Search Results

Search found 1081 results on 44 pages for 'combinations'.

Page 39/44 | < Previous Page | 35 36 37 38 39 40 41 42 43 44  | Next Page >

  • getSymbols and using lapply, Cl, and merge to extract close prices

    - by algotr8der
    I've been messing around with this for some time. I recently started using the quantmod package to perform analytics on stock prices. I have a ticker vector that looks like the following: > tickers [1] "SPY" "DIA" "IWM" "SMH" "OIH" "XLY" "XLP" "XLE" "XLI" "XLB" "XLK" "XLU" "XLV" [14] "QQQ" > str(tickers) chr [1:14] "SPY" "DIA" "IWM" "SMH" "OIH" "XLY" "XLP" "XLE" ... I wrote a function called myX to use in a lapply call to save prices for every stock in the vector tickers. It has the following code: myX <- function(tickers, start, end) { require(quantmod) getSymbols(tickers, from=start, to=end) } I call lapply by itself library(quantmod) lapply(tickers,myX,start="2001-03-01", end="2011-03-11") > lapply(tickers,myX,start="2001-03-01", end="2011-03-11") [[1]] [1] "SPY" [[2]] [1] "DIA" [[3]] [1] "IWM" [[4]] [1] "SMH" [[5]] [1] "OIH" [[6]] [1] "XLY" [[7]] [1] "XLP" [[8]] [1] "XLE" [[9]] [1] "XLI" [[10]] [1] "XLB" [[11]] [1] "XLK" [[12]] [1] "XLU" [[13]] [1] "XLV" [[14]] [1] "QQQ" That works fine. Now I want to merge the Close prices for every stock into an object that looks like # BCSI.Close WBSN.Close NTAP.Close FFIV.Close SU.Close # 2011-01-03 30.50 20.36 57.41 134.33 38.82 # 2011-01-04 30.24 19.82 57.38 132.07 38.03 # 2011-01-05 31.36 19.90 57.87 137.29 38.40 # 2011-01-06 32.04 19.79 57.49 138.07 37.23 # 2011-01-07 31.95 19.77 57.20 138.35 37.30 # 2011-01-10 31.55 19.76 58.22 142.69 37.04 Someone recommended I try something like the following: ClosePrices <- do.call(merge, lapply(tickers, function(x) Cl(get(x)))) However I tried various combinations of this without any success. First I tried just calling lapply with Cl(x) >lapply(tickers,myX,start="2001-03-01", end="2011-03-11") Cl(myX))) > lapply(tickers,myX,start="2001-03-01", end="2011-03-11") Cl(x))) Error: unexpected symbol in "lapply(tickers,myX,start="2001-03-01", end="2011-03-11") Cl" > > lapply(tickers,myX(x),start="2001-03-01", end="2011-03-11") Cl(x))) Error: unexpected symbol in "lapply(tickers,myX(x),start="2001-03-01", end="2011-03-11") Cl" > > lapply(tickers,myX(start="2001-03-01", end="2011-03-11") Cl(x) Error: unexpected symbol in "lapply(tickers,myX(start="2001-03-01", end="2011-03-11") Cl" > lapply(tickers,myX(start="2001-03-01", end="2011-03-11") Cl(x)) Error: unexpected symbol in "lapply(tickers,myX(start="2001-03-01", end="2011-03-11") Cl" > Any guidance would be kindly appreciated.

    Read the article

  • How do I create a Spring 3 + Tiles 2 webapp using REST-ful URLs?

    - by Ichiro Furusato
    I'm having a heck of a time resolving URLs with Spring 3.0 MVC. I'm just building a HelloWorld to try out how to build a RESTful webapp in Spring, nothing theoretically complicated. All of the examples I've been able to find are based on configurations that pay attention to file extensions ("*.htm" or "*.do"), include an artificial directory name prefix ("/foo") or even prefix paths with a dot (ugly), all approaches that use some artificial regex pattern as a signal to the resolver. For a REST approach I want to avoid all that muck and use only the natural URL patterns of my application. I would assume (perhaps incorrectly) that in web.xml I'd set a url-pattern of "/*" and pass everything to the DispatcherServlet for resolution, then just rely on URL patterns in my controller. I can't reliably get my resolver(s) to catch the URL patterns, and in all my trials this results in a resource not found error, a stack overflow (loop), or some kind of opaque Spring 3 ServletException stack trace — one of my ongoing frustrations with Spring generally is that the error messages are not often very helpful. I want to work with a Tiles 2 resolver. I've located my *.jsp files in WEB-INF/views/ and have a single line index.jsp file at the application root redirecting to the index file set by my layout.xml (the Tiles 2 Configurer). I do all the normal Spring 3 high-level configuration: <mvc:annotation-driven /> <mvc:view-controller path="/" view-name="index"/> <context:component-scan base-package="com.acme.web.controller" /> ...followed by all sorts of combinations and configurations of UrlBasedViewResolver, InternalResourceViewResolver, UrlFilenameViewController, etc. with all manner of variantions in my Tiles 2 configuration file. Then in my controller I've trying to pick up my URL patterns. Problem is, I can't reliably even get the resolver(s) to catch the patterns to send to my controller. This has now stretched to multiple days with no real progress on something I thought would be very simple to implement. I'm perhaps trying to do too much at once, though I would think this should be a simple (almost a default) configuration. I'm just trying to create a simple HelloWorld-type application, I wouldn't expect this is rocket science. Rather than me post my own configurations (which have ranged all over the map), does anyone know of an online example that: shows a simple Spring 3 MVC + Tiles 2 web application that uses REST-ful URLs (i.e., avoiding forced URL patterns such as file extensions, added directory names or dots) and relies solely on Spring 3 code/annotations (i.e., nothing outside of Spring MVC itself) to accomplish this? Is there an easy way to do this? Thanks very much for any help.

    Read the article

  • Web Services Primer for a WinForms Developer?

    - by Unicorns
    I've been writing client/server applications with Winforms for about six years now, but I have yet to venture into the web space (neither ASP.NET nor web services). Given the direction that the job market has been heading for some time and the fact that I have a basic curiosity, I'd like to get involved with writing web services, but I don't know where to start. I've read about various options (XML/SOAP vs. JSON, REST vs...well, actually I don't know what it's called, etc.), but I'm not sure what sort of criteria are in play when making the determination to use one or the other. Obviously, I'd like to leverage the tools that I have (Visual Studio, the .NET framework, etc.) without hamstringing myself into only targeting a particular audience (i.e. writing the service in such a way as to make it difficult to consume from a Windows Mobile/Android/iPhone client, for example). For the record, my plan--for now--is to use WCF for my web service development, but I'm open to using another .NET approach if that's advisable. I realize that this question is pretty open-ended so it may get closed, but here are some things I'm wondering: What are some things to consider when choosing the type of web service (REST, etc.) I intend to write? Is it possible (and, if so, feasible) to move from one approach to another? Can web services be written in an event-driven way? As I said I'm a Winforms developer, so I'm used to objects raising events for me to react to. For instance, if I have two clients connected to my service, is there a way for me to "push" information to one of them as a result of an action by the other? If this is possible, is this advisable or am I just not thinking about it correctly? What authentication mechanisms seem to work best for public-facing services? What about if I plan to have different types of OS'es and clients connecting to the service? Is there a generally accepted platform-agnostic approach? In the line of authentication, is this something that I should be doing myself (authenticating an managing sessions, etc.) or is this something should be handled at the framework level and I just define exactly how it should work? If that's the case, how do I tell who the requester has authenticated themselves as? I started writing an authentication mechanism (simple username/password combinations stored in the database and a corresponding session table with a GUID key) within my service and just requiring that key to be passed with every operation (other than logging in, of course), but I want to make sure that I'm not reinventing the wheel here. However, I also don't want to clutter up the server with a bunch of machine user accounts just to use Basic authentication. I'm also under the impression that Digest (and of course Windows) authentication requires a machine (or AD) user account.

