Search Results

Search found 14399 results on 576 pages for 'python noob'.

Page 372/576 | < Previous Page | 368 369 370 371 372 373 374 375 376 377 378 379  | Next Page >

  • Programmatically sync the db in Django

    - by Attila Oláh
    I'm trying to sync my db from a view, something like this: from django import http from django.core import management def syncdb(request): management.call_command('syncdb') return http.HttpResponse('Database synced.') The issue is, it will block the dev server by asking for user input from the terminal. How can I pass it the '--noinput' option to prevent asking me anything? I have other ways of marking users as super-user, so there's no need for the user input, but I really need to call syncdb (and flush) programmatically, without logging on to the server via ssh. Any help is appreciated.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Django: Geocoding an address on form submission?

    - by User
    Trying to wrap my head around django forms and the django way of doing things. I want to create a basic web form that allows a user to input an address and have that address geocoded and saved to a database. I created a Location model: class Location(models.Model): address = models.CharField(max_length=200) city = models.CharField(max_length=100) state = models.CharField(max_length=100, null=True) postal_code = models.CharField(max_length=100, null=True) country = models.CharField(max_length=100) latitude = models.DecimalField(max_digits=18, decimal_places=10, null=True) longitude = models.DecimalField(max_digits=18, decimal_places=10, null=True) And defined a form: class LocationForm(forms.ModelForm): class Meta: model = models.Location exclude = ('latitude','longitude') In my view I'm using form.save() to save the form. This works and saves an address to the database. I created a module to geocode an address. I'm not sure what the django way of doing things is, but I guess in my view, before I save the form, I need to geocode the address and set the lat and long. How do I set the latitude and longitude before saving?

    Read the article

  • Tkinter Packing Strangeness: Buttons packed above others

    - by Parand
    I'm sure I'm doing something obvious wrong here, but I can't see it. I end up with the "Should be on top" label packed at the bottom instead of at the top. What am I doing wrong? from Tkinter import * class SelectAction(Frame): buttons = {} def callback(self): print "Callback" def createWidgets(self): logo_label = Label(text="Should be on top").pack(fill=X) for name, text, callback in ( ('setup_account', 'Account Settings', self.callback), ('do_action', 'Do Something', self.callback), ): self.buttons[name] = Button(self, text=text, command=callback).pack(fill=X) def __init__(self, master=None): Frame.__init__(self, master) self.pack() self.createWidgets() if __name__ == "__main__": root = Tk() app = SelectAction(master=root) app.mainloop() root.destroy()

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Error handling in the RequestHandler without embedding in URI

    - by hyn
    When a user sends a filled form, I want to print an error message in case there is an input error. One of the GAE sample codes does this by embedding the error message in the URI. Inside the form handler (get): self.redirect('/compose?error_message=%s' % message) and in the handler (get) of redirected URI, gets the message from request: values = { 'error_message': self.request.get('error_message'), ... Is there a way to accomplish the same without embedding the message in the URI?

    Read the article

  • How to reload Django models without losing my locals in an interactive session?

    - by Gj
    I'm doing some research with an interactive shell and using a Django app (shell_plus) for storing data and browsing it using the convenient admin. Occasionally I add or change some of the app models, and run a syncdb (or South migration when changing a model). The changes to the models don't take effect in my interactive session even if I re-import the app models. Thus I'm forced to restart the shell_plus and lose my precious locals() in the process. Is there any way to reload the models during a session? Thanks!!

    Read the article

  • how to fill a part of a circle using PIL?

    - by valya
    hello. I'm trying to use PIL for a task but the result is very dirty. What I'm doing is trying to fill a part of a piece of a circle, as you can see on the image. Here is my code: def gen_image(values): side = 568 margin = 47 image = Image.open(settings.MEDIA_ROOT + "/i/promo_circle.jpg") draw = ImageDraw.Draw(image) draw.ellipse((margin, margin, side-margin, side-margin), outline="white") center = side/2 r = side/2 - margin cnt = len(values) for n in xrange(cnt): angle = n*(360.0/cnt) - 90 next_angle = (n+1)*(360.0/cnt) - 90 nr = (r * values[n] / 5) max_r = r min_r = nr for cr in xrange(min_r*10, max_r*10): cr = cr/10.0 draw.arc((side/2-cr, side/2-cr, side/2+cr, side/2+cr), angle, next_angle, fill="white") return image

    Read the article

  • Is there a way to control how pytest-xdist runs tests in parallel?

