Search Results

Search found 13683 results on 548 pages for 'python sphinx'.

Page 370/548 | < Previous Page | 366 367 368 369 370 371 372 373 374 375 376 377  | Next Page >

  • I get a 400 Bad Request error while using django-piston

    - by Cheezo
    Hello, I am trying to use Piston to provide REST support to Django. I have implemented my handlers as per the documentation provided . The problem is that i can "read" and "delete" my resource but i cannot "create" or "update". Each time i hit the relevant api i get a 400 Bad request Error. I have extended the Resource class for csrf by using this commonly available code snippet: class CsrfExemptResource(Resource): """A Custom Resource that is csrf exempt""" def init(self, handler, authentication=None): super(CsrfExemptResource, self).init(handler, authentication) self.csrf_exempt = getattr(self.handler, 'csrf_exempt', True) My class (code snippet) looks like this: user_resource = CsrfExemptResource(User) class User(BaseHandler): allowed_methods = ('GET', 'POST', 'PUT', 'DELETE') @require_extended def create(self, request): email = request.GET['email'] password = request.GET['password'] phoneNumber = request.GET['phoneNumber'] firstName = request.GET['firstName'] lastName = request.GET['lastName'] self.createNewUser(self, email,password,phoneNumber,firstName,lastName) return rc.CREATED Please let me know how can i get the create method to work using the POST operation?

    Read the article

  • Qt/PyQt dialog with toggable fullscreen mode - problem on Windows

    - by Guard
    I have a dialog created in PyQt. It's purpose and functionality don't matter. The init is: class MyDialog(QWidget, ui_module.Ui_Dialog): def __init__(self, parent=None): super(MyDialog, self).__init__(parent) self.setupUi(self) self.installEventFilter(self) self.setWindowFlags(Qt.Dialog | Qt.WindowTitleHint) self.showMaximized() Then I have event filtering method: def eventFilter(self, obj, event): if event.type() == QEvent.KeyPress: key = event.key() if key == Qt.Key_F11: if self.isFullScreen(): self.setWindowFlags(self._flags) if self._state == 'm': self.showMaximized() else: self.showNormal() self.setGeometry(self._geometry) else: self._state = 'm' if self.isMaximized() else 'n' self._flags = self.windowFlags() self._geometry = self.geometry() self.setWindowFlags(Qt.Tool | Qt.FramelessWindowHint) self.showFullScreen() return True elif key == Qt.Key_Escape: self.close() return QWidget.eventFilter(self, obj, event) As can be seen, Esc is used for dialog hiding, and F11 is used for toggling full-screen. In addition, if the user changed the dialog mode from the initial maximized to normal and possibly moved the dialog, it's state and position are restored after exiting the full-screen. Finally, the dialog is created on the MainWindow action triggered: d = MyDialog(self) d.show() It works fine on Linux (Ubuntu Lucid), but quite strange on Windows 7: if I go to the full-screen from the maximized mode, I can't exit full-screen (on F11 dialog disappears and appears in full-screen mode again. If I change the dialog's mode to Normal (by double-clicking its title), then go to full-screen and then return back, the dialog is shown in the normal mode, in the correct position, but without the title line. Most probably the reason for both cases is the same - the setWindowFlags doesn't work. But why? Is it also possible that it is the bug in the recent PyQt version? On Ubuntu I have 4.6.x from apt, and on Windows - the latest installer from the riverbank site.

    Read the article

  • How can I draw a log-normalized imshow plot with a colorbar representing the raw data in matplotlib

    - by Adam Fraser
    I'm using matplotlib to plot log-normalized images but I would like the original raw image data to be represented in the colorbar rather than the [0-1] interval. I get the feeling there's a more matplotlib'y way of doing this by using some sort of normalization object and not transforming the data beforehand... in any case, there could be negative values in the raw image. import matplotlib.pyplot as plt import numpy as np def log_transform(im): '''returns log(image) scaled to the interval [0,1]''' try: (min, max) = (im[im > 0].min(), im.max()) if (max > min) and (max > 0): return (np.log(im.clip(min, max)) - np.log(min)) / (np.log(max) - np.log(min)) except: pass return im a = np.ones((100,100)) for i in range(100): a[i] = i f = plt.figure() ax = f.add_subplot(111) res = ax.imshow(log_transform(a)) # the colorbar drawn shows [0-1], but I want to see [0-99] cb = f.colorbar(res) I've tried using cb.set_array, but that didn't appear to do anything, and cb.set_clim, but that rescales the colors completely. Thanks in advance for any help :)

    Read the article

  • split twice in the same expression?

