Search Results

Search found 63197 results on 2528 pages for 'every answer gets a point'.

Page 38/2528 | < Previous Page | 34 35 36 37 38 39 40 41 42 43 44 45  | Next Page >

  • FTP upload stalls at same point every time on FileZilla

    - by John
    On two different FTP accounts, I am having problems uploading files. I can login and see the contents of the dir, and start an upload. Using Filezilla the transfer seems to always stall at either 0.9% or 1.2% (always those two numbers) and may simply hang, or keep restarting and then again stop at the same point. WindowsXP FTP is not great but I get similar types of problems there... it starts uploading and after a short while I get a timeout error. FTP used to work fine, and I don't know if it's these accounts in particular (both have the same service provider although purchased on opposite sides of the world) or if "FTP is broken on my PC"... can that even happen?!

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Folders disappear every timeWindows XP starts up

    - by Reebz
    Whenever my Windows XP machine starts up, subfolders disappear from the first top-level folder, listed alphabetically (eg. from "C:\AA Backups"). The first time it happened I suspected user error (such as an unintentional delete or copy). But I then found it happens on every start-up, sometimes affecting huge numbers of files. Renaming the affected folder (eg to "ZZ Backups") just means that a different folder is affected the next time. Avast found no virus or malware that would seem to be responsible. The missing files are not visible to an undelete utility such as NTFSUndelete. Running "chkdsk/f" found no problems and did not fix the problem. File permissions also appear corrupted - a few files which should be accessible are missing "read" permission. What's happened to this machine?? Any ideas or reports of similar experiences would be most welcome.

    Read the article

  • What does "every two minutes" mean in cron?

    - by Ambrose
    I've got two scripts in cron set to run every two minutes: */2 -- the thing is, they're out of step. One runs at 1,3,5,7,9 minutes, etc. and the other at 0,2,4,6,8. This is not a mission-critical problem, but means I've got two status reports, one a bit stale compared to the other. What does cron do exactly? Run the first one in crontab document order, waiting till it's finished to run the second one? Is there any way I can make the run at the same time, or as close as possible?

    Read the article

  • CPanel: Every url is being redirected to http://:2083

    - by Frank
    On my cpanel server, I restored about 50 accounts from crashed cpanel server. All of the sites were working fine, but suddenly without changing anything, every site started to get redirected to url "http://:2083/"., There is nothing in logs, no errors. when i do wget it says: wget grinfeld.com.br --2012-09-04 13:18:23-- http://grinfeld.com.br/ Resolving grinfeld.com.br... 198.101.221.254 Connecting to grinfeld.com.br|198.101.221.254|:80... connected. HTTP request sent, awaiting response... 301 Moved Location: https://:2083/ [following] https://:2083/: Invalid host name.

    Read the article

  • After recovery to restore point, Windows 7 missing pinned items and favorites

    - by Michael Levy
    I believe a recent windows update was interrupted. The next day, I could not logon and was presented with the error "User Profile Service service failed the logon. User profile cannot be loaded". I followed some advice from http://answers.microsoft.com/en-us/windows/forum/windows_vista-security/help-user-profile-service-service-failed-the-logon/4ed66b21-c23e-42f1-98b2-706dcf931fae and logged in with a different admin account and used system restore to restore to a recent restore point. Most everything is working fine, but I have noticed two odd things: Any items that were pinned to my start menu or task bar were not accessible. I had to un-pin and re-pin the items. In Windows Explorer, my favorites are gone and I can't seem to add any favorites. If I browse to a folder and right click on the Favorites Icon and select "add current location to favorites" nothing is saved. I'd appreciate any explanation to understand why these things did not get recovered properly and any help fixing the favorite functionality.

    Read the article

  • Ruby Challenge - efficiently change the last character of every word in a sentence to a capital

    - by emson
    Hi All I recently was challenged to write some Ruby code to change the last character of every word in a sentence into a capital. Such that the string: "script to convert the last letter of every word to a capital" becomes "scripT tO converT thE lasT letteR oF everY worD tO A capitaL" This was my optimal solution however I'm sure you wizards have much better solutions and I would be really interested to hear them. "script to convert the last letter of every word to a capital".split.map{|w|w<<w.slice!(-1).chr.upcase}.join' ' For those interested as to what is going on here is an explanation. split will split the sentence up into an array, the default delimiter is a space and with Ruby you don't need to use brackets here. map the array from split is passed to map which opens a block and process each word (w) in the array. the block slice!(s) off the last character of the word and converts it to a chr (a character not ASCII code) and then capitalises upcase it. This character is now appended << to the word which is missing the sliced last letter. Finally the array of words is now join together with a ' ' to reform the sentence. Enjoy

    Read the article

  • In Windows Vista, when starting any and every program, a "bad image" error is generated

    - by Mark Hatton
    I have a problem where any program is started under Windows Vista, the following error message is generated Bad Image C;\PROGRA~1\Google\GOOGLE~3\GOEC62~1.DLL is either not designed to run on Windows or it contains an error.Try installing the program again using the original installation media or contact your system administrator or the software vendor for support. This happens for every program started, including those that start automatically at boot time. My Google-fu is failing to solve this for me. I have already tried an "sfc /scannow" which did find some problems, but it said that it could not correct them. What might cause this problem? How might it be resolved?