    - by superselector
    I have the following directory layout: runner.py lib/ tests/ testsuite1/ testsuite1.py testsuite2/ testsuite2.py testsuite3/ testsuite3.py testsuite4/ testsuite4.py The format of testsuite*.py modules is as follows: import pytest class testsomething: def setup_class(self): ''' do some setup ''' # Do some setup stuff here def teardown_class(self): '''' do some teardown''' # Do some teardown stuff here def test1(self): # Do some test1 related stuff def test2(self): # Do some test2 related stuff .... .... .... def test40(self): # Do some test40 related stuff if __name__=='__main()__' pytest.main(args=[os.path.abspath(__file__)]) The problem I have is that I would like to execute the 'testsuites' in parallel i.e. I want testsuite1, testsuite2, testsuite3 and testsuite4 to start execution in parallel but individual tests within the testsuites need to be executed serially. When I use the 'xdist' plugin from py.test and kick off the tests using 'py.test -n 4', py.test is gathering all the tests and randomly load balancing the tests among 4 workers. This leads to the 'setup_class' method to be executed every time of each test within a 'testsuitex.py' module (which defeats my purpose. I want setup_class to be executed only once per class and tests executed serially there after). Essentially what I want the execution to look like is: worker1: executes all tests in testsuite1.py serially worker2: executes all tests in testsuite2.py serially worker3: executes all tests in testsuite3.py serially worker4: executes all tests in testsuite4.py serially while worker1, worker2, worker3 and worker4 are all executed in parallel. Is there a way to achieve this in 'pytest-xidst' framework? The only option that I can think of is to kick off different processes to execute each test suite individually within runner.py: def test_execute_func(testsuite_path): subprocess.process('py.test %s' % testsuite_path) if __name__=='__main__': #Gather all the testsuite names for each testsuite: multiprocessing.Process(test_execute_func,(testsuite_path,))

    Read the article

  • django on appengine

    - by aks
    I am impressed with django.Am am currenty a java developer.I want to make some cool websites for myself but i want to host it in some third pary environmet. Now the question is can i host the django application on appengine?If yes , how?? Are there any site built using django which are already hosted on appengine?

    Read the article

  • SQLAlchemy declarative syntax with autoload in Pylons

    - by Juliusz Gonera
    I would like to use autoload to use an existings database. I know how to do it without declarative syntax (model/_init_.py): def init_model(engine): """Call me before using any of the tables or classes in the model""" t_events = Table('events', Base.metadata, schema='events', autoload=True, autoload_with=engine) orm.mapper(Event, t_events) Session.configure(bind=engine) class Event(object): pass This works fine, but I would like to use declarative syntax: class Event(Base): __tablename__ = 'events' __table_args__ = {'schema': 'events', 'autoload': True} Unfortunately, this way I get: sqlalchemy.exc.UnboundExecutionError: No engine is bound to this Table's MetaData. Pass an engine to the Table via autoload_with=<someengine>, or associate the MetaData with an engine via metadata.bind=<someengine> The problem here is that I don't know where to get the engine from (to use it in autoload_with) at the stage of importing the model (it's available in init_model()). I tried adding meta.Base.metadata.bind(engine) to environment.py but it doesn't work. Anyone has found some elegant solution?

    Read the article

  • Sqlalchemy complex in_ clause

    - by lostlogic
    I'm trying to find a way to cause sqlalchemy to generate sql of the following form: select * from t where (a,b) in ((a1,b1),(a2,b2)); Is this possible? If not, any suggestions on a way to emulate it? Thanks kindly!

