Search Results

Search found 13693 results on 548 pages for 'python metaprogramming'.

Page 382/548 | < Previous Page | 378 379 380 381 382 383 384 385 386 387 388 389  | Next Page >

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Inlines in Django Admin

    - by Oli
    I have two models, Order and UserProfile. Each Order has a ForeignKey to UserProfile, to associate it with that user. On the django admin page for each Order, I'd like to display the UserProfile associated with it, for easy processing of information. I have tried inlines: class UserInline(admin.TabularInline): model = UserProfile class ValuationRequestAdmin(admin.ModelAdmin): list_display = ('address1', 'address2', 'town', 'date_added') list_filter = ('town', 'date_added') ordering = ('-date_updated',) inlines = [ UserInline, ] But it complains that UserProfile "has no ForeignKey to" Order - which it doesn't, it's the other way around. Is there a way to do what I want?

    Read the article

  • Sending message from one server to another in Twisted

    - by Casey Patton
    I've implemented my servers in the following way: def makeServer(application, port): factory = protocol.ServerFactory() factory.protocol = MyChat factory.clients = [] internet.TCPServer(port, factory).setServiceParent(application) application = service.Application("chatserver") server1 = makeServer(application, port=1025) server2 = makeServer(application, port=1026) server3 = makeServer(application, port=1027) Note that MyChat is an event handling class that has a "receiveMessage" action: def lineReceived(self, line): print "received", repr(line) for c in self.factory.clients: c.transport.write(message + '\n') I want server1 to be able to pass messages to server2. Rather, I want server1 to be treated as a client of server2. If server1 receives the message "hi" then I want it to send that same exact message to server2. How can I accomplish this?

    Read the article

  • django link format words joined with hypens

    - by soField
    href="http://www.torontolife.com/daily/daily-dish/restauranto/2010/03/10/best-new-restaurants-2010-james-chatto-names-five-honourable-mentions/"Best new restaurants 2010: honourable mentions is django has built in mechanism to format links above i mean words joined with hypens how can achieve this ?

    Read the article

  • Distance between numpy arrays, columnwise

    - by Jaapsneep
    I have 2 arrays in 2D, where the column vectors are feature vectors. One array is of size F x A, the other of F x B, where A << B. As an example, for A = 2 and F = 3 (B can be anything): arr1 = np.array( [[1, 4], [2, 5], [3, 6]] ) arr2 = np.array( [[1, 4, 7, 10, ..], [2, 5, 8, 11, ..], [3, 6, 9, 12, ..]] ) I want to calculate the distance between arr1 and a fragment of arr2 that is of equal size (in this case, 3x2), for each possible fragment of arr2. The column vectors are independent of each other, so I believe I should calculate the distance between each column vector in arr1 and a collection of column vectors ranging from i to i + A from arr2 and take the sum of these distances (not sure though). Does numpy offer an efficient way of doing this, or will I have to take slices from the second array and, using another loop, calculate the distance between each column vector in arr1 and the corresponding column vector in the slice?

    Read the article

  • compare two following values in numpy array

    - by Billy Mitchell
    What is the best way to touch two following values in an numpy array? example: npdata = np.array([13,15,20,25]) for i in range( len(npdata) ): print npdata[i] - npdata[i+1] this looks really messed up and additionally needs exception code for the last iteration of the loop. any ideas? Thanks!

    Read the article

  • Can some explain why this wont draw a circle? It is drawing roughly 3/4?