    Read the article

  • Scrolling RelativeLayout- white border over part of the content

    - by Tanis.7x
    I have a fairly simply Fragment that adds a handful of colored ImageViews to a RelativeLayout. There are more images than can fit on screen, so I implemented some custom scrolling. However, When I scroll around, I see that there is an approximately 90dp white border overlapping part of the content right where the edges of the screen are before I scroll. It is obvious that the ImageViews are still being created and drawn properly, but they are being covered up. How do I get rid of this? I have tried: Changing both the RelativeLayout and FrameLayout to WRAP_CONTENT, FILL_PARENT, MATCH_PARENT, and a few combinations of those. Setting the padding and margins of both layouts to 0dp. Example: Fragment: public class MyFrag extends Fragment implements OnTouchListener { int currentX; int currentY; RelativeLayout container; final int[] colors = {Color.BLACK, Color.RED, Color.BLUE}; @Override public View onCreateView(LayoutInflater inflater, ViewGroup fragContainer, Bundle savedInstanceState) { return inflater.inflate(R.layout.fragment_myfrag, null); } @Override public void onActivityCreated(Bundle savedInstanceState) { super.onActivityCreated(savedInstanceState); container = (RelativeLayout) getView().findViewById(R.id.container); container.setOnTouchListener(this); // Temp- Add a bunch of images to test scrolling for(int i=0; i<1500; i+=100) { for (int j=0; j<1500; j+=100) { int color = colors[(i+j)%3]; ImageView image = new ImageView(getActivity()); image.setScaleType(ImageView.ScaleType.CENTER); image.setBackgroundColor(color); LayoutParams lp = new RelativeLayout.LayoutParams(100, 100); lp.setMargins(i, j, 0, 0); image.setLayoutParams(lp); container.addView(image); } } } @Override public boolean onTouch(View v, MotionEvent event) { switch (event.getAction()) { case MotionEvent.ACTION_DOWN: { currentX = (int) event.getRawX(); currentY = (int) event.getRawY(); break; } case MotionEvent.ACTION_MOVE: { int x2 = (int) event.getRawX(); int y2 = (int) event.getRawY(); container.scrollBy(currentX - x2 , currentY - y2); currentX = x2; currentY = y2; break; } case MotionEvent.ACTION_UP: { break; } } return true; } } XML: <FrameLayout xmlns:android="http://schemas.android.com/apk/res/android" xmlns:tools="http://schemas.android.com/tools" android:layout_width="fill_parent" android:layout_height="fill_parent" tools:context=".FloorPlanFrag"> <RelativeLayout android:id="@+id/container" android:layout_width="fill_parent" android:layout_height="fill_parent" /> </FrameLayout>

    Read the article

  • What is the most effective way to test for combined keyboard arrow direction in ActionScript 3.0?

    - by Relee
    I need to monitor the direction a user is indicating using the four directional arrow keys on a keyboard in ActionScript 3.0 and I want to know the most efficient and effective way to do this. I've got several ideas of how to do it, and I'm not sure which would be best. I've found that when tracking Keyboard.KEY_DOWN events, the event repeats as long as the key is down, so the event function is repeated as well. This broke the method I had originally chosen to use, and the methods I've been able to think of require a lot of comparison operators. The best way I've been able to think of would be to use bitwise operators on a uint variable. Here's what I'm thinking var _direction:uint = 0x0; // The Current Direction That's the current direction variable. In the Keyboard.KEY_DOWN event handler I'll have it check what key is down, and use a bitwise AND operation to see if it's already toggled on, and if it's not, I'll add it in using basic addition. So, up would be 0x1 and down would be 0x2 and both up and down would be 0x3, for example. It would look something like this: private function keyDownHandler(e:KeyboardEvent):void { switch(e.keyCode) { case Keyboard.UP: if(!(_direction & 0x1)) _direction += 0x1; break; case Keyboard.DOWN: if(!(_direction & 0x2)) _direction += 0x2; break; // And So On... } } The keyUpHandler wouldn't need the if operation since it only triggers once when the key goes up, instead of repeating. I'll be able to test the current direction by using a switch statement labeled with numbers from 0 to 15 for the sixteen possible combinations. That should work, but it doesn't seem terribly elegant to me, given all of the if statements in the repeating keyDown event handler, and the huge switch. private function checkDirection():void { switch(_direction) { case 0: // Center break; case 1: // Up break; case 2: // Down break; case 3: // Up and Down break; case 4: // Left break; // And So On... } } Is there a better way to do this?