    Read the article

  • What is the Simplest Possible Payment Gateway to Implement? (using Django)

    - by b14ck
    I'm developing a web application that will require users to either make one time deposits of money into their account, or allow users to sign up for recurring billing each month for a certain amount of money. I've been looking at various payment gateways, but most (if not all) of them seem complex and difficult to get working. I also see no real active Django projects which offer simple views for making payments. Ideally, I'd like to use something like Amazon FPS, so that I can see online transaction logs, refund money, etc., but I'm open to other things. I just want the EASIEST possible payment gateway to integrate with my site. I'm not looking for anything fancy, whatever does the job, and requires < 10 hours to get working from start to finish would be perfect. I'll give answer points to whoever can point out a good one. Thanks!

    Read the article

  • How do i add a new object with suds?

    - by Jerome
    I'm trying to use suds but have so far been unsuccessful at figuring this out. Hopefully it's something simple that i'm missing. Any help would be highly appreciated. This is supposed to be the raw soap message that i need to achieve: <soapenv:Envelope xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/" xmlns:api="http://api.service.apimember.soapservice.com/"> <soapenv:Header/> <soapenv:Body> <api:insertOrUpdateMemberByObj> <token>t67GFCygjhkjyUy8y9hkjhlkjhuii</token> <member> <dynContent> <entry> <key>FIRSTNAME</key> <value>hhhhbbbbb</value> </entry> </dynContent> <email>[email protected]</email> </member> </api:insertOrUpdateMemberByObj> </soapenv:Body> </soapenv:Envelope> So i use suds to create the member object: member = client.factory.create('member') produces: (apiMember){ attributes = (attributes){ entry[] = <empty> } } How exactly do i append an 'entry'? I try this: member.attributes.entry.append({'key':'FIRSTNAME','value':'test'}) and that produces this: (apiMember){ attributes = (attributes){ entry[] = { value = "test" key = "FIRSTNAME" }, } } However, what i actually need is: (apiMember){ attributes = (attributes){ entry[] = (entry) { value = "test" key = "FIRSTNAME" }, } } How do i achieve this?

    Read the article

  • Ternary operator

    - by Antoine Leclair
    In PHP, I often use the ternary operator to add an attribute to an html element if it applies to the element in question. For example: <select name="blah"> <option value="1"<?= $blah == 1 ? ' selected="selected"' : '' ?>> One </option> <option value="2"<?= $blah == 2 ? ' selected="selected"' : '' ?>> Two </option> </select> I'm starting a project with Pylons using Mako for the templating. How can I achieve something similar? Right now, I see two possibilities that are not ideal. Solution 1: <select name="blah"> % if blah == 1: <option value="1" selected="selected">One</option> % else: <option value="1">One</option> % endif % if blah == 2: <option value="2" selected="selected">Two</option> % else: <option value="2">Two</option> % endif </select> Solution 2: <select name="blah"> <option value="1" % if blah == 1: selected="selected" % endif >One</option> <option value="2" % if blah == 2: selected="selected" % endif >Two</option> </select> In this particular case, the value is equal to the variable tested (value="1" = blah == 1), but I use the same pattern in other situations, like <?= isset($variable) ? ' value="$variable" : '' ?>. I am looking for a clean way to achieve this using Mako.

    Read the article

  • Getting unpredictable data into a tabular format

    - by Acorn
    The situation: Each page I scrape has <input> elements with a title= and a value= I don't know what is going to be on the page. I want to have all my collected data in a single table at the end, with a column for each title. So basically, I need each row of data to line up with all the others, and if a row doesn't have a certain element, then it should be blank (but there must be something there to keep the alignment). eg. First page has: {animal: cat, colour: blue, fruit: lemon, day: monday} Second page has: {animal: fish, colour: green, day: saturday} Third page has: {animal: dog, number: 10, colour: yellow, fruit: mango, day: tuesday} Then my resulting table should be: animal | number | colour | fruit | day cat | none | blue | lemon | monday fish | none | green | none | saturday dog | 10 | yellow | mango | tuesday Although it would be good to keep the order of the title value pairs, which I know dictionaries wont do. So basically, I need to generate columns from all the titles (kept in order but somehow merged together) What would be the best way of going about this without knowing all the possible titles and explicitly specifying an order for the values to be put in?

    Read the article

  • How to repeatedly show a Dialog with PyGTK / Gtkbuilder?