    Read the article

  • How do I schedule a task to run every hour indefinitely on Server 2003

    - by JMK
    I am moving a scheduled task from a Windows 7 machine to a Windows Server 2003 machine. On Windows 7 I can configure my task to run every hour indefinitely by setting up a custom trigger like so: On Windows Server 2003, I assume I need to use the advanced schedule options, and I have got this far: Whether I choose duration or time, my task seems to have an expiry date, how do I get this to run indefinitely? The only thing I can think of at the minute is to setup 24 schedules for my task, one for each hour but there has to be a more elegant way. Thanks

    Read the article

  • Oracle application - files missing in the Mount point in UNix server

    - by arun_V
    My oracle application test instance is down, When I browse through the Unix server, I couldn’t find any files in the mount point,U01 U06 or U10, when I put BDF command it shows the following $ bdf Filesystem kbytes used avail %used Mounted on /dev/vg00/lvol3 204800 35571 158662 18% / /dev/vg00/lvol1 299157 38506 230735 14% /stand /dev/vg00/lvol8 1392640 1261068 123620 91% /var /dev/vg00/lvol7 1327104 825170 470631 64% /usr /dev/vg00/lvol4 716800 385891 310746 55% /tmp /dev/vg00/lvol6 872448 814943 53936 94% /opt /dev/vg00/lvolssh 32768 13243 18306 42% /opt/openssh /dev/vg00/lvol5 204800 187397 16334 92% /home /dev/vg00/lvolback 512000 472879 36704 93% /backup dg-ora04:/dgora03_u10 204800 167088 35416 83% /u10 dg-ora04:/dgora03_u06 204800 167088 35416 83% /u06 dg-ora04:/dgora03_u01 204800 167088 35416 83% /u01 Why can't I see any files inside the mount points?

    Read the article

  • Unix printing a banner page on every print job

    - by yum_tacos4u
    I have a Data General server on unix that is printing a banner page on every print. I originally thought that the banner page was comming from the printer. As this is an HP printer, I used telnet to get to the jetadmin and then proceded to disable the banner page, but this did not solve the issue. I then went into the sysadm program to see if the TCPIP printing was set to print a banner page on print jobs, but I did not see any options to print a banner page. Any help or ideas on how to disable the banner page from printing in unix? Here is a banner page example print

    Read the article

  • Server responses "bus error" to every command

    - by Temnovit
    I have a linux machine dedicated to MySQL server with a pretty high load. Today I woke up and was terrified to see, that database server is down. I could connect to it via SSH, but it was responding with bus error to each and every command. [root@r1304 home]# ls Bus error [root@r1304 home]# tail /var/log/messages Bus error [root@r1304 home]# reboot Bus error [root@r1304 home]# free -m Bus error [root@r1304 home]# chkdisk Bus error I went to Data Center and did a hard reset, which seemed to help, but after a half an hour situation reapeated and now I can't even connet via SSH anymore. Any ideas what this could be? how to diagnose such a problem and what are possible fixes? Server has 32 GB RAM, 2xSSD drives with software RAID UPDATE According to Zabbix, when MySQL died, number of processes stated to increase drammaticaly, until I did a hard reset. What could those be? Number of processes

    Read the article

  • create a view to show the backup status in every 10 mins

    - by user2853141
    I have a question, my table have following data: userID, startTime, EndTime ————————————— 101, 04/11/2013 11:00:00, 04/11/2013 11:55:00 102, 04/11/2013 11:00:00, 04/11/2013 11:24:00 103, 04/11/2013 11:20:00, 04/11/2013 11:45:00 104, 04/11/2013 11:30:00, 04/11/2013 11:35:00 105, 04/11/2013 11:40:00, 04/11/2013 11:55:00 can I use the view to show the backup status in every 10 mins? I wonder the result as following: time, count —————————— 04/11/2013 11:00:00, 2 04/11/2013 11:10:00, 2 04/11/2013 11:20:00, 3 04/11/2013 11:30:00, 3 04/11/2013 11:40:00, 3 04/11/2013 11:50:00, 2 04/11/2013 12:00:00, 0 04/11/2013 11:00:00 – 04/11/2013 11:09:59 have 2 jobs, 101 & 102 04/11/2013 11:10:00 – 04/11/2013 11:19:59 have 2 jobs, 101 & 102 04/11/2013 11:20:00 – 04/11/2013 11:29:59 have 3 jobs, 101 & 102 & 103 … 04/11/2013 11:50:00 – 04/11/2013 11:59:59 have 2 jobs, 101 & 105 04/11/2013 12:00:00 – 04/11/2013 12:09:59 have 0 job I wonder if you can give me a help……thanks a lot

