Search Results

Search found 14236 results on 570 pages for 'times square'.

Page 379/570 | < Previous Page | 375 376 377 378 379 380 381 382 383 384 385 386  | Next Page >

• Java - java.util.List problem

  - by Yatendra Goel

  I have a java.util.ArrayList<Item> and an Item object. Now, I want to obtain the number of times the Item is stored in the arraylist. I know that I can do arrayList.contains() check but it returns true, irrespective of whether it contains one or more Items. Q1. How can I find the number of time the Item is stored in the list? ================================================================================== Q2. Also, If the list contains more than one Item, then how can I determine the index of other Items because arrayList.indexOf(item) returns the index of only first Item every time?

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Loading multiple embedded flash apps onto an HTML page- problem with ordering

  - by shudson250

  We need to load an embedded version of a site written in Flash, and not originally designed to load multiple instances of itself, on a HTML page. The specific issue is how to get them to load in order when embedded, given that they are all being opened by the same instance of the flash player. It's a complicated mapping application, and at the moment, the maps and data get intermixed as the session variables are overwritten by another instance starting to load before the previous one has finished. We need a way to have them load sequentially, one finishing before another starts to load. The most we can specify in the URL is an &order=1 or similar. We have PHP and SQL on the backend. Edit: The embedded versions are being loaded in an iFrame of a parent site. One php file loads one swf, as many times as the parent site desires.

  Read the article

• Color getAlpha() not working as intended

  - by Arvy

  I was making a program where I load an image and after that I do something with opaque pixels. Transparent pixels showed up as black pixels, but after some time I found the cause: Color c = new Color (input.getRGB(x, y)); Works-> if ((input.getRGB(x, y) & 0xFF000000) != 0x00000000) { do_smth();} Returns true at all times-> if (c.getAlpha() != 0) { do_smth(); } So why it does not work?

  Read the article

• deleting and reusing a temp table in a stored precedures

  - by Sheagorath

  Hi I need to SELECT INTO a temp table multiple times with a loop but I just can't do it, because after the table created( in SELECT into you can't simply drop the table at the end of the loop because you can't delete a table and create it again in the same batch. so how can I delete a table in a stored procedure and create it again? here is a snippet of where I am actualy using the temp table which is supposed to be a pivoting algorithm: WHILE @offset<@NumDays BEGIN SELECT bg.*, j.ID, j.time, j.Status INTO #TEMP1 FROM #TEMP2 AS bg left outer join PersonSchedule j on bg.PersonID = j.PersonID and bg.TimeSlotDateTime = j.TimeSlotDateTime and j.TimeSlotDateTime = @StartDate + @offset DROP TABLE #TEMP2; SELECT * INTO #TEMP2 FROM #TEMP1 DROP TABLE #TEMP1 SET @offset = @offset + 1 END

  Read the article

• MySQL Insert Query Randomly Takes a Long Time

  - by ShimmerTroll

  I am using MySQL to manage session data for my PHP application. When testing the app, it is usually very quick and responsive. However, seemingly randomly the response will stall before finally completing after a few seconds. I have narrowed the problem down to the session write query which looks something like this: INSERT INTO Session VALUES('lvg0p9peb1vd55tue9nvh460a7', '1275704013', '') ON DUPLICATE KEY UPDATE sessAccess='1275704013',sessData=''; The slow query log has this information: Query_time: 0.524446 Lock_time: 0.000046 Rows_sent: 0 Rows_examined: 0 This happens about 1 out of every 10 times. The query usually only takes ~0.0044 sec. The table is InnoDB with about 60 rows. sessId is the primary key with a BTREE index. Since this is accessed on every page view, it is clearly not an acceptable execution time. Why is this happening? Update: Table schema is: sessId:varchar(32), sessAccess:int(10), sessData:text