    - by UcanDoIt
    Imagine I have the following: inFile = "/adda/adas/sdas/hello.txt" # that instruction give me hello.txt Name = inFile.name.split("/") [-1] # that one give me the name I want - just hello Name1 = Name.split(".") [0] Is there any chance to simplify that doing the same job in just one expression?

    Read the article

  • Attribute Error in django

    - by itsandy
    Hi all, I am having an attribute error while working with django-registration it says 'NoneType' object has no attribute 'strip' I dropped my db table and created again but the error doesnt go..can anyone help..

    Read the article

  • How to replace empty string with zero in comma-separated string?

    - by dsaccount1
    "8,5,,1,4,7,,,,7,,1,9,3,6,,,8,6,3,9,,2,5,4,,,,,3,2,,,7,4,1,1,,4,,6,9,,5,,,,5,,,1,,6,3,,,6,5,,,,7,4,,1,7,6,,,,8,,5,,,7,1,,3,9," I'm doing a programming challenge where i need to parse this sequence into my sudoku script. Need to get the above sequence into 8,5,0,1,4,7,0,0,0,7,0,1,9,3,6,0,0,8......... I tried re but without success, help is appreciated, thanks.

    Read the article

  • How to allow resizing of QMessageBox in PyQt4

    - by Simeon Fitch
    I'm using the nice feature in QMessageBox to optionally show detailed text to the user. However, the window after expansion is still fairly small, and one immediately tries to resize the window so more of the details are visible. Even after setting what I think are the proper settings it won't allow resizing. Here's the relevant snippet of PyQt4 code: mb = QMessageBox() mb.setText("Results written to '%s'" % filename) mb.setDetailedText(str(myData)) mb.setSizePolicy(QSizePolicy.Expanding, QSizePolicy.Expanding) mb.setSizeGripEnabled(True) Am I missing a step and/or is this at all possible?

    Read the article

  • problem with pasting image over lines in wx DC

    - by Moayyad Yaghi
    hello .. i have the same code as wx Doodle pad in the wx demos i added a tool to paste images from the clipboard to the pad. using wx.DrawBitmap() function , but whenever i refresh the buffer .and call funtions ( drawSavedLines and drawSavedBitmap) it keeps putting bitmap above line no matter what i did even if i called draw bitmap first and then draw lines . is there anyway to put a line above the bitmap ? please inform me if i miss anything thanx in advance

    Read the article

  • Obtaining references to function objects on the execution stack from the frame object?

    - by Marcin
    Given the output of inspect.stack(), is it possible to get the function objects from anywhere from the stack frame and call these? If so, how? (I already know how to get the names of the functions.) Here is what I'm getting at: Let's say I'm a function and I'm trying to determine if my caller is a generator or a regular function? I need to call inspect.isgeneratorfunction() on the function object. And how do you figure out who called you? inspect.stack(), right? So if I can somehow put those together, I'll have the answer to my question. Perhaps there is an easier way to do this?

    Read the article

  • asyncore callbacks launching threads... ok to do?

    - by sbartell
    I'm unfamiliar with asyncore, and have very limited knowledge of asynchronous programming except for a few intro to twisted tutorials. I am most familiar with threads and use them in all my apps. One particular app uses a couchdb database as its interface. This involves longpolling the db looking for changes and updates. The module I use for couchdb is couchdbkit. It uses an asyncore loop to watch for these changes and send them to a callback. So, I figure from this callback is where I launch my worker threads. It seems a bit crude to mix asynchronous and threaded programming. I really like couchdbkit, but would rather not introduce issues into my program. So, my question is, is it safe to fire threads from an async callback? Here's some code... {{{ def dispatch(change): global jobs, db_url # jobs is my queue db = Database(db_url) work_order = db.get(change['id']) # change is an id to the document that changed. # i need to get the actual document (workorder) worker = Worker(work_order, db) # fire the thread jobs.append[worker] worker.start() return main() . . . consumer.wait(cb=dispatch, since=update_seq, timeout=10000) #wait constains the asyncloop. }}}