    Read the article

  • My iphone app gets memory warning and killed at 6.8MB

    - by Pankaj
    My app has a thread that does some time consuming job for more than a minute and the app consumes around 6.8MB of memory. I receive a memory warning after sometime and then it gets killed. There is nothing that I can release, and I am using not even 7MB of memory...driving me crazy...any advice please?

    Read the article

  • Using nginx as a reverse proxy for tomcat results in new jsessionids for every ssl request

    - by user439407
    I am using nginx as a reverse proxy for a tomcat setup, and everything works fine for the MOST part, the only issue I am having is that every request to an http address results in a new JSESSION ID being created(this doesn't happen in http), here is the relevant part of the NGINX configuration: location / { proxy_set_header X-Forwarded-For $proxy_add_x_forwarded_for; proxy_set_header Host $http_host; proxy_set_header X-Real-IP $remote_addr; proxy_set_header X-Forwarded-Proto https; proxy_redirect off; proxy_connect_timeout 240; proxy_send_timeout 240; proxy_read_timeout 240; proxy_pass http://localhost:8080; } Any idea why I am constantly genning new jsessionids?

    Read the article

  • Cloud hosting and single hardware point of failure?

    - by PeterB
    From talking to sales I thought Rackspace Cloud was running on a SAN and compute nodes (as VMWare's offerings do), only to find out it doesn't, so when the host server goes down for maintenance all cloud servers on the server go down (in our case for 2.5 hours). I understand Amazon EC2 also has this single-server point of failure. Which cloud hosting solutions don't rely on a single server? I've yet to find a list by architecture Is there a term that distinguishes between these types of 'cloud'? Is one of these 'grid computing' and the other 'virtualisation'? Can a SAN backed solution provide the same reliability as 2 mirrored cloud servers on (say) Rackspace Cloud? I am more familiar with the VMWare architecture and would like to understand the advantages and disadvantages of each approach. I understand the standard architecture is to have multiple cloud servers and mirrored data between them; until we need multiple database servers I'm wondering if a SAN/node hosting solution would provide the lack of downtime we need without the added complexity.

    Read the article

  • CSS: Why do the border gets like this?

    - by Azzyh
    why does the border get like this, i want it around the videoclip, if i use float it do the border correctly, if i use position, then it gets like that, and i dont want to use float. #clip{ position: relative; right: 1px; border: 2px solid #FF3399; }

    Read the article

  • mac os x, find all symbolic links that point to files on a different volume

    - by Eddified
    In my ~ dir, I have some symlinks that point to "/Volumes/Macintosh HD 2/..." and I want to find them all recursively. A look at the man page for 'find' says the '-lname' argument will search the symbolic link contents. It appears to work, but not recursively: $ pwd /Users/myusername $ sudo find . -lname '/Volumes*' $ cd Documents/ $ sudo find . -lname '/Volumes*' ./Documents on Win7 ./work.rtf What's going on? How can I make this work recursively? -- The 'find' program is supposed to always work recursively. I checked perms, they look ok, but as you can see I used "sudo" just to be sure... no dice. $ ls -ld Documents/ drwx------+ 14 myusername staff 476 Jan 12 16:32 Documents/

    Read the article

  • How to connect to internet 2 or more pcs with an usb wifi adapter

    - by bhaoahd
    In one pc I have an USB Wifi adapter (Realtek RTL8187L Chipset), from there a 10 meters cable to an outdoor antenna. With that I connect to a public Access Point. Now I want to be able to connect more computers to internet using that same connection that comes from the outdoor antenna, what options do I have to do this? I do have another usb wifi adapter with a small omni antenna, and a router encore ENHWI-G/A. This router can be used as a Wifi AP, but it needs a modem that works with the RJ45 connector. Is there a way I could take internet from the outdoor antenna, and create another AP indoor using that router to "repeat" that wifi that comes from the outdoor antenna? If creating this second AP is not possible, should I use some sort of local network between computers, connect my main PC with the outdoor antenna, and share the connection through the lan? (I would really prefer to have a second AP indoor so I can connect other devices like a Palm, but I am not sure how could this be possible with this router and the usb wifi adapter)

    Read the article

  • Shortcut key to skip cursor from left/right of every typed word

    - by user176368
    I want to know if it is even possible to jump my cursor from left/right of every typed word using Vimperator, a Firefox addon that behaves like Vim, including its shortcut keys. So a good example would be: I took a marvelous dump right before bed and I so happen to sleep better.- Now if my cursor is at the end of that sentence (hence the dash) how can I jump my cursor right before the word better by just using a shortcut key? by default Ctrl+A & Ctrl+E are shortcut keys that brings your cursor to beginning/end of the current line your on.