    - by Julian
    I have created a PyGTK application that shows a Dialog when the user presses a button. The dialog is loaded in my __init__ method with: builder = gtk.Builder() builder.add_from_file("filename") builder.connect_signals(self) self.myDialog = builder.get_object("dialog_name") In the event handler, the dialog is shown with the command self.myDialog.run(), but this only works once, because after run() the dialog is automatically destroyed. If I click the button a second time, the application crashes. I read that there is a way to use show() instead of run() where the dialog is not destroyed, but I feel like this is not the right way for me because I would like the dialog to behave modally and to return control to the code only after the user has closed it. Is there a simple way to repeatedly show a dialog using the run() method using gtkbuilder? I tried reloading the whole dialog using the gtkbuilder, but that did not really seem to work, the dialog was missing all child elements (and I would prefer to have to use the builder only once, at the beginning of the program). [SOLUTION] As pointed out by the answer below, using hide() does the trick. But one has to take care that the dialog is in fact destroyed if one does not catch its "delete-event". A simple example that works is: import pygtk import gtk class DialogTest: def rundialog(self, widget, data=None): self.dia.show_all() result = self.dia.run() def destroy(self, widget, data=None): gtk.main_quit() def closedialog(self, widget, data=None): self.dia.hide() return True def __init__(self): self.window = gtk.Window(gtk.WINDOW_TOPLEVEL) self.window.connect("destroy", self.destroy) self.dia = gtk.Dialog('TEST DIALOG', self.window, gtk.DIALOG_MODAL | gtk.DIALOG_DESTROY_WITH_PARENT) self.dia.vbox.pack_start(gtk.Label('This is just a Test')) self.dia.connect("delete-event", self.closedialog) self.button = gtk.Button("Run Dialog") self.button.connect("clicked", self.rundialog, None) self.window.add(self.button) self.button.show() self.window.show() if __name__ == "__main__": testApp = DialogTest() gtk.main()

    Read the article

  • how to speed up the code??

    - by kaushik
    in my program i have a method which requires about 4 files to be open each time it is called,as i require to take some data.all this data from the file i have been storing in list for manupalation. I approximatily need to call this method about 10,000 times.which is making my program very slow? any method for handling this files in a better ways and is storing the whole data in list time consuming what is better alternatives for list? I can give some code,but my previous question was closed as that only confused everyone as it is a part of big program and need to be explained completely to understand,so i am not giving any code,please suggest ways thinking this as a general question... thanks in advance

    Read the article

  • how to speed up the code??