  Read the article

• Jumping over a While loop in Debug mode

  - by BDotA

  Here is the scenario: I put a break point at the beginning of a method that I want to debug... at first lets say there is Part1 in this method that I want to step into/over some of the codes... good... after that there is a While loop that I am NOT interested to step into/over it, I just want to tell the debugger that Hey you yourself run this loop for 10 times and just let me move to Part2 of my code which starts after this While loop , is it possible to do this with debugging options? so something like this : BreakPoint : MyMethod { Part One of the code : Ok, lets debug it While Loop : I do not care, Do not want to debug it Part Two of the code: Yes, I want to debug it too }

  Read the article

• Count Records in Listing View

  - by 47

  I have these two models: class CommonVehicle(models.Model): year = models.ForeignKey(Year) series = models.ForeignKey(Series) engine = models.ForeignKey(Engine) body_style = models.ForeignKey(BodyStyle) ... class Vehicle(models.Model): objects = VehicleManager() stock_number = models.CharField(max_length=6, blank=False) vin = models.CharField(max_length=17, blank=False) common_vehicle = models.ForeignKey(CommonVehicle) .... What I want to do is to have a count of how many times a given CommonVehicle object is used in the Vehicle class. So far my attempts are giving me one number, which is a total of all the records. How can I have the count being the total appearances for each CommonVehicle

  Read the article

• Why only random-access-iterator implements operator+ in C++?

  - by xopht

  I'd like get far next value for STL list iterator but it doesn't implement operator+, vector has it though. Why and how can I get the value where I want? I think I can do that if I call operator++ several times, but isn't that a little bit dirty? What I want to do is the following: list<int> l; ...omitted... list<int>::iterator itr = l.begin() + 3; // but, list iterator does not have // operator+ What is the best solution for what I want?

  Read the article

• Querying a smalldatetime's date and time seperately in SQL server?

  - by Kylee

  Imagine a table that has two fields, a smalltimedate and an int and about 1000 rows of data. What I'm attempting to do in query is to find the average of the INT field for rows between 3/3/2010 - 3/13/2010 and only if the entry is between 6:00am - 11:00pm. I tried between '2010-03-03 06:00 AND 2010-03-13 23:00' However that only restricts that very beginning and end times. I could do this with a loop but I'm going to need to have the same query run over much larger date ranges and this will quickly eat server resources. Is there a way to query date and time seperately?

  Read the article

• Android:simulating 1-bit display

  - by user1681805

  I'm new to Android,trying to build a simple game which use 1-bit black and white display.the screen dimension is 160 * 80,that is 12800 pixels.I created a byte array for the "VRAM",so each time it draws,it first checks the array. The thing is that I am not drawing a point or rectangle for each pixel,I'm using 2 bitmaps(ARGB_4444,I have to use alpha channel,because of shadow effect),1 for positive and 1 for negative.So I called 12800 times drawBitmap() in the surfaceView's Draw method.I know that's silly...But even for openGL,12800 quards won't be that fast right? Sorry..I cannot post imgs.the link of screenshot:http://i1014.photobucket.com/albums/af267/baininja/Screenshot_2013-10-22-01-05-36_zps91dbcdef.png should i totally give up this and draw points on a 160*80 bitmap then scale it to intented size?But that loses the visual effects.

  Read the article

• How to return settings from an object

  - by Rockbot

  i have done something like this: myProject = settings: duration: 500 value: 'aValue' aFunction: -> myElement.fadeOut myProject.settings.duration This is just a sample but my project is like that. A lot of times i have to reference to the settings to get a certain value, and i always have to write myProject.settings.value, and it doesn´t look good. My question is, can I call a function that returns the wanted value? Something like this? aFunction -> myElement.fadeOut getSetting(duration) I tried with getSetting: (param) -> myProject.settings.param but failed? Why is that? Thank you!

  Read the article

• Is Memory increase create difference in output or behavior of java application?