    Read the article

  • Android USB Host Communication

    - by Kip Russell
    I'm working on a project that utilizes the USB Host capabilities in Android 3.2. I'm suffering from a deplorable lack of knowledge and talent regarding USB/Serial communication in general. I'm also unable to find any good example code for what I need to do. I need to read from a USB Communication Device. Ex: When I connect via Putty (on my PC) I enter: >GO And the device starts spewing out data for me. Pitch/Roll/Temp/Checksum. Ex: $R1.217P-0.986T26.3*60 $R1.217P-0.986T26.3*60 $R1.217P-0.987T26.3*61 $R1.217P-0.986T26.3*60 $R1.217P-0.985T26.3*63 I can send the initial 'GO' command from the Android device at which time I receive an echo of 'GO'. Then nothing else on any subsequent reads. How can I: 1) Send the 'go' command. 2) Read in the stream of data that results. The USB device I'm working with has the following interfaces (endpoints). Device Class: Communication Device (0x2) Interfaces: Interface #0 Class: Communication Device (0x2) Endpoint #0 Direction: Inbound (0x80) Type: Intrrupt (0x3) Poll Interval: 255 Max Packet Size: 32 Attributes: 000000011 Interface #1 Class: Communication Device Class (CDC) (0xa) Endpoint #0 Address: 129 Number: 1 Direction: Inbound (0x80) Type: Bulk (0x2) Poll Interval (0) Max Packet Size: 32 Attributes: 000000010 Endpoint #1 Address: 2 Number: 2 Direction: Outbound (0x0) Type: Bulk (0x2) Poll Interval (0) Max Packet Size: 32 Attributes: 000000010 I'm able to deal with permission, connect to the device, find the correct interface and assign the endpoints. I'm just having trouble figuring out which technique to use to send the initial command read the ensuing data. I'm tried different combinations of bulkTransfer and controlTransfer with no luck. Thanks. I'm using interface#1 as seen below: public AcmDevice(UsbDeviceConnection usbDeviceConnection, UsbInterface usbInterface) { Preconditions.checkState(usbDeviceConnection.claimInterface(usbInterface, true)); this.usbDeviceConnection = usbDeviceConnection; UsbEndpoint epOut = null; UsbEndpoint epIn = null; // look for our bulk endpoints for (int i = 0; i < usbInterface.getEndpointCount(); i++) { UsbEndpoint ep = usbInterface.getEndpoint(i); Log.d(TAG, "EP " + i + ": " + ep.getType()); if (ep.getType() == UsbConstants.USB_ENDPOINT_XFER_BULK) { if (ep.getDirection() == UsbConstants.USB_DIR_OUT) { epOut = ep; } else if (ep.getDirection() == UsbConstants.USB_DIR_IN) { epIn = ep; } } } if (epOut == null || epIn == null) { throw new IllegalArgumentException("Not all endpoints found."); } AcmReader acmReader = new AcmReader(usbDeviceConnection, epIn); AcmWriter acmWriter = new AcmWriter(usbDeviceConnection, epOut); reader = new BufferedReader(acmReader); writer = new BufferedWriter(acmWriter); }

    Read the article

  • Autoconf -- including a static library (newbie)

    - by EB
    I am trying to migrate my application from manual build to autoconf, which is working very nicely so far. But I have one static library that I can't figure out how to integrate. That library will NOT be located in the usual library locations - the location of the binary (.a file) and header (.h file) will be given as a configure argument. (Notably, even if I move the .a file to /usr/lib or anywhere else I can think of, it still won't work.) It is also not named traditionally (it does not start with "lib" or "l"). Manual compilation is working with these (directory is not predictable - this is just an example): gcc ... -I/home/john/mystuff /home/john/mystuff/helper.a (Uh, I actually don't understand why the .a file is referenced directly, not with -L or anything. Yes, I have a half-baked understanding of building C programs.) So, in my configure.ac, I can use the relevant configure argument to successfully find the header (.h file) using AC_CHECK_HEADER. Inside the AC_CHECK_HEADER I then add the location to CPFLAGS and the #include of the header file in the actual C code picks it up nicely. Given a configure argument that has been put into $location and the name of the needed files are helper.h and helper.a (which are both in the same directory), here is what works so far: AC_CHECK_HEADER([$location/helper.h], [AC_DEFINE([HAVE_HELPER_H], [1], [found helper.h]) CFLAGS="$CFLAGS -I$location"]) Where I run into difficulties is getting the binary (.a file) linked in. No matter what I try, I always get an error about undefined references to the function calls for that library. I'm pretty sure it's a linkage issue, because I can fuss with the C code and make an intentional error in the function calls to that library which produces earlier errors that indicate that the function prototypes have been loaded and used to compile. I tried adding the location that contains the .a file to LDFLAGS and then doing a AC_CHECK_LIB but it is not found. Maybe my syntax is wrong, or maybe I'm missing something more fundamental, which would not be surprising since I'm a newbie and don't really know what I'm doing. Here is what I have tried: AC_CHECK_HEADER([$location/helper.h], [AC_DEFINE([HAVE_HELPER_H], [1], [found helper.h]) CFLAGS="$CFLAGS -I$location"; LDFLAGS="$LDFLAGS -L$location"; AC_CHECK_LIB(helper)]) No dice. AC_CHECK_LIB is looking for -lhelper I guess (or libhelper?) so I'm not sure if that's a problem, so I tried this, too (omit AC_CHECK_LIB and include the .a directly in LDFLAGS), without luck: AC_CHECK_HEADER([$location/helper.h], [AC_DEFINE([HAVE_HELPER_H], [1], [found helper.h]) CFLAGS="$CFLAGS -I$location"; LDFLAGS="$LDFLAGS -L$location/helper.a"]) To emulate the manual compilation, I tried removing the -L but that doesn't help: AC_CHECK_HEADER([$location/helper.h], [AC_DEFINE([HAVE_HELPER_H], [1], [found helper.h]) CFLAGS="$CFLAGS -I$location"; LDFLAGS="$LDFLAGS $location/helper.a"]) I tried other combinations and permutations, but I think I might be missing something more fundamental....

    Read the article

  • Move namespace declaration from payload to envelope on an axis created web service

    - by rmarimon
    I just created a web service client using axis and eclipse that does not work with my web service provider. The message created by the web service client looks like this: <?xml version="1.0" encoding="UTF-8"?> <soapenv:Envelope xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance"> <soapenv:Body> <enviarMensajeRequest xmlns="http://www.springframework.org/spring-ws/Imk-Zenkiu-Services"> <usuario>someuser</usuario> <clave>somepassword</clave> <mensaje>somemessage</mensaje> <contacto> <buzonSMS>somenumber</buzonSMS> <primerNombre>somefirstname</primerNombre> <primerApellido>somelastname</primerApellido> </contacto> </enviarMensajeRequest> </soapenv:Body> </soapenv:Envelope> I see nothing wrong with the message but my provider insists the message should be: <?xml version="1.0" encoding="UTF-8"?> <soapenv:Envelope xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:imk="http://www.springframework.org/spring-ws/Imk-Zenkiu-Services"> <soapenv:Body> <imk:enviarMensajeRequest> <imk:usuario>someuser</imk:usuario> <imk:clave>somepassword</imk:clave> <imk:mensaje>somemessage</imk:mensaje> <imk:contacto> <imk:buzonSMS>somenumber</imk:buzonSMS> <imk:primerNombre>somefirstname</imk:primerNombre> <imk:primerApellido>somelastname</imk:primerApellido> </imk:contacto> </imk:enviarMensajeRequest> </soapenv:Body> </soapenv:Envelope> Notice the namespace declaration moving from the enviarMensajeRequest to the soapenv:Envelope and the qualification with imk: on the parameters. I've tried many combinations on the process but my web service, wsdl and xml knowledge is very limited. The provider says that they can't help beyond telling me this. Any ideas? Perhaps a different framework that I can use to create the correct client.

    Read the article

  • How to add new object to an IList mapped as a one-to-many with NHibernate?