    - by Brandon Shockley
    If we want to use n small lines to outline our circle then we can just divide both the circumference and 360 degrees by n (i.e , (2*pi*r)/n and 360/n). Did I not do that? import turtle, math window = turtle.Screen() window.bgcolor('blue') body = turtle.Turtle() body.pencolor('black') body.fillcolor('white') body.speed(10) body.width(3) body.hideturtle() body.up() body.goto(0, 200) lines = 40 toprad = 40 top_circum = 2 * math.pi * toprad sol = top_circum / lines circle = 360 / lines for stops in range(lines): body.pendown() body.left(sol) body.forward(circle) window.exitonclick()

    Read the article

  • Sending file over socket

    - by johannix
    I'm have a problem sending data as a file from one end of a socket to the other. What's happening is that both the server and client are trying to read the file so the file never gets sent. I was wondering how to have the client block until the server's completed reading the file sent from the client. I have this working with raw packets using send and recv, but figured this was a cleaner solution... Client: connects to server creating socket connection creates a file on socket and sends data waits for file from server Server: waits for file from client Complete interraction: client sends data to server server sends data to client

    Read the article

  • Get wrong PATH_INFO after rewriting in lighttpd

    - by Satoru.Logic
    In my lighttpd config file, I have a rewrite rule like this: $HTTP["host"] == "sub.example.com" { url.rewrite = ( "^/(.*)" => "/sub/$1" ) } So when a user visits http://sub.example.com, she's actually visiting http://example.com/sub. The problem is that the PATH_INFO seems wrong, URL: http://sub.example.com/extra PATH_INFO: expected: /extra what I get: /sub/extra Now whenever I call request.get_path(), it returns something like http://sub.example.com/sub/extra, which is not what I want. Of course, I can just override the get_path method of the request class, but I wonder if there is a simpler way like changing the lighttpd config?

    Read the article

  • PyGTK: Trouble with size of ScrolledWindow

    - by canavanin
    Hi everyone! I am using PyGTK and the gtk.Assistant. On one page I have placed a treeview (one column, just strings) in a gtk.ScrolledWindow (I wanted the vertical scrollbar, since the list contains about 35 items). Everything is working fine; the only thing that bugs me is that I have not been able to figure out from the documentation how to set the size of the scrolled window. Currently only three items are displayed at a time; I would like to set this number to 10 or so. Below is the code. As you can see I have tried using a gtk.Adjustment to influence the scrolled window's size, but as - once more - I have been incompetent at retrieving the required info from the documentation, I don't actually know what values should be put into there. self.page7 = gtk.VBox() # The gtk.Adjustment: page_size = gtk.Adjustment(lower=10, page_size=100) # just used some arbitrary numbers here >_< scrolled_win = gtk.ScrolledWindow(page_size) scrolled_win.set_policy(gtk.POLICY_AUTOMATIC, gtk.POLICY_AUTOMATIC) # only display scroll bars when required self.character_traits_treeview = gtk.TreeView() self.character_traits_treestore = gtk.TreeStore(str) self.character_traits_treeview.set_model(self.character_traits_treestore) tc = gtk.TreeViewColumn("Character traits") self.character_traits_treeview.append_column(tc) cr = gtk.CellRendererText() tc.pack_start(cr, True) tc.add_attribute(cr, "text", 0) self.character_trait_selection = self.character_traits_treeview.get_selection() self.character_trait_selection.connect('changed', self.check_number_of_character_trait_selections) self.character_trait_selection.set_mode(gtk.SELECTION_MULTIPLE) self.make_character_traits_treestore() # adding the treeview to the scrolled window: scrolled_win.add(self.character_traits_treeview) self.page7.pack_start(scrolled_win, False, False, 0) self.assistant.append_page(self.page7) self.assistant.set_page_title(self.page7, "Step 7: Select 2-3 character traits") self.assistant.set_page_type(self.page7, gtk.ASSISTANT_PAGE_CONTENT) self.assistant.set_page_complete(self.page7, False) def check_number_of_character_trait_selections(self, blah): # ... def make_character_traits_treestore(self): # ... I know I should RTFM, but as I can't make head or tail of it, and as further searching, too, has been to no avail, I'm just hoping that someone on here can give me a hint. Thanks a lot in advance! PS: Here are the links to: the gtk.ScrolledWindow documentation the gtk.Adjustment documentation

    Read the article

  • How to override inner class methods if the inner class is defined as a property of the top class

    - by Maddy
    I have a code snippet like this class A(object): class b: def print_hello(self): print "Hello world" b = property(b) And I want to override the inner class b (please dont worry about the lowercase name) behaviour. Say, I want to add a new method or I want to change an existing method, like: class C(A): class b(A.b): def print_hello(self): print "Inner Class: Hello world" b = property(b) Now if I create C's object as c = C(), and call c.b I get TypeError: 'property' object is not callable error. How would I get pass this and call print_hello of the extended inner class? Disclaimer: I dont want to change the code for A class.

