Search Results

Search found 14236 results on 570 pages for 'times square'.

Page 378/570 | < Previous Page | 374 375 376 377 378 379 380 381 382 383 384 385  | Next Page >

  • Building a custom iterator.

    - by Isai
    I am making this class which is a custom Map based off a hash map. I have an add method where if you add an object the object will be the key, and its value will be 1 if the object is not currently in the list. However if you add object that is currently in the list its value will be bumped up by 1. So if I added 10 strings which were all the same, the key would be that string and the value will be 10. I understand in practice when I iterate through the map, there is actually only one object to iterate, however, I am trying to create a inner class that will define an iterator that will iterate the same object however many times its value is. I can do this by simply using for loops to construct an appropriate ArrayList and just create an iterator for that, but that is too inefficient. Is there an easy or more efficient way of doing this?

    Read the article

  • DirectX into Bitmap

    - by G. St.
    Hi, I want to develope a graphicintensive application. It should be hardwareaccelerated with DirectX. Also it must looking good, so I use a LayeredWindow for nice shadoweffects. But now I have a big problem, because I cannot draw with DX on a LayeredWindow. So I search for a possibility to render with DX into a bitmap, so I can use it for the layeredwindow. I found a way to get a stream of the rendersurface, but this brings up my processor to 100%, because I must render the layeredwindow up to 75 times per second. Thank you, if you can help me, or you know a better way to draw with DirectX a Window with unregular Border and Shadows.

    Read the article

  • Export from a standalone database to an embedded database.

    - by jdana
    I have a two-part application, where there is a central database that is edited, and then at certain times, the data is released and distributed as its own application. I would like to use a standalone database for the central database (MySQL, Postgres, Oracle, SQL Server, etc.) and then have a reliable export to an embedded database (probably SQLite) for distribution. What tools/processes are available for such an export, or is it a practice to be avoided? EDIT: A couple of additional pieces of information. The distributed application should be able to run without having to connect to another server (ex: your spellchecker still works even you don't have internet), and I don't want to install a full DB server for read-only access to the data.

    Read the article

  • replace \n and \r\n with <br /> in java

    - by Bala R
    This has been asked several times for several languages but I can't get it to work. I have a string like this String str = "This is a string.\nThis is a long string."; And I'm trying to replace the \n with <br /> using str = str.replaceAll("(\r\n|\n)", "<br />"); but the \n is not getting replaced. I tried to use this RegEx Tool to verify and I see the same result. The input string does not have a match for "(\r\n|\n)". What am i doing wrong ?

    Read the article

  • Python performance profiling (file close)

    - by user1853986
    First of all thanks for your attention. My question is how to reduce the execution time of my code. Here is the relevant code. The below code is called in iteration from the main. def call_prism(prism_input_file,random_length): prism_output_file = "path.txt" cmd = "prism %s -simpath %d %s" % (prism_input_file,random_length,prism_output_file) p = os.popen(cmd) p.close() return prism_output_file def main(prism_input_file, number_of_strings): ... for n in range(number_of_strings): prism_output_file = call_prism(prism_input_file,z[n]) ... return I used statistics from the "profile statistics browser" when I profiled my code. The "file close" system command took the maximum time (14.546 seconds). The call_prism routine is called 10 times. But the number_of_strings is usually in thousands, so, my program takes lot of time to complete. Let me know if you need more information. By the way I tried with subprocess, too. Thanks.

    Read the article

  • How do I write a Guice Provider that doesn't explicitly create objects?

    - by ripper234
    Say I have a ClassWithManyDependencies. I want to write a Guice Provider for this class, in order to create a fresh instance of the class several times in my program (another class will depend on this Provider and use it at several points to create new instances). One way to achieve this is by having the Provider depend on all the dependencies of ClassWithManyDependencies. This is quite ugly. Is there a better way to achieve this? Note - I certainly don't want the Provider to depend on the injector. Another option I considered is having ClassWithManyDependencies and ClassWithManyDependenciesProvider extend the same base class, but it's butt ugly.