    - by kaushik
    i have very huge code about 600 lines plus. cant post the whole thing here. but a particular code snippet is taking so much time,leading to problems. here i post that part of code please tell me what to do speed up the processing.. please suggest the part which may be the reason and measure to improve them if this small part of code is understandable. using_data={} def join_cost(a , b): global using_data #print a #print b save_a=[] save_b=[] print 1 #for i in range(len(m)): #if str(m[i][0])==str(a): save_a=database_index[a] #for i in range(len(m)): # if str(m[i][0])==str(b): #print 'save_a',save_a #print 'save_b',save_b print 2 save_b=database_index[b] using_data[save_a[0]]=save_a s=str(save_a[1]).replace('phone','text') s=str(s)+'.pm' p=os.path.join("c:/begpython/wavnk/",s) x=open(p , 'r') print 3 for i in range(6): x.readline() k2='a' j=0 o=[] while k2 is not '': k2=x.readline() k2=k2.rstrip('\n') oj=k2.split(' ') o=o+[oj] #print o[j] j=j+1 #print j #print o[2][0] temp=long(1232332) end_time=save_a[4] #print end_time k=(j-1) for i in range(k): diff=float(o[i][0])-float(end_time) if diff<0: diff=diff*(-1) if temp>diff: temp=diff pm_row=i #print pm_row #print temp #print o[pm_row] #pm_row=3 q=[] print 4 l=str(p).replace('.pm','.mcep') z=open(l ,'r') for i in range(pm_row): z.readline() k3=z.readline() k3=k3.rstrip('\n') q=k3.split(' ') #print q print 5 s=str(save_b[1]).replace('phone','text') s=str(s)+'.pm' p=os.path.join("c:/begpython/wavnk/",s) x=open(p , 'r') for i in range(6): x.readline() k2='a' j=0 o=[] while k2 is not '': k2=x.readline() k2=k2.rstrip('\n') oj=k2.split(' ') o=o+[oj] #print o[j] j=j+1 #print j #print o[2][0] temp=long(1232332) strt_time=save_b[3] #print strt_time k=(j-1) for i in range(k): diff=float(o[i][0])-float(strt_time) if diff<0: diff=diff*(-1) if temp>diff: temp=diff pm_row=i #print pm_row #print temp #print o[pm_row] #pm_row=3 w=[] l=str(p).replace('.pm','.mcep') z=open(l ,'r') for i in range(pm_row): z.readline() k3=z.readline() k3=k3.rstrip('\n') w=k3.split(' ') #print w cost=0 for i in range(12): #print q[i] #print w[i] h=float(q[i])-float(w[i]) cost=cost+math.pow(h,2) j_cost=math.sqrt(cost) #print cost return j_cost def target_cost(a , b): a=(b+1)*3 b=(a+1)*2 t_cost=(a+b)*5/2 return t_cost r1='shht:ra_77' r2='grx_18' g=[] nodes=[] nodes=nodes+[[r1]] for i in range(len(y_in_db_format)): g=y_in_db_format[i] #print g #print g[0] g.remove(str(g[0])) nodes=nodes+[g] nodes=nodes+[[r2]] print nodes print "lenght of nodes",len(nodes) lists=[] #lists=lists+[r1] for i in range(len(nodes)): for j in range(len(nodes[i])): lists=lists+[nodes[i][j]] #lists=lists+[r2] print lists distance={} for i in range(len(lists)): if i==0: distance[str(lists[i])]=0 else: distance[str(lists[i])]=long(123231223) #print distance group_dist=[] infinity=long(123232323) for i in range(len(nodes)): distances=[] for j in range(len(nodes[i])): #distances=[] if i==0: distances=distances+[[nodes[i][j], 0]] else: distances=distances+[[nodes[i][j],infinity]] group_dist=group_dist+[distances] #print distances print "group_distances",group_dist #print "check",group_dist[0][0][1] #costs={} #for i in range(len(lists)): #if i==0: # costs[str(lists[i])]=1 #else: # costs[str(lists[i])]=get_selfcost(lists[i]) path=[] for i in range(len(nodes)): mini=[] if i!=(len(nodes)-1): #temp=long(123234324) #Now calculate the cost between the current node and each of its neighbour for k in range(len(nodes[(i+1)])): for j in range(len(nodes[i])): current=nodes[i][j] #print "current_node",current j_distance=join_cost( current , nodes[i+1][k]) #t_distance=target_cost( current , nodes[i+1][k]) t_distance=34 #print distance #print "distance between current and neighbours",distance total_distance=(.5*(float(group_dist[i][j][1])+float(j_distance))+.5*(float(t_distance))) #print "total distance between the intial_nodes and current neighbour",total_distance if int(group_dist[i+1][k][1]) > int(total_distance): group_dist[i+1][k][1]=total_distance #print "updated distance",group_dist[i+1][k][1] a=current #print "the neighbour",nodes[i+1][k],"updated the value",a mini=mini+[[str(nodes[i+1][k]),a]] print mini