    - by Jørn Schou-Rode
    My model contains a class Section which has an ordered list of Statics that are part of this section. Leaving all the other properties out, the implementation of the model looks like this: public class Section { public virtual int Id { get; private set; } public virtual IList<Static> Statics { get; private set; } } public class Static { public virtual int Id { get; private set; } } In the database, the relationship is implemented as a one-to-many, where the table Static has a foreign key pointing to Section and an integer column Position to store its index position in the list it is part of. The mapping is done in Fluent NHibernate like this: public SectionMap() { Id(x => x.Id); HasMany(x => x.Statics).Cascade.All().LazyLoad() .AsList(x => x.WithColumn("Position")); } public StaticMap() { Id(x => x.Id); References(x => x.Section); } Now I am able to load existing Statics, and I am also able to update the details of those. However, I cannot seem to find a way to add new Statics to a Section, and have this change persisted to the database. I have tried several combinations of: mySection.Statics.Add(myStatic) session.Update(mySection) session.Save(myStatic) but the closest I have gotten (using the first two statements), is to an SQL exception reading: "Cannot insert the value NULL into column 'Position'". Clearly an INSERT is attempted here, but NHibernate does not seem to automatically append the index position to the SQL statement. What am I doing wrong? Am I missing something in my mappings? Do I need to expose the Position column as a property and assign a value to it myself? EDIT: Apparently everything works as expected, if I remove the NOT NULL constraint on the Static.Position column in the database. I guess NHibernate makes the insert and immediatly after updates the row with a Position value. While this is an anwers to the question, I am not sure if it is the best one. I would prefer the Position column to be not nullable, so I still hope there is some way to make NHibernate provide a value for that column directly in the INSERT statement. Thus, the question is still open. Any other solutions?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Autoconf -- building with static library (newbie)

    - by EB
    I am trying to migrate my application from manual build to autoconf, which is working very nicely so far. But I have one static library that I can't figure out how to integrate. That library will NOT be located in the usual library locations - the location of the binary (.a file) and header (.h file) will be given as a configure argument. (Notably, even if I move the .a file to /usr/lib or anywhere else I can think of, it still won't work.) It is also not named traditionally (it does not start with "lib" or "l"). Manual compilation is working with these (directory is not predictable - this is just an example): gcc ... -I/home/john/mystuff /home/john/mystuff/helper.a (Uh, I actually don't understand why the .a file is referenced directly, not with -L or anything. Yes, I have a half-baked understanding of building C programs.) So, in my configure.ac, I can use the relevant configure argument to successfully find the header (.h file) using AC_CHECK_HEADER. Inside the AC_CHECK_HEADER I then add the location to CPFLAGS and the #include of the header file in the actual C code picks it up nicely. Given a configure argument that has been put into $location and the name of the needed files are helper.h and helper.a (which are both in the same directory), here is what works so far: AC_CHECK_HEADER([$location/helper.h], [AC_DEFINE([HAVE_HELPER_H], [1], [found helper.h]) CFLAGS="$CFLAGS -I$location"]) Where I run into difficulties is getting the binary (.a file) linked in. No matter what I try, I always get an error about undefined references to the function calls for that library. I'm pretty sure it's a linkage issue, because I can fuss with the C code and make an intentional error in the function calls to that library which produces earlier errors that indicate that the function prototypes have been loaded and used to compile. I tried adding the location that contains the .a file to LDFLAGS and then doing a AC_CHECK_LIB but it is not found. Maybe my syntax is wrong, or maybe I'm missing something more fundamental, which would not be surprising since I'm a newbie and don't really know what I'm doing. Here is what I have tried: AC_CHECK_HEADER([$location/helper.h], [AC_DEFINE([HAVE_HELPER_H], [1], [found helper.h]) CFLAGS="$CFLAGS -I$location"; LDFLAGS="$LDFLAGS -L$location"; AC_CHECK_LIB(helper)]) No dice. AC_CHECK_LIB is looking for -lhelper I guess (or libhelper?) so I'm not sure if that's a problem, so I tried this, too (omit AC_CHECK_LIB and include the .a directly in LDFLAGS), without luck: AC_CHECK_HEADER([$location/helper.h], [AC_DEFINE([HAVE_HELPER_H], [1], [found helper.h]) CFLAGS="$CFLAGS -I$location"; LDFLAGS="$LDFLAGS -L$location/helper.a"]) To emulate the manual compilation, I tried removing the -L but that doesn't help: AC_CHECK_HEADER([$location/helper.h], [AC_DEFINE([HAVE_HELPER_H], [1], [found helper.h]) CFLAGS="$CFLAGS -I$location"; LDFLAGS="$LDFLAGS $location/helper.a"]) I tried other combinations and permutations, but I think I might be missing something more fundamental....

    Read the article

  • jquery show hidden div

    - by Fahad
    Firstly, I'm sort of embarrassed asking about this, so many people have already asked this question but even after having gone through so many posts, I'm unable to achieve what I want. Basically, a div, initially hidden, has to be displayed on a button click. I tried hiding the div using display:none and hide() and then displaying it using show(), toggle(), and css("display","block"). Using all sorts of combinations of the above, I was still unable to get the result. Code: <html xmlns="http://www.w3.org/1999/xhtml"> <head runat="server"> <title></title> <link href="css/smoothness/jquery-ui-1.9.2.custom.min.css" rel="stylesheet" type="text/css" /> <script src="jQuery/jquery-1.8.3.min.js" type="text/javascript"></script> <script src="jQuery/jquery-ui-1.9.2.custom.min.js" type="text/javascript"></script> <script type="text/javascript"> $(document).ready(function () { $('#one').hide(); $('#Button1').click(function () { $('#one').toggle(500); }); }); </script> </head> <body> <form id="form1" runat="server"> <div id="one" style="height: 20px;width:200px; background-color: Red; "> </div> <asp:Button ID="Button1" runat="server" Text="Show" /> </form> </body> </html> On button click, the div is shown for a brief second before it disappears again. The same thing happens if I use show() instead of toggle() in the above code. Again the same thing if I set style="display:none" to the div instead of using hide() and then use show() or toggle(). I also tried using $('#one').css("display","block"); but again, the same result. Can anyone please tell me where I'm going wrong. Just started learning jQuery and it is really frustrating when something apparently so simple will not work. Thanks in advance. :)

    Read the article

  • What database table structure should I use for versions, codebases, deployables?