  - by Nitz

  Hey Guys I have created one java-swing application. The application runs perfectly runs perfect on my pc. But it doesn't run perfectly on client pc. I had increase my Virtual Memory, earlier on my pc. So my question is.. Is changing memory limit, effect or change application behavior? Is there anything that change the behavior of java application? bcz same application runs perfectly on my pc and same application does not running perfectly on client pc? and there is no problem in code, i have checked three times.

  Read the article

• extracting multiple fields from a text file using php

  - by Dave

  Hi, what is the best way of extracting multiple (~40 values) from a text file using php? the data is more or less like: NAMEA valuea NAMEB valueb I'm looking for a proper* approach to extracting this data into a data-structure, because i will need to specify regexs for all of them (all 40). did i make myself clear? *meaning, the default/painful method would be for me to do: $namea = extractfunction("regexa", $textfilevalue); $nameb = extractfunction("regeb", $textfilevalue); ... 40 times!

  Read the article

• how to deal with async calls in Ajax 4.0(using jquery?)

  - by dexter

  in my code i have done something like this. $.get('/Home/Module/Submit', { moduleName: ModName, moduleParameters: moduleParameters }, function(result) { $("#" + target).html(result); }); when i put alert in the function(result) {..} it shows html perfectly(both in alert and at the 'target'-on the .aspx page) BUT when i remove the alert.. on the page the 'html' don't appear or appear randomly (this method is called multiple times) i think that the 'result' comes to function asynchronously thats why it is not bind with the respective 'div' however in the last iteration it gets bind every time. can we make process stop until data gets bind? or is there any functionality (like alert) which can make data bind.. without disturbing UI (unlike alert)?

  Read the article

• Beside SVN, how do you manage your development vs test vs production source code?

  - by medopal

  I'm working on a very large project with three phases of source code. Development source code: changes rapidly every second, and checked by our QA Test environment code: released to clients' QA department (released every 2-3 weeks) Production environment: after confirmed ok by client QA its released to prod. (every few months) The system (governmental web app) is very large to track changes,bugs and hot fixes, sometimes the Testers could ask for a change, some other times the Production could ask for a hot fix or small update. The problem is, when the Test or Production request changes, the development code is already changed a lot, and they always warn us they want only that small fix, do not upload anything new with it. The question, how should i manage the code for the 3 phases, and get back to Test or Production code any tie and fix that small one thing (reflecting the change to the current Development as well)? Note: making a branch each time is too much, and i don't want the developers to be lost between updating the mainstream, the branch and the Test code!

  Read the article

• (iphone) Does it make difference to provide more images when the object is moving in a straight line?

  - by Eugene

  Hi. Among many animation scenarios, there are times when I want an object to move a straight line then change direction, move another straight line and so forth. Assuming I would use either UIImageView or CABasicAnimation with image arrays. Does it make difference to provide more images when the object is moving in a straight line? For example, point1 ---------point2 ------- point3 (all points are in a straight line) Providing an image at point2 to UIImageView or CABasicAnimation, gives any better animation result, assuming I don't need to change the animation speed along the course? If I were flashing each image myself, yes it would make the animation look smooth, but I'm giving the images to UIImageView/CABasicAnimation, and wonder what they do. Thank you

  Read the article

• C++ string how to

  - by typoknig

  This is a very simple question and I feel stupid for asking it, but I am pressed for time and I need to figure it out :) I just need to know how to make a string that contains text and other variables. For instance in Java I can just do this: String someString; for(int i = 0; i>10; i++){ someString = ("this text has printed " + i + " times"); //how do I create this line in C++? System.out.println(someString); i++; }

  Read the article

• FLEX: how to ignore MouseEvents from the container ?