    Read the article

  • SUDS rendering a duplicate node and wrapping everything in it

    - by PylonsN00b
    Here is my code: #Make the SOAP connection url = "https://api.channeladvisor.com/ChannelAdvisorAPI/v1/InventoryService.asmx?WSDL" headers = {'Content-Type': 'text/xml; charset=utf-8'} ca_client_inventory = Client(url, location="https://api.channeladvisor.com/ChannelAdvisorAPI/v1/InventoryService.asmx", headers=headers) #Make the SOAP headers login = ca_client_inventory.factory.create('APICredentials') login.DeveloperKey = 'REMOVED' login.Password = 'REMOVED' #Attach the headers ca_client_inventory.set_options(soapheaders=login) synch_inventory_item_list = ca_client_inventory.factory.create('SynchInventoryItemList') synch_inventory_item_list.accountID = "REMOVED" array_of_inventory_item_submit = ca_client_inventory.factory.create('ArrayOfInventoryItemSubmit') for product in products: inventory_item_submit = ca_client_inventory.factory.create('InventoryItemSubmit') inventory_item_list = get_item_list(product) inventory_item_submit = [inventory_item_list] array_of_inventory_item_submit.InventoryItemSubmit.append(inventory_item_submit) synch_inventory_item_list.itemList = array_of_inventory_item_submit #Call that service baby! ca_client_inventory.service.SynchInventoryItemList(synch_inventory_item_list) Here is what it outputs: <?xml version="1.0" encoding="UTF-8"?> <SOAP-ENV:Envelope xmlns:ns0="http://api.channeladvisor.com/webservices/" xmlns:ns1="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:tns="http://api.channeladvisor.com/webservices/" xmlns:SOAP-ENV="http://schemas.xmlsoap.org/soap/envelope/"> <SOAP-ENV:Header> <tns:APICredentials> <tns:DeveloperKey>REMOVED</tns:DeveloperKey> <tns:Password>REMOVED</tns:Password> </tns:APICredentials> </SOAP-ENV:Header> <ns1:Body> <ns0:SynchInventoryItemList> <ns0:accountID> <ns0:accountID>REMOVED</ns0:accountID> <ns0:itemList> <ns0:InventoryItemSubmit> <ns0:Sku>1872</ns0:Sku> <ns0:Title>The Big Book Of Crazy Quilt Stitches</ns0:Title> <ns0:Subtitle></ns0:Subtitle> <ns0:Description>Embellish the seams and patches of crazy quilt projects with over 75 embroidery stitches and floral motifs. You&apos;ll use this handy reference book again and again to dress up wall hangings, pillows, sachets, clothing, and other nostalgic creations.</ns0:Description> <ns0:Weight>4</ns0:Weight> <ns0:FlagStyle/> <ns0:IsBlocked xsi:nil="true"/> <ns0:ISBN></ns0:ISBN> <ns0:UPC>028906018721</ns0:UPC> <ns0:EAN></ns0:EAN> <ns0:QuantityInfo> <ns0:UpdateType>UnShipped</ns0:UpdateType> <ns0:Total>0</ns0:Total> </ns0:QuantityInfo> <ns0:PriceInfo> <ns0:Cost>0.575</ns0:Cost> <ns0:RetailPrice xsi:nil="true"/> <ns0:StartingPrice xsi:nil="true"/> <ns0:ReservePrice xsi:nil="true"/> <ns0:TakeItPrice>6.95</ns0:TakeItPrice> <ns0:SecondChanceOfferPrice xsi:nil="true"/> <ns0:StorePrice>6.95</ns0:StorePrice> </ns0:PriceInfo> <ns0:ClassificationInfo> <ns0:Name>Books</ns0:Name> <ns0:AttributeList> <ns0:ClassificationAttributeInfo> <ns0:Name>Designer/Author</ns0:Name> <ns0:Value>Patricia Eaton</ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Trim Size</ns0:Name> <ns0:Value></ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Binding</ns0:Name> <ns0:Value>Leaflet</ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Release Date</ns0:Name> <ns0:Value>11/1/1999 0:00:00</ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Skill Level</ns0:Name> <ns0:Value></ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Pages</ns0:Name> <ns0:Value>20</ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Projects</ns0:Name> <ns0:Value></ns0:Value> </ns0:ClassificationAttributeInfo> </ns0:AttributeList> </ns0:ClassificationInfo> <ns0:ImageList> <ns0:ImageInfoSubmit> <ns0:PlacementName>ITEMIMAGEURL1</ns0:PlacementName> <ns0:FilenameOrUrl>1872.jpg</ns0:FilenameOrUrl> </ns0:ImageInfoSubmit> </ns0:ImageList> </ns0:InventoryItemSubmit> </ns0:itemList> </ns0:accountID> </ns0:SynchInventoryItemList> </ns1:Body> </SOAP-ENV:Envelope> See how it creates the accountID node twice and wraps the whole thing in it? WHY? How do I make it stop that?!

    Read the article

< Previous Page | 368 369 370 371 372 373 374 375 376 377 378 379  | Next Page >