    - by Zac Thompson
    I'm having doubts about my table structure, and I wonder if there is a better approach. I've got a little database for version control repositories (e.g. SVN), the packages (e.g. Linux RPMs) built therefrom, and the versions (e.g. 1.2.3-4) thereof. A given repository might produce no packages, or several, but if there are more than one for a given repository then a particular version for that repository will indicate a single "tag" of the codebase. A particular version "string" might be used to tag a version of the source code in more than one repository, but there may be no relationship between "1.0" for two different repos. So if packages P and Q both come from repo R, then P 1.0 and Q 1.0 are both built from the 1.0 tag of repo R. But if package X comes from repo Y, then X 1.0 has no relationship to P 1.0. In my (simplified) model, I have the following tables (the x_id columns are auto-incrementing surrogate keys; you can pretend I'm using a different primary key if you wish, it's not really important): repository - repository_id - repository_name (unique) ... version - version_id - version_string (unique for a particular repository) - repository_id ... package - package_id - package_name (unique) - repository_id ... This makes it easy for me to see, for example, what are valid versions of a given package: I can join with the version table using the repository_id. However, suppose I would like to add some information to this database, e.g., to indicate which package versions have been approved for release. I certainly need a new table: package_version - version_id - package_id - package_version_released ... Again, the nature of the keys that I use are not really important to my problem, and you can imagine that the data column is "promotion_level" or something if that helps. My doubts arise when I realize that there's really a very close relationship between the version_id and the package_id in my new table ... they must share the same repository_id. Only a small subset of package/version combinations are valid. So I should have some kind of constraint on those columns, enforcing that ... ... I don't know, it just feels off, somehow. Like I'm including somehow more information than I really need? I don't know how to explain my hesitance here. I can't figure out which (if any) normal form I'm violating, but I also can't find an example of a schema with this sort of structure ... not being a DBA by profession I'm not sure where to look. So I'm asking: am I just being overly sensitive?

    Read the article

  • How to make html image clickable inside a TextView

    - by Gonan
    I have the following text in a string in the resources file: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;</a> It shows the image fine (I implemented ImageGetter) but it is not clickable. I have tried adding the Linkify thingy but I don't think it's meant for this case, and so it doesn't work. The setMovementMethod doesn't work either. I have tried different combinations of the above: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;hello</a> Here, even the "hello" part is not clickable (neither blue nor underlined). <a href="mailto:[email protected]"><img src="mail_big" /></a> This doesn't even show the image. &lt;a href="mailto:[email protected]"&gt;&lt;img src="mail_big" /&gt;&lt;/a&gt; If I just write the email, without the <a> tag it works perfectly, but I would like to use the image of an envelope that the user can click on. It's not possible to use an imagebutton because this text is in the middle of a string and so I can't split it. Any ideas? Thanks! EDIT: I found a solution or rather found how to do it correctly. All I had to do was adding the setMovementMethod call before the call to setText in the TextView and ALSO, and COMPLETELY NECESSARY, remove the attribute "android:autoLink="all" from the layout. Apparently, parsing mails and urls in a string is mutually exclusive to interpreting the link tags in a string. So one or the other but not both. Finally my layout is just a TextView with nothing special, just width and height. The activity is like this: TextView tv = (TextView)findViewById(R.id.about_text); tv.setMovementMethod(LinkMovementMethod.getInstance()); tv.setText(Html.fromHtml(getString(R.string.about_content), new ImageGetter(), null)); And the string is like this: <string name="about_content"><a href="mailto:[email protected]"><img src="mail" /></a></string>

    Read the article

  • How can I connect to MSMQ over a workgroup?

    - by cyclotis04
    I'm writing a simple console client-server app using MSMQ. I'm attempting to run it over the workgroup we have set up. They run just fine when run on the same computer, but I can't get them to connect over the network. I've tried adding Direct=, OS:, and a bunch of combinations of other prefaces, but I'm running out of ideas, and obviously don't know the right way to do it. My queue's don't have GUIDs, which is also slightly confusing. Whenever I attempt to connect to a remote machine, I get an invalid queue name message. What do I have to do to make this work? Server: class Program { static string _queue = @"\Private$\qim"; static MessageQueue _mq; static readonly object _mqLock = new object(); static void Main(string[] args) { _queue = Dns.GetHostName() + _queue; lock (_mqLock) { if (!MessageQueue.Exists(_queue)) _mq = MessageQueue.Create(_queue); else _mq = new MessageQueue(_queue); } Console.Write("Starting server at {0}:\n\n", _mq.Path); _mq.Formatter = new BinaryMessageFormatter(); _mq.BeginReceive(new TimeSpan(0, 1, 0), new object(), OnReceive); while (Console.ReadKey().Key != ConsoleKey.Escape) { } _mq.Close(); } static void OnReceive(IAsyncResult result) { Message msg; lock (_mqLock) { try { msg = _mq.EndReceive(result); Console.Write(msg.Body); } catch (Exception ex) { Console.Write("\n" + ex.Message + "\n"); } } _mq.BeginReceive(new TimeSpan(0, 1, 0), new object(), OnReceive); } } Client: class Program { static MessageQueue _mq; static void Main(string[] args) { string queue; while (_mq == null) { Console.Write("Enter the queue name:\n"); queue = Console.ReadLine(); //queue += @"\Private$\qim"; try { if (MessageQueue.Exists(queue)) _mq = new MessageQueue(queue); } catch (Exception ex) { Console.Write("\n" + ex.Message + "\n"); _mq = null; } } Console.Write("Connected. Begin typing.\n\n"); _mq.Formatter = new BinaryMessageFormatter(); ConsoleKeyInfo key = new ConsoleKeyInfo(); while (key.Key != ConsoleKey.Escape) { key = Console.ReadKey(); _mq.Send(key.KeyChar.ToString()); } } }

    Read the article

  • Flash: How to preload upcoming SWF while current one plays

    - by pthesis
    I have a Flash slideshow that plays SWFs listed in an XML file. I would like to have the upcoming SWF load while the current one displays. I've tried all sorts of combinations of LoadMovie and LoadMovieNum, including creating an empty movie clip, but there's something I'm just not getting. Right now, after making the first round through all the files, it transitions smoothly from slide to slide, but I'd like for it to preload so that it transitions without the "Loading..." screen the first time around. It can be viewed here: slideshow Where should I put the LoadMovie line to load the next file (image[p+1]), and how should it look? function loadXML(loaded) { if (loaded) { xmlNode = this.firstChild; image = []; description = []; total = xmlNode.childNodes.length; for (i=0; i<total; i++) { image[i] = xmlNode.childNodes[i].childNodes[0].firstChild.nodeValue; description[i] = xmlNode.childNodes[i].childNodes[1].firstChild.nodeValue; } firstImage(); } else { content = "file not loaded!"; } } xmlData = new XML(); xmlData.ignoreWhite = true; xmlData.onLoad = loadXML; xmlData.load("xmlfile.xml"); ///////////////////////////////////// back_btn.onRelease = function () { backImage(); }; next_btn.onRelease = function () { nextImage(); }; p = 0; function nextImage() { if (p<(total-1)) { p++; trace(this); _root.mc_loadfile.loadMovie (image[p]); _root.movie_name.text = image[p]; next_btn._visible = true; back_btn._visible = true; if (getBytesLoaded() == getBytesTotal()) slideshow(); } else if (p == (total-1)) { p = 0; firstImage(); } } function backImage() { clearInterval(myInterval); if (p>0) { --p; _root.mc_loadfile.loadMovie (image[p]); _root.movie_name.text = image[p]; next_btn._visible = true; if (p != 0) { back_btn._visible = true; } else { back_btn._visible = false; } slideshow(); } } I'd appreciate any help.