    Read the article

  • Regular Expression repetition of class

    - by codersarepeople
    I am trying to figure out a regular expression for the following: <tr class="A">.*</tr><tr class="(B|C)">.*</tr> Now The second tr class will repeat an unknown number of times, with something unknown in between repetitions, but simply putting it in parentheses and added a plus doesn't work. Here's the PHP code that didn't work: $pattern = '/<tr\ class=\"A\">.*(<tr\ class=\"(B|C)\">.*<\/tr>.*)+/'; preg_match_all($pattern,$playerHtml,$scores); But it only returns the first Here's an example of something that should match: <tr class="A">blah</tr>blah <tr class="B">blah</tr>blah <tr class="B">blah</tr>blah <tr class="C">blah</tr> This only matches blahblahblah

    Read the article

  • Duplicate records

    - by czuroski
    Hello, I am using nHibernate for db persistence. I have a one-to-many relationship defined between 2 tables. When I query and try to get data, I am getting the correct number of rows from the "many" table, but the rows are duplicates of the first row returned. table1 (one), table2 (many). I create a criteria query to get a certain record from table1. I then expect to get all associated records from table2. ie, table1 holds orders, table2 holds items. I query table1 to get an order which has 4 items. I expect to see each of those 4 items from table2, but all I am seeing is the 1st item repeated 4 times. Does anyone have any idea what might be happening?

    Read the article

  • iPad: How can I implement a scrolling timeline using a static image?

    - by BeachRunnerJoe
    I'm diving into iOS development and I'm building a simple timeline app using a static timeline image that I already have. The timeline image won't fit on the screen. The width of the image is about five times the width of the iPad screen, so I have to allow the user to scroll the image horizontally. Here's a mockup... For each item on the timeline, the user can tap it to receive a description at the bottom of the screen. My questions are... I was planning to use a UIScrollView with a PageControl at the bottom. Can a UIScrollView hold a single view that holds the entire timeline image or do I have to break the the timeline image up into multiple views? Are there any performance issues I need to consider when implementing this with a UIScrolLView, using a static image? Are there other approaches to implementing this scrollable timeline that I should consider other than using a UIScrollView? Thanks so much in advance for your wisdom!

    Read the article

  • what to use for repetitive (daily, weekly, monthly) tasks ? Workflows, Windows Services, something e

    - by mare
    I've been writing Windows Services for a while and they always seem to work fine for things that need to run every day, few times a week, once a month, etc. but I've been lately thinking about going with Windows Workflow Foundation. However, I am unsure how would they run on a server without some container application (for instance SharePoint)? I worked with Sharepoint workflows before and I always had huge problems, at first with the bugs in the workflow architecture implementation (the problems with sleep and delay) and later when they eventually started to work, they were difficult to manage and change. On the other hand Windows Services were always quite easy to implement, easy to create a setup for them and install them and they were always quite resilient (they were often working for months without crashing or something else going wrong). What do you recommend? Please bear in mind we are working in .NET (version is of no problem, if 4.0 brings something new on this subject, we can use it).

    Read the article

  • MediaWiki : is it possible to add an edit link in a template?

    - by leo
    I have a template on my wiki, kind of a box template. Then, there is this page where I use it several times. Can I add an edit link to each of the boxes so I don't have to edit the whole page in order to modify one of the boxes? The boxes contain only text, not other templates. Thanks! Edit: Actually there's an easier way to ask my question: Let's say I have a page without sections defined (namely without == titles ==): content A content B content C Is there a way to open an edit form only for content B?