  - by Patrick

  hi, I've some objects on the canvas, and I added eventListeners to these objects for MOUSE_UP event. I'm know checking if it works by tracing e.target.name, and I found out that the event is triggered twice, before on the element container (Canvas) and then the element itself. I read several times the documentation about Capture, Bubbling etc.. but I don't understand how to trigger the events only from the element itself... child.addEventListener(MouseEvent.MOUSE_UP, updateSelectedTags); private function updateSelectedTags(e:MouseEvent):void { Alert.show(e.currentTarget.name); //I have 2 alerts, one for canvas, the other one for the child } } thanks

  Read the article

• Upon USB insert, record unique identifer sting, format drive to FAT32 and copy a file. Bash or Pytho

  - by samsixty

  Hello, This is what I want to do, insert USB flash drive. mount it. record uniquie identifer string to a file. format the drive to FAT32. copy a text file to the drive. unmount it. remove the drive. 30 times The situation is this, I have bought 30 usb drives. I need to format each one to ensure they are clean, I need the unique string from each device. I need to put the same txt file on each one. I am not great at writing scripts but can read and follow bash and python. Any pointers would be appreciated.

  Read the article

• Refactoring a nested loop

  - by user3517441

  I have the following code which I use a lot of times in the class. for (int i = 0; i < someList.size(); i++) { for (int j = 0; j < someList.size(); j++) { if (i != j) { someList.get(i).sendMessageTo(someList.get(j))); //variable action } } } The purpose of the loop is to make each element in the List to send a message (or perform another action) to every element in the list except itself. Is there any way I can create a helper method so I don't have to repeat the loop code. I want to be able to state the variable action and call the helper method. Thanks.

  Read the article

• Django: IE doesn't load locahost or loads very SLOWLY

  - by reedvoid

  I'm just starting to learn Django, building a project on my computer, running Windows 7 64-bit, Python 2.7, Django 1.3. Basically whatever I write, it loads in Chrome and Firefox instantly. But for IE (version 9), it just stalls there, and does nothing. I can load up "http://127.0.0.1:8000" on IE and leave the computer on for hours and it doesn't load. Sometimes, when I refresh a couple of times or restart IE it'll work. If I change something in the code, again, Chrome and Firefox reflects changes instantly, whereas IE doesn't - if it loads the page at all. What is going on? I'm losing my mind here....

  Read the article

• How can i see how many mysql connections are opend ?

  - by Sahal

  How can i see how many number of connections are opened in one request. (mysql_connect) I know that if i call mysql_connect function 100 times, function will return the connection link which is already opened only if parameters of the function is same. It will not request for new connection if connection is already exists. But i just want to make sure mysql_connect is not requesting new. I am working with a legacy system which contains so many "mysql_connect" function. Is there any setting in apache or is there any way i can log this number of connection value in apache or mysql log file? Please help.

  Read the article

• Targeting an iFrame once with jQuery

  - by user275074

  Hi, I have a series of frames (4) which are used in a page to create loading of dynamic content through Ajax calls. In each of these frames I target parent level elements and update them with there respective content e.g. $("#loadingGrid1",top.document).show(); $("#frameSkills",top.document).hide(); In jQuery is there a way to instead of targeting specific elements on the parent page multiple times, simply target the page once into a variable e.g. var parentPage=$('#frameSkills',top.document); And then use this variable to apply content like $(parentPage #loadingGrid1).hide() Hope I've explained what I'm after enough. Basically, I'm having to call "top.document" in every jQuery selector I make and it seems like a waste of energy.

  Read the article

• How to determine bandwidth used by cron job?

  - by Lost_in_code

  I'm not a unix guy. CPanel does a good job of managing cronjobs and that is what I used to run dozens of cronjobs. All of them combined run more than 5000 times every day. Every cron makes a call to an external API. How can I check how much bandwidth are all the cron jobs eating? For my website I use awstats and that shows bandwidth usage et al. Another thing is that I dont want the admins to ban the cron jobs because they are using too much bandwidth (and CPU), more than what is allocated in my web hosting package.

  Read the article

< Previous Page | 375 376 377 378 379 380 381 382 383 384 385 386  | Next Page >