    Read the article

  • Refactor a link and an image

    - by Mihail Stoynov
    I have to write an link with an image inside. Instead of explaining, here's the code I have now: <c:if test="${userSession.loggedUser eq null and company.image != null}"> <a onclick="${rich:component('loginPanel')}.show()"> <img src="/download.do?hash=#{company.image.hash}" /> </a> </c:if> <c:if test="${userSession.loggedUser eq null and company.image == null}"> <a onclick="${rich:component('loginPanel')}.show()"> <img src="${request.contextPath}/img/icons/logo_default.jpg" /> </a> </c:if> <c:if test="${userSession.loggedUser ne null and company.image != null}"> <a href="company.xhtml?${company.name}"> <img src="/download.do?hash=#{company.image.hash}" /> </a> </c:if> <c:if test="#{userSession.loggedUser ne null and company.image == null}"> <a href="company.xhtml?${company.name}"> <img src="${request.contextPath}/img/icons/logo_default.jpg" /> </a> </c:if> This code looks awful - there are two exact links with two exact images but combined in all possible combinations. Is there a better way? Is there a way to avoid c:if - it created tables? Update: Bozho proposes: You can replace <c:if and <a with <h:outputLink rendered="#{..}". Apart from that I don't see any other optimization. But it doesn't work. This does not render correctly: <a href=> <h:outputLink rendered="#{..} <h:outputLink rendered="#{..} </a> (the image is outside the anchor) This does render fine: <h:outputLink value=> <h:outputLink rendered="#{..} <h:outputLink rendered="#{..} </a> , but it always adds href and in two of the cases I don't want href when rendered.

    Read the article

  • proper fill an image larger than screen

    - by madcat
    what I wanted to achieve here is simply fit the image width to the screen on both orientations and use UIScrollView to just allow scroll vertically to see the whole image. both viewController and view are created pragmatically. the image loaded is larger than screen on both width and height. here is the related code in my viewController: - (BOOL)shouldAutorotateToInterfaceOrientation:(UIInterfaceOrientation)interfaceOrientation { return YES; } - (void)loadView { UIScreen *screen = [UIScreen mainScreen]; CGRect rect = [screen applicationFrame]; self.view = [[UIView alloc] initWithFrame:rect]; self.view.contentMode = UIViewContentModeScaleAspectFill; self.view.autoresizingMask = UIViewAutoresizingFlexibleWidth | UIViewAutoresizingFlexibleHeight; UIImage *img=[[UIImage alloc] initWithContentsOfFile:[[NSBundle mainBundle] pathForResource:@"image" ofType:@"png"]]; UIImageView *imgView =[[UIImageView alloc] initWithImage:img]; [img release]; imgView.contentMode = UIViewContentModeScaleAspectFill; imgView.autoresizingMask = UIViewAutoresizingFlexibleWidth | UIViewAutoresizingFlexibleHeight; [self.view addSubview:imgView]; [imgView release]; } tried all combinations for both contentMode above, did not give me correct result. the most close I am getting now: I manually resize imgView in loadView, portrait mode would display correctly since app always starts with portrait mode, but in landscape mode, the width fits correctly, but image is centered vertically rather than top aligned. if I add the imgView to a scrollView, in landscape mode it looks like contentSize is not set to full image size. but when I scroll bounce I can see the image is there in full size. question: why I need to resize it manually? in landscape mode how and where I can 'move' the imgView, so imgView.frame.origin is (0,0) and works correctly with a scroll view? Thanks! UPDATE: I added: imgView.clipsToBounds = YES; and find out in landscape mode the image bounds is smaller than screen in height. so the question becomes how to have the image view keeps original ratio (thus shows the full image always) when rotated to landscape? do I need to manually resize it after rotation again?

    Read the article

  • FILE_NOT_FOUND when trying to open COM port C++

    - by Moutabreath
    I am trying to open a com port for reading and writing using C++ but I can't seem to pass the first stage of actually opening it. I get an INVALID_HANDLE_VALUE on the handle with GetLastError FILE_NOT_FOUND. I have searched around the web for a couple of days I'm fresh out of ideas. I have searched through all the questions regarding COM on this website too. I have scanned through the existing ports (or so I believe) to get the name of the port right. I also tried combinations of _T("COM1") with the slashes, without the slashes, with colon, without colon and without the _T I'm using windows 7 on 64 bit machine. this is the code i got I'll be glad for any input on this void SendToCom(char* data, int len) { DWORD cbNeeded = 0; DWORD dwPorts = 0; EnumPorts(NULL, 1, NULL, 0, &cbNeeded, &dwPorts); //What will be the return value BOOL bSuccess = FALSE; LPCSTR COM1 ; BYTE* pPorts = static_cast<BYTE*>(malloc(cbNeeded)); bSuccess = EnumPorts(NULL, 1, pPorts, cbNeeded, &cbNeeded, &dwPorts); if (bSuccess){ PORT_INFO_1* pPortInfo = reinterpret_cast<PORT_INFO_1*>(pPorts); for (DWORD i=0; i<dwPorts; i++) { //If it looks like "COMX" then size_t nLen = _tcslen(pPortInfo->pName); if (nLen > 3) { if ((_tcsnicmp(pPortInfo->pName, _T("COM"), 3) == 0) ){ COM1 =pPortInfo->pName; //COM1 ="\\\\.\\COM1"; HANDLE m_hCommPort = CreateFile( COM1 , GENERIC_READ|GENERIC_WRITE, // access ( read and write) 0, // (share) 0:cannot share the COM port NULL, // security (None) OPEN_EXISTING, // creation : open_existing FILE_FLAG_OVERLAPPED, // we want overlapped operation NULL // no templates file for COM port... ); if (m_hCommPort==INVALID_HANDLE_VALUE) { DWORD err = GetLastError(); if (err == ERROR_FILE_NOT_FOUND) { MessageBox(hWnd,"ERROR_FILE_NOT_FOUND",NULL,MB_ABORTRETRYIGNORE); } else if(err == ERROR_INVALID_NAME) { MessageBox(hWnd,"ERROR_INVALID_NAME",NULL,MB_ABORTRETRYIGNORE); } else { MessageBox(hWnd,"unkown error",NULL,MB_ABORTRETRYIGNORE); } } else{ WriteAndReadPort(m_hCommPort,data); } } pPortInfo++; } } } }