    Read the article

  • Mootools event leak

    - by user572263
    The example to demonstrate the issue can be found here: link text The test shows a basic Mootools class that contains an element variable with a click event attached. There’s also a “cleanup” function to remove the event and nullify the element variable. My problem is that when I loop a thousand times to create the “LeakClass” instance and clean it up, it causes a major memory leak like there’s no tomorrow. I tested this on IE8 and Chrome. On the other hand what I’ve noticed is that if I comment out the line that adds the “click” event, the code doesn’t leak. Can somebody please help me structure the class/event in a manner that it doesn’t leak. Thanks in advance.

    Read the article

  • Seasonal Pricing for a Hotel Room

    - by Laykes
    I am trying to manage seasonal prices for hotel rooms. The only way that I can think of doing it would be to use: | DayDate |EndDate | A | B ----------------------------------------------- | 2010/07/1 |2010/07/2 | 200 | 40 | 2010/07/3 |2010/07/4 | 150 | 40 | 2010/07/5 |2010/07/5 | 150 | 50 | 2010/07/6 |2010/07/7 | 200 | 50 | 2010/07/8 |2010/07/9 | 100 | 60 etc.. (table taken from another question). The problem is: I don't want my seasons to be year specific. Seasons for rooms shouldn't change year on year. I don't want my users to have to enter the seasonal information several times. I am also going to have thousands of rooms, so I don't know a way to make this easily manageable. I'm using mysql and php.

    Read the article

  • Singleton pattern with Web application, Not a good idea!!

    - by Tony
    Hi I found something funny, I notice it by luck while I was debugging other thing. I was applying MCP pattern and I made a singleton controller to be shared among all presentations. Suddenly I figured out that some event is called once at first postback, twice if there is two postback, 100 times if there is 100 postbacks. because Singleton is based on a static variable which hold the instance, and the static variable live across postbacks, and I wired the event assuming that it will be wired once, and rewired for each postback. I think we should think twice before applying a singleton in a web application, or I miss something?? thanks

    Read the article

  • Persistent UDP sessions on Android

    - by Wedgeski
    I have a client-server app which requires me to maintain a persistent session over UDP. The goal is to maintain a path from the server to the mobile Android device no matter what route it has to the internet (WiFi or mobile network). This is achieved using a proprietary, well-tested session-management protocol over UDP. I need the phone to be able to maintain, say, a five-minute keep-alive with the server at all times. Ideally I would like to do this without maintaining any wake-locks on the device. I don't want the screen to light up every time I send a UDP to the server, for example, and I don't want to have a damaging effect on battery usage. Has anyone addressed this problem?

    Read the article

  • pthread_exit return value

    - by Manty
    This is surprising for me. void * thread_func(void *arg) { pthread_exit(&ret); } int main(void) { pthread_t thr; int *exit_status; pthread_create(&thr, NULL, thread_func, NULL); sleep(2); pthread_join(thr, (void **)&exit_status); printf("value of exit status - %d\n", *exit_status); ret = 20; pthread_join(thr, (void **)&exit_status); printf("value of exit status - %d\n", *exit_status); return 0; } The output is value of exit status - 50 value of exit status - 20 I was expecting both the times the exit_status would be the actual exit value(50 in my case) of the thread. Instead it is just returning the value of the global variable which I used for pthread_exit. Is it not a bug?

    Read the article

  • Performance: Subquery or Joining

    - by Auro
    Hello I got a little question about performance of a subquery / joining another table INSERT INTO Original.Person ( PID, Name, Surname, SID ) ( SELECT ma.PID_new , TBL.Name , ma.Surname, TBL.SID FROM Copy.Person TBL , original.MATabelle MA WHERE TBL.PID = p_PID_old AND TBL.PID = MA.PID_old ); This is my SQL, now this thing runs around 1 million times or more. Now my question is what would be faster? if I change TBL.SID to (Select new from helptable where old = tbl.sid) or if I add helptable to the from and do the joining in the where? greets Auro

    Read the article

  • Why does FrameworkElement's FindResource() Method Accept an Object and not a String?

