGED_AREA BAD_POOL_HEADER MEMORY_MANAGEMENT I has also started with Windows Error Recovey which I have done but that has froze on me or hasn't helped. I have also reset computer to its original state. Now as soon as I turn on it goes to a BSOD almost immediately. I know you need more info about computer, so if you can tell me what info it is you need, I will get it. I can tell you that it is a desktop.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • C#: My callback function gets called twice for every Sent Request

    - by Madi D.
    I've Got a program that uploads/downloads files into an online server,Has a callback to report progress and log it into a textfile, The program is built with the following structure: public void Upload(string source, string destination) { //Object containing Source and destination to pass to the threaded function KeyValuePair<string, string> file = new KeyValuePair<string, string>(source, destination); //Threading to make sure no blocking happens after calling upload Function Thread t = new Thread(new ParameterizedThreadStart(amazonHandler.TUpload)); t.Start(file); } private void TUpload(object fileInfo) { KeyValuePair<string, string> file = (KeyValuePair<string, string>)fileInfo; /* Some Magic goes here,Checking The file and Authorizing Upload */ var ftiObject = new FtiObject () { FileNameOnHDD = file.Key, DestinationPath = file.Value, //Has more data used for calculations. }; //Threading to make sure progress gets callback gets called. Thread t = new Thread(new ParameterizedThreadStart(amazonHandler.UploadOP)); t.Start(ftiObject); //Signal used to stop progress untill uploadCompleted is called. uploadChunkDoneSignal.WaitOne(); /* Some Extra Code */ } private void UploadOP(object ftiSentObject) { FtiObject ftiObject = (FtiObject)ftiSentObject; /* Some useless code to create the uri and prepare the ftiObject. */ // webClient.UploadFileAsync will open a thread that // will upload the file and report // progress/complete using registered callback functions. webClient.UploadFileAsync(uri, "PUT", ftiObject.FileNameOnHDD, ftiObject); } I got a callback that is registered to the Webclient's UploadProgressChanged event , however it is getting called twice per sent request. void UploadProgressCallback(object sender, UploadProgressChangedEventArgs e) { FtiObject ftiObject = (FtiObject )e.UserState; Logger.log(ftiObject.FileNameOnHDD, (double)e.BytesSent ,e.TotalBytesToSend); } Log Output: Filename: C:\Text1.txt Uploaded:1024 TotalFileSize: 665241 Filename: C:\Text1.txt Uploaded:1024 TotalFileSize: 665241 Filename: C:\Text1.txt Uploaded:2048 TotalFileSize: 665241 Filename: C:\Text1.txt Uploaded:2048 TotalFileSize: 665241 Filename: C:\Text1.txt Uploaded:3072 TotalFileSize: 665241 Filename: C:\Text1.txt Uploaded:3072 TotalFileSize: 665241 Etc... I am watching the Network Traffic using a watcher, and only 1 request is being sent. Some how i cant Figure out why the callback is being called twice, my doubt was that the callback is getting fired by each thread opened(the main Upload , and TUpload), however i dont know how to test if thats the cause. Note: The reason behind the many /**/ Comments is to indicate that the functions do more than just opening threads, and threading is being used to make sure no blocking occurs (there a couple of "Signal.WaitOne()" around the code for synchronization)

    Read the article

  • My laptop can connect to every wireless network except fios

    - by going crazy
    I have always been able to connect to every wireless router secured or unsecured wep or wpa. I had Fios installed and could not connect. Verizon suggested it was my computer and gave me an outside wirless drive to use, it worked. I got rid of fios and went back to comcast and threw out the drive, but now 2 years later, I am sitting at my friends house haveing the same problem. My tech savy friend told me it is a firewall setting or something in my antivirus software, but I disabled them both and still nothing works........Funny it is only FIOS

    Read the article

  • Folders disappear every timeWindows XP starts up

    - by Reebz
    Whenever my Windows XP machine starts up, subfolders disappear from the first top-level folder, listed alphabetically (eg. from "C:\AA Backups"). The first time it happened I suspected user error (such as an unintentional delete or copy). But I then found it happens on every start-up, sometimes affecting huge numbers of files. Renaming the affected folder (eg to "ZZ Backups") just means that a different folder is affected the next time. Avast found no virus or malware that would seem to be responsible. The missing files are not visible to an undelete utility such as NTFSUndelete. Running "chkdsk/f" found no problems and did not fix the problem. File permissions also appear corrupted - a few files which should be accessible are missing "read" permission. What's happened to this machine?? Any ideas or reports of similar experiences would be most welcome.

    Read the article

< Previous Page | 33 34 35 36 37 38 39 40 41 42 43 44  | Next Page >