    Read the article

  • Regex and unicode

    - by dbr
    I have a script that parses the filenames of TV episodes (show.name.s01e02.avi for example), grabs the episode name (from the www.thetvdb.com API) and automatically renames them into something nicer (Show Name - [01x02].avi) The script works fine, that is until you try and use it on files that have Unicode show-names (something I never really thought about, since all the files I have are English, so mostly pretty-much all fall within [a-zA-Z0-9'\-]) How can I allow the regular expressions to match accented characters and the likes? Currently the regex's config section looks like.. config['valid_filename_chars'] = """0123456789abcdefghijklmnopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ!@£$%^&*()_+=-[]{}"'.,<>`~? """ config['valid_filename_chars_regex'] = re.escape(config['valid_filename_chars']) config['name_parse'] = [ # foo_[s01]_[e01] re.compile('''^([%s]+?)[ \._\-]\[[Ss]([0-9]+?)\]_\[[Ee]([0-9]+?)\]?[^\\/]*$'''% (config['valid_filename_chars_regex'])), # foo.1x09* re.compile('''^([%s]+?)[ \._\-]\[?([0-9]+)x([0-9]+)[^\\/]*$''' % (config['valid_filename_chars_regex'])), # foo.s01.e01, foo.s01_e01 re.compile('''^([%s]+?)[ \._\-][Ss]([0-9]+)[\.\- ]?[Ee]([0-9]+)[^\\/]*$''' % (config['valid_filename_chars_regex'])), # foo.103* re.compile('''^([%s]+)[ \._\-]([0-9]{1})([0-9]{2})[\._ -][^\\/]*$''' % (config['valid_filename_chars_regex'])), # foo.0103* re.compile('''^([%s]+)[ \._\-]([0-9]{2})([0-9]{2,3})[\._ -][^\\/]*$''' % (config['valid_filename_chars_regex'])), ]

    Read the article

  • Iterate with binary structure over numpy array to get cell sums

    - by Curlew
    In the package scipy there is the function to define a binary structure (such as a taxicab (2,1) or a chessboard (2,2)). import numpy from scipy import ndimage a = numpy.zeros((6,6), dtype=numpy.int) a[1:5, 1:5] = 1;a[3,3] = 0 ; a[2,2] = 2 s = ndimage.generate_binary_structure(2,2) # Binary structure #.... Calculate Sum of result_array = numpy.zeros_like(a) What i want is to iterate over all cells of this array with the given structure s. Then i want to append a function to the current cell value indexed in a empty array (example function sum), which uses the values of all cells in the binary structure. For example: array([[0, 0, 0, 0, 0, 0], [0, 1, 1, 1, 1, 0], [0, 1, 2, 1, 1, 0], [0, 1, 1, 0, 1, 0], [0, 1, 1, 1, 1, 0], [0, 0, 0, 0, 0, 0]]) # The array a. The value in cell 1,2 is currently one. Given the structure s and an example function such as sum the value in the resulting array (result_array) becomes 7 (or 6 if the current cell value is excluded). Someone got an idea?

    Read the article

  • Reading path in templates

    - by DJPython
    Hello, is it any way to read path to current page? For example, I am at www.example.com/foo/bar/ - and I want to read '/foo/bar/'. But, all have to be done in template file without modyficating views. I have to many view files to edit each one. Sorry for my english, hope everyone understand. Cheers.