    - by ChrisNel52
    I understand that calling FindResource() on a FrameworkElement (e.g. a Window) can be used to find a resource in the FrameworkElement's ResourceDictionary. For example, I've used it many times to access a Style through code to add a new Setter to the Style dynamically. I always pass the x:Key value of the Style as a string into the FindResource() method. Like... Style style = w.FindResource("GridDescriptionColumn") as Style; My question is, I noticed that FindResource() accepts an argument of type object and not an argument of type string. I can't for the life of my think of a reason I would call FindResource() with an argument that is not a string. It makes me think that I may unaware of other ways to use FindResource(). Does anyone know why FindResource() accepts a parameter type of object and not string? If so, what would be an example of calling FindResource() with a parameter type other than a string? Thanks.

    Read the article

  • Letter-spacing in large name decreasing

    - by zabulus
    I have such trouble: in large names, as shown in image , somehow letter-spacing for Tahoma font is decreasing. This issue is shown up in two components that I use, so I don't think this is bug of the components. I have tested with another fonts, Arial - situation the same; MS Sans Serif - the same; Trebuchet MS - situation is good, symbols type correctly; Times New Roman - situation is good too, but font with notches Can you help? Using .NET without WPF.

    Read the article

  • Why would SQL be very slow when doing updates?

    - by ooo
    Suddenly doing updates into a few tables have gotten 10 times slower than they used to be. What are some good recommendations to determine root cause and optimization? Could it be that indexing certain columns are causing updates to be slow? Any other recommendations? I guess more important than guesses would be help on the process of identifying the root cause or metrics around performance. Is there anything in Fluent NHibernate that you can use to help identify the root cause of performance issues?

    Read the article

  • WMF image data validation?

    - by deostroll
    There is an image capturing device which gives its output in wmf. This output is stored in the database directly. We have cases where at times some of these images do not appear on a web page in IE. But if we right click on the page we are able to save the image on to the hard disk; meaning the image does exist on the page, but does not appear visible. I think this is because of some file corruption issue, but I don't know how to resolve it. We are however able to view such files using MS Picture Viewer (desktop app). Is there anyway we can detect such problematic files?

    Read the article

  • sum of timespans

    - by frenchie
    I have a collection of objects that include a timespan variable: MyObject { TimeSpan TheDuration {get;set;} } I want to use linq to sum those times. Of course, (from r in MyCollection select r.TheDuration).Sum(); doesn't work! I'm thinking of changing the datatype of TheDuration to an int and then summing it and converting the sum to a TimeSpan. That'll be messy because each TheDuration in my collection is used in as a timespan somewhere else. Any suggestion on this summation?

    Read the article

  • How to iterate over numerically named object properties

    - by Scott Schluer
    So I have a horribly designed class that I can't change that has properties like this: object.Color1 object.Color2 object.Color3 etc... How can I iterate through those with a for loop. In other words, something like this: for (int i = 0; i <= 40; i++) { string PropertyName = "Color" + i; if (object.PropertyName != "") { // do something } } Obviously this code wouldn't work but it gives you an idea of what I'm after. I have to do some processing on each property and I don't want to repeat my code 40 times. :) A loop would be perfect, I'm just not sure how to create the name of the property on the fly.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Loading multiple embedded flash apps onto an HTML page- problem with ordering

    - by shudson250
    We need to load an embedded version of a site written in Flash, and not originally designed to load multiple instances of itself, on a HTML page. The specific issue is how to get them to load in order when embedded, given that they are all being opened by the same instance of the flash player. It's a complicated mapping application, and at the moment, the maps and data get intermixed as the session variables are overwritten by another instance starting to load before the previous one has finished. We need a way to have them load sequentially, one finishing before another starts to load. The most we can specify in the URL is an &order=1 or similar. We have PHP and SQL on the backend. Edit: The embedded versions are being loaded in an iFrame of a parent site. One php file loads one swf, as many times as the parent site desires.

    Read the article

< Previous Page | 374 375 376 377 378 379 380 381 382 383 384 385  | Next Page >