    Read the article

  • Get content in iframe to use as much space as it needs

    - by Mark
    I'm trying to write a simple JavaScript based modal dialog. The JavaScript function takes the content, puts it in a new iframe and adds the iframe to the page. Works great so far, the only problem is that the content of the dialog (e.g. a table) gets wrapped, although plenty of space is available on the page. I'd like the content of the dialog, a table in my case, to use as much space as it needs, without wrapping any lines. I tried lots of combinations of setting width/style.width on the iframe and the table. Nothing did the trick. Here the code to show the iframe dialog: function SimpleDialog() { this.domElement = document.createElement('iframe'); this.domElement.setAttribute('style', 'border: 1px solid red; z-index: 201; position: absolute; top: 0px; left: 0px;'); this.showWithContent = function(content) { document.getElementsByTagName('body')[0].appendChild(this.domElement); this.domElement.contentDocument.body.appendChild(content); var contentBody = this.domElement.contentDocument.body; contentBody.style.padding = '0px'; contentBody.style.margin = '0px'; // Set the iframe size to the size of content. // However, content got wrapped already. this.domElement.style.height = content.offsetHeight + 'px'; this.domElement.style.width = content.offsetWidth + 'px'; this._centerOnScreen(); }; this._centerOnScreen = function() { this.domElement.style.left = window.pageXOffset + (window.innerWidth / 2) - (this.domElement.offsetWidth / 2) + 'px'; this.domElement.style.top = window.pageYOffset + (window.innerHeight / 2) - (this.domElement.offsetHeight / 2) + 'px'; }; } Here the test code: var table = document.createElement('table'); table.setAttribute('style', 'border: 1px solid black; width: 100%;'); table.innerHTML = "<tr><td style='font-size:40px;'>Hello world in big letters</td></tr><tr><td>second row</td></tr>"; var dialog = new SimpleDialog(); dialog.showWithContent(table); The table shows up nicely centered on the page, but the words in the first cell are wrapped to two lines. How do I get the table to use as much space as it needs (without using white-space: nowrap ;) Thanks in advance for any suggestions! -Mark

    Read the article

  • Sorting a list of numbers with modified cost

    - by David
    First, this was one of the four problems we had to solve in a project last year and I couldn’t find a suitable algorithm so we handle in a brute force solution. Problem: The numbers are in a list that is not sorted and supports only one type of operation. The operation is defined as follows: Given a position i and a position j the operation moves the number at position i to position j without altering the relative order of the other numbers. If i j, the positions of the numbers between positions j and i - 1 increment by 1, otherwise if i < j the positions of the numbers between positions i+1 and j decreases by 1. This operation requires i steps to find a number to move and j steps to locate the position to which you want to move it. Then the number of steps required to move a number of position i to position j is i+j. We need to design an algorithm that given a list of numbers, determine the optimal (in terms of cost) sequence of moves to rearrange the sequence. Attempts: Part of our investigation was around NP-Completeness, we make it a decision problem and try to find a suitable transformation to any of the problems listed in Garey and Johnson’s book: Computers and Intractability with no results. There is also no direct reference (from our point of view) to this kind of variation in Donald E. Knuth’s book: The art of Computer Programing Vol. 3 Sorting and Searching. We also analyzed algorithms to sort linked lists but none of them gives a good idea to find de optimal sequence of movements. Note that the idea is not to find an algorithm that orders the sequence, but one to tell me the optimal sequence of movements in terms of cost that organizes the sequence, you can make a copy and sort it to analyze the final position of the elements if you want, in fact we may assume that the list contains the numbers from 1 to n, so we know where we want to put each number, we are just concerned with minimizing the total cost of the steps. We tested several greedy approaches but all of them failed, divide and conquer sorting algorithms can’t be used because they swap with no cost portions of the list and our dynamic programing approaches had to consider many cases. The brute force recursive algorithm takes all the possible combinations of movements from i to j and then again all the possible moments of the rest of the element’s, at the end it returns the sequence with less total cost that sorted the list, as you can imagine the cost of this algorithm is brutal and makes it impracticable for more than 8 elements. Our observations: n movements is not necessarily cheaper than n+1 movements (unlike swaps in arrays that are O(1)). There are basically two ways of moving one element from position i to j: one is to move it directly and the other is to move other elements around i in a way that it reaches the position j. At most you make n-1 movements (the untouched element reaches its position alone). If it is the optimal sequence of movements then you didn’t move the same element twice.

    Read the article

  • passing back answers in prolog

    - by AhmadAssaf
    i have this code than runs perfectly .. returns a true .. when tracing the values are ok .. but its not returning back the answer .. it acts strangely when it ends and always return empty list .. uninstantiated variable .. test :- extend(4,12,[4,3,1,2],[[1,5],[3,4],[6]],_ExtendedBins). %printing basic information about the extend(NumBins,Capacity,RemainingNumbers,BinsSoFar,_ExtendedBins) :- getNumberofBins(BinsSoFar,NumberOfBins), msort(RemainingNumbers,SortedRemaining),nl, format("Current Number of Bins is :~w\n",[NumberOfBins]), format("Allowed Capacity is :~w\n",[Capacity]), format("maximum limit in bin is :~w\n",[NumBins]), format("Trying to fit :~w\n\n",[SortedRemaining]), format("Possible Solutions :\n\n"), fitElements(NumBins,NumberOfBins, Capacity,SortedRemaining,BinsSoFar,[]). %this is were the creation for possibilities will start %will check first if the number of bins allowed is less than then %we create a new list with all the possible combinations %after that we start matching to other bins with capacity constraint fitElements(NumBins,NumberOfBins, Capacity,RemainingNumbers,Bins,ExtendedBins) :- ( NumberOfBins < NumBins -> print('Creating new set: '); print('Sorry, Cannot create New Sets')), createNewList(Capacity,RemainingNumbers,Bins,ExtendedBins). createNewList(Capacity,RemainingNumbers,Bins,ExtendedBins) :- createNewList(Capacity,RemainingNumbers,Bins,[],ExtendedBins), print(ExtendedBins). createNewList(0,Bins,Bins,ExtendedBins,ExtendedBins). createNewList(_,[],_,ExtendedBins,ExtendedBins). createNewList(Capacity,[Element|Rest],Bins,Temp,ExtendedBins) :- conjunct_to_list(Element,ListedElement), append(ListedElement,Temp,NewList), sumlist(NewList,Sum), (Sum =< Capacity, append(ListedElement,ExtendedBins,Result); Capacity = 0), createNewList(Capacity,Rest,Bins,NewList,Result). fit(0,[],ExtendedBins,ExtendedBins). fit(Capacity,[Element|Rest],Bin,ExtendedBins) :- conjunct_to_list(Element,Listed), append(Listed,Bin,NewBin), sumlist(NewBin,Sum), (Sum =< Capacity -> fit(Capacity,Rest,NewBin,ExtendedBins); Capacity = 0, append(NewBin,ExtendedBins,NewExtendedBins), print(NewExtendedBins), fit(0,[],NewBin,ExtendedBins)). %get the number of bins provided getNumberofBins(List,NumberOfBins) :- getNumberofBins(List,0,NumberOfBins). getNumberofBins([],NumberOfBins,NumberOfBins). getNumberofBins([_List|Rest],TempCount,NumberOfBins) :- NewCount is TempCount + 1, %calculate the count getNumberofBins(Rest,NewCount,NumberOfBins). %recursive call %Convert set of terms into a list - used when needed to append conjunct_to_list((A,B), L) :- !, conjunct_to_list(A, L0), conjunct_to_list(B, L1), append(L0, L1, L). conjunct_to_list(A, [A]). Greatly appreciate the help