    Read the article

  • Pass errors in Django using HttpResponseRedirect

    - by JPC
    I know that HttpResponseRedirect only takes one parameter, a URL. But there are cases when I want to redirect with an error message to display. I was reading this post: How to pass information using an http redirect (in Django) and there were a lot of good suggestions. I don't really want to use a library that I don't know how works. I don't want to rely on messages which, according to the Django docs, is going to be removed. I thought about using sessions. I also like the idea of passing it in a URL, something like: return HttpResponseRedirect('/someurl/?error=1') and then having some map from error code to message. Is it good practice to have a global map-like structure which hard codes in these error messages or is there a better way? Or should I just use a session EDIT: I got it working using a session. Is that a good practice to put things like this in the session?

    Read the article

  • Making only one task run at a time in celerybeat

    - by Noufal Ibrahim
    I have a task which I execute once a minute using celerybeat. It works fine. Sometimes though, the task takes a few seconds more than a minute to run because of which two instances of the task run. This leads to some race conditions that mess things up. I can (and probably should) fix my task to work properly but I wanted to know if celery has any builtin ways to ensure this. My cursory Google searches and RTFMs yielded no results.

    Read the article

  • Images to video - converting to IplImage makes video blue

    - by user891908
    I want to create a video from images using opencv. The strange problem is that if i will write image (bmp) to disk and then load (cv.LoadImage) it it renders fine, but when i try to load image from StringIO and convert it to IplImage, it turns video to blue. Heres the code: import StringIO output = StringIO.StringIO() FOREGROUND = (0, 0, 0) TEXT = 'MY TEXT' font_path = 'arial.ttf' font = ImageFont.truetype(font_path, 18, encoding='unic') text = TEXT.decode('utf-8') (width, height) = font.getsize(text) # Create with background with place for text w,h=(600,600) contentimage=Image.open('0.jpg') background=Image.open('background.bmp') x, y = contentimage.size # put content onto background background.paste(contentimage,(((w-x)/2),0)) draw = ImageDraw.Draw(background) draw.text((0,0), text, font=font, fill=FOREGROUND) pi = background pi.save(output, "bmp") #pi.show() #shows image in full color output.seek(0) pi= Image.open(output) print pi, pi.format, "%dx%d" % pi.size, pi.mode cv_im = cv.CreateImageHeader(pi.size, cv.IPL_DEPTH_8U, 3) cv.SetData(cv_im, pi.tostring()) print pi.size, cv.GetSize(cv_im) w = cv.CreateVideoWriter("2.avi", cv.CV_FOURCC('M','J','P','G'), 1,(cv.GetSize(cv_im)[0],cv.GetSize(cv_im)[1]), is_color=1) for i in range(1,5): cv.WriteFrame(w, cv_im) del w

    Read the article

  • Does this introduce security vulnerabilities?

    - by mcmt
    I don't think I'm missing anything. Then again I'm kind of a newbie. def GET(self, filename): name = urllib.unquote(filename) full = path.abspath(path.join(STATIC_PATH, filename)) #Make sure request is not tricksy and tries to get out of #the directory, e.g. filename = "../.ssh/id_rsa". GET OUTTA HERE assert full[:len(STATIC_PATH)] == STATIC_PATH, "bad path" return open(full).read()

    Read the article

  • virtualenvwrapper .hook problem

    - by Wraith
    I've used virtualenvwrapper, but I'm having problems running it on a new computer. My .bashrc file is updated per the instructions: export WORKON_HOME=$DEV_HOME/projects source /usr/local/bin/virtualenvwrapper.sh But when source is run, I get the following: bash: /25009.hook: Permission denied bash: /25009.hook: No such file or directory This previous post leads me to believe the filename is being recycled and locked because virtualenvwrapper.sh uses $$. Is there any way to fix this?

    Read the article

< Previous Page | 378 379 380 381 382 383 384 385 386 387 388 389  | Next Page >