    Read the article

  • Android: Find coordinates of a certain point X meters from my location moving towards the point I am

    - by Aidan
    Hi Guys, I'm constructing a geolocation based application and I'm trying to figure out a way to make my application realise when a user is facing the direction of the given location (a particular long / lat co-ord). I've done some Googling and checked the SDK but can't really find anything for such a thing. Does anyone know of a way? Example. Point A = Phones current location. Point B = A's orientation in relation to true north + 45 + max distance towards the direction your facing, Point C = A's orientation in relation to true north - 45 + max distance towards the direction your facing. So now you have a triangle constructed. pretty schweet huh? yeah.. I think so.. So now that I have my fancy Triangle I use something called Barycentric Coordinates ( http://en.wikipedia.org/wiki/Barycentric_coordinates_(mathematics) ). This will allow me to test another point and see if it is in the triangle. If it is, it means we're facing it AND it's within the right distance. So it should be displayed on screen. If I'm facing 90 degrees from true north. The distance it travels should be that direction. 90 degrees from true north. It should not be 100 degrees or something from true north! But the problem is I haven't yet figured out how I make the device realise it must go "out" the direction it is facing.

    Read the article

  • Deterministic floating point and .NET

    - by code2code
    How can I guarantee that floating point calculations in a .NET application (say in C#) always produce the same bit-exact result? Especially when using different versions of .NET and running on different platforms (x86 vs x86_64). Inaccuracies of floating point operations do not matter. In Java I'd use strictfp. In C/C++ and other low level languages this problem is essentially solved by accessing the FPU / SSE control registers but that's probably not possible in .NET. Even with control of the FPU control register the JIT of .NET will generate different code on different platforms. Something like HotSpot would be even worse in this case... Why do I need it? I'm thinking about writing a real-time strategy (RTS) game which heavily depends on fast floating point math together with a lock stepped simulation. Essentially I will only transmit user input across the network. This also applies to other games which implement replays by storing the user input. Not an option are: decimals (too slow) fixed point values (too slow and cumbersome when using sqrt, sin, cos, tan, atan...) update state across the network like an FPS: Sending position information for hundreds or a few thousand units is not an option Any ideas?

    Read the article

  • Restoring the Fonts folder by using a restore point

    - by ryalho
    I am an idiot. Who would have thought that installing 2 gigs of fonts would be detrimental to the boot up time for the most common design programs such as adobe illustrator. I would like to restore the font folder because I am no longer able to just delete the fonts. It takes too long. So when I right-click the fonts folder and select "Restore Previous Versions" I am able to find a restore point, but the "Restore" button is greyed out. this leads me to think that I cannot change the settings of files in the windows directory. Oh and there are 34,000 fonts I need gone. Thanks

    Read the article

  • Create my own custom ellipsis bullet point

    - by Airn5475
    I regularly use an ellipsis as a bullet point in a list of items in Word/Outlook 2010. Example: I like summer because... ... it's warm out. ... we go on vacation. ... my birthday is in July. Currently in Word/Outlook if you type certain characters like a hyphen and hit space, it will automatically start a bulleted list using the hyphen. I would really like the same functionality with the ellipsis. When I type the third period and hit space, start a bulleted list. Does anyone know of a way to do this? Registry hack? Hidden Word Setting?

    Read the article

  • VPS stops responding every now and again

    - by Or W
    I have a Linode vps that I use to host some of my websites on. It's Ubuntu based and it's up to date in terms of all packages. I don't have any cron jobs scheduled or any automatic processes. I host a few (up to date) wordpress blogs there that have very little traffic altogether. Every day (at a different time) my server stops responding, I can't SSH to it, web access is getting timed out and it just dies until I reboot it through the Linode manager. On the linode dashboard I can see that the CPU is not very high (2-3%) Incoming/Outgoing traffic is on 0 and the IO count has a spike just before the server stops responding (SWAP IO is at 2k and IO Rate is at 5k). When I reboot the server everything is just fine. I'm trying to figure out a way to analyze what's going on at these random times where the server freezes up. How can I determine the problem?

    Read the article

< Previous Page | 34 35 36 37 38 39 40 41 42 43 44 45  | Next Page >