    Read the article

  • Calling compiled C from R with .C()

    - by Sarah
    I'm trying to call a program (function getNBDensities in the C executable measurementDensities_out) from R. The function is passed several arrays and the variable double runsum. Right now, the getNBDensities function basically does nothing: it prints to screen the values of passed parameters. My problem is the syntax of calling the function: array(.C("getNBDensities", hr = as.double(hosp.rate), # a vector (s x 1) sp = as.double(samplingProbabilities), # another vector (s x 1) odh = as.double(odh), # another vector (s x 1) simCases = as.integer(x[c("xC1","xC2","xC3")]), # another vector (s x 1) obsCases = as.integer(y[c("yC1","yC2","yC3")]), # another vector (s x 1) runsum = as.double(runsum), # double DUP = TRUE, NAOK = TRUE, PACKAGE = "measurementDensities_out")$f, dim = length(y[c("yC1","yC2","yC3")]), dimnames = c("yC1","yC2","yC3")) The error I get, after proper execution of the function (i.e., the right output is printed to screen), is Error in dim(data) <- dim : attempt to set an attribute on NULL I'm unclear what the dimensions are that I should be passing the function: should it be s x 5 + 1 (five vectors of length s and one double)? I've tried all sorts of combinations (including sx5+1) and have found only seemingly conflicting descriptions/examples online of what's supposed to happen here. For those who are interested, the C code is below: #include <R.h> #include <Rmath.h> #include <math.h> #include <Rdefines.h> #include <R_ext/PrtUtil.h> #define NUM_STRAINS 3 #define DEBUG void getNBDensities( double *hr, double *sp, double *odh, int *simCases, int *obsCases, double *runsum ); void getNBDensities( double *hr, double *sp, double *odh, int *simCases, int *obsCases, double *runsum ) { #ifdef DEBUG for ( int s = 0; s < NUM_STRAINS; s++ ) { Rprintf("\nFor strain %d",s); Rprintf("\n\tHospitalization rate = %lg", hr[s]); Rprintf("\n\tSimulation probability = %lg",sp[s]); Rprintf("\n\tSimulated cases = %d",simCases[s]); Rprintf("\n\tObserved cases = %d",obsCases[s]); Rprintf("\n\tOverdispersion parameter = %lg",odh[s]); } Rprintf("\nRunning sum = %lg",runsum[0]); #endif } naive solution While better (i.e., potentially faster or syntactically clearer) solutions may exist (see Dirk's answer below), the following simplification of the code works: out<-.C("getNBDensities", hr = as.double(hosp.rate), sp = as.double(samplingProbabilities), odh = as.double(odh), simCases = as.integer(x[c("xC1","xC2","xC3")]), obsCases = as.integer(y[c("yC1","yC2","yC3")]), runsum = as.double(runsum)) The variables can be accessed in >out.

    Read the article

  • recursion resulting in extra unwanted data

    - by spacerace
    I'm writing a module to handle dice rolling. Given x die of y sides, I'm trying to come up with a list of all potential roll combinations. This code assumes 3 die, each with 3 sides labeled 1, 2, and 3. (I realize I'm using "magic numbers" but this is just an attempt to simplify and get the base code working.) int[] set = { 1, 1, 1 }; list = diceroll.recurse(0,0, list, set); ... public ArrayList<Integer> recurse(int index, int i, ArrayList<Integer> list, int[] set){ if(index < 3){ // System.out.print("\n(looping on "+index+")\n"); for(int k=1;k<=3;k++){ // System.out.print("setting i"+index+" to "+k+" "); set[index] = k; dump(set); recurse(index+1, i, list, set); } } return list; } (dump() is a simple method to just display the contents of list[]. The variable i is not used at the moment.) What I'm attempting to do is increment a list[index] by one, stepping through the entire length of the list and incrementing as I go. This is my "best attempt" code. Here is the output: Bold output is what I'm looking for. I can't figure out how to get rid of the rest. (This is assuming three dice, each with 3 sides. Using recursion so I can scale it up to any x dice with y sides.) [1][1][1] [1][1][1] [1][1][1] [1][1][2] [1][1][3] [1][2][3] [1][2][1] [1][2][2] [1][2][3] [1][3][3] [1][3][1] [1][3][2] [1][3][3] [2][3][3] [2][1][3] [2][1][1] [2][1][2] [2][1][3] [2][2][3] [2][2][1] [2][2][2] [2][2][3] [2][3][3] [2][3][1] [2][3][2] [2][3][3] [3][3][3] [3][1][3] [3][1][1] [3][1][2] [3][1][3] [3][2][3] [3][2][1] [3][2][2] [3][2][3] [3][3][3] [3][3][1] [3][3][2] [3][3][3] I apologize for the formatting, best I could come up with. Any help would be greatly appreciated. (This method was actually stemmed to use the data for something quite trivial, but has turned into a personal challenge. :) edit: If there is another approach to solving this problem I'd be all ears, but I'd also like to solve my current problem and successfully use recursion for something useful.

    Read the article

  • C++ dynamic type construction and detection

    - by KneLL
    There was an interesting problem in C++, but it concerns more likely architecture. There are many (10, 20, 40, etc) classes that describe some characteristics (mix-in classes), for exmaple: struct Base { virtual ~Base() {} }; struct A : virtual public Base { int size; }; struct B : virtual public Base { float x, y; }; struct C : virtual public Base { bool some_bool_state; }; struct D : virtual public Base { string str; } // .... Primary module declares and exports a function (for simplicity just function declarations without classes): // .h file void operate(Base *pBase); // .cpp file void operate(Base *pBase) { // .... } Any other module can has a code like this: #include "mixins.h" #include "primary.h" class obj1_t : public A, public C, public D {}; class obj2_t : public B, public D {}; // ... void Pass() { obj1_t obj1; obj2_t obj2; operate(&obj1); operate(&obj2); } The question is how to know what the real type of given object in operate() without dynamic_cast and any type information in classes (constants, etc)? Function operate() is used with big array of objects in small time periods and dynamic_cast is too slow for it. And I don't want to include constants (enum obj_type { ... }) because this is not OOP-way. // module operate.cpp void some_operate(Base *pBase) { processA(pBase); processB(pBase); } void processA(A *pA) { } void processB(B *pB) { } I cannot directly pass a pBase to these functions. And it's impossible to have all possible combinations of classes, because I can add new classes just by including new .h files. As one of solutions that comed to mind, in editor application I can use a composite container: struct CompositeObject { vector<Base *pBase> parts; }; But editor does not need a time optimization and can use dynamic_cast for parts to determine the exact type. In operate() I cannot use this solution. So, is it possible to not use a dynamic_cast and type information to solve this problem? Or maybe I should use another architecture?

    Read the article

< Previous Page | 35 36 37 38 39 40 41 42 43 44  | Next Page >