    Read the article

  • Prepopulate drop-box according to another drop-box choice in Django Admin

    - by onorua
    I have models like this: class User(models.Model): Switch = models.ForeignKey(Switch, related_name='SwitchUsers') Port = models.ForeignKey(Port) class Switch(models.Model): Name = models.CharField(max_length=50) class Port(models.Model): PortNum = models.PositiveIntegerField() Switch = models.ForeignKey(Switch, related_name = "Ports") When I'm in Admin interface and choose Switch from Switches available, I would like to have Port prepopulated accordingly with Ports from the related Switch. As far as I understand I need to create some JS script to prepopulate it. Unfortunately I don't have this experience, and I would like to keep things simple as it possible and don't rewrite all Django admin interface. Just add this functionality for one Field. Could you please help me with my problem? Thank you.

    Read the article

  • Simple pygtk and threads example please.

    - by wtzolt
    Hello, Can someone give me a simple example involving threads in this manner, please. Problem with my code is that when I click button One, GUI freezes until its finished. I want buttons to stay responsive when def is being executed. How can i fix that? class fun: wTree = None def __init__( self ): self.wTree = gtk.glade.XML( "ui.glade" ) dic = { "on_buttonOne" : self.one, "on_buttonTwo" : self.two, } self.wTree.signal_autoconnect( dic ) gtk.main() def sone(self, widget): time.sleep(1) print "1" time.sleep(1) print "2" time.sleep(1) print "3" def stwo(self, widget): time.sleep(1) print "4" time.sleep(1) print "5" time.sleep(1) print "6" do=fun() Pretty please, help me.

    Read the article

  • How can I lookup an attribute in any scope by name?

    - by Wai Yip Tung
    How can I lookup an attribute in any scope by name? My first trial is to use globals() and locals(). e.g. >>> def foo(name): ... a=1 ... print globals().get(name), locals().get(name) ... >>> foo('a') None 1 >>> b=1 >>> foo('b') 1 None >>> foo('foo') <function foo at 0x014744B0> None So far so good. However it fails to lookup any built-in names. >>> range <built-in function range> >>> foo('range') None None >>> int <type 'int'> >>> foo('int') None None Any idea on how to lookup built-in attributes?

    Read the article

  • redefine __and__ operator

    - by wiso
    Why I can't redefine the __and__ operator? class Cut(object): def __init__(self, cut): self.cut = cut def __and__(self, other): return Cut("(" + self.cut + ") && (" + other.cut + ")") a = Cut("a>0") b = cut("b>0") c = a and b print c.cut() I want (a>0) && (b>0), but I got b, that the usual behaviour of and

    Read the article

  • CherryPy and RESTful web api

    - by hyperboreean
    What's the best approach of creating a RESTful web api in CherryPy? I've been looking around for a few days now and nothing seems great. For Django it seems that are lots of tools to do this, but not for CherryPy or I am not aware of them

    Read the article

  • Raising events and object persistence in Django

    - by Mridang Agarwalla
    Hi, I have a tricky Django problem which didn't occur to me when I was developing it. My Django application allows a user to sign up and store his login credentials for a sites. The Django application basically allows the user to search this other site (by scraping content off it) and returns the result to the user. For each query, it does a couple of queries of the other site. This seemed to work fine but sometimes, the other site slaps me with a CAPTCHA. I've written the code to get the CAPTCHA image and I need to return this to the user so he can type it in but I don't know how. My search request (the query, the username and the password) in my Django application gets passed to a view which in turn calls the backend that does the scraping/search. When a CAPTCHA is detected, I'd like to raise a client side event or something on those lines and display the CAPTCHA to the user and wait for the user's input so that I can resume my search. I would somehow need to persist my backend object between calls. I've tried pickling it but it doesn't work because I get the Can't pickle 'lock' object error. I don't know to implement this though. Any help/ideas? Thanks a ton.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

< Previous Page | 366 367 368 369 370 371 372 373 374 375 376 377  | Next Page >