Search Results

Search found 39440 results on 1578 pages for 'possible homework'.

Page 39/1578 | < Previous Page | 35 36 37 38 39 40 41 42 43 44 45 46  | Next Page >

  • [java] Returning the element number of the longest string in an array

    - by JohnRoberts
    Hoookay, so. I'm trying to get the longestS method to take the user-inputted array of strings, then return the element number of the longest string in that array. I got it to the point where I was able to return the number of chars in the longest string, but I don't believe that will work for what I need. My problem is that I keep getting incompatible type errors when trying to figure this out. I don't understand the whole data type thing with strings yet. It's confusing me how I go about return a number of the array yet the array is of strings. The main method is fine, I got stuck on the ???? part. { public static void main(String [] args) { Scanner inp = new Scanner( System.in ); String [] responseArr= new String[4]; for (int i=0; i<4; i++) { System.out.println("Enter string "+(i+1)); responseArr[i] = inp.nextLine(); } int highest=longestS(responseArr); } public static int longestS(String[] values) { int largest=0 for( int i = 1; i < values.length; i++ ) { if ( ????? ) } return largest; } }

    Read the article

  • Can someone help with big O notation?

    - by Dann
    void printScientificNotation(double value, int powerOfTen) { if (value >= 1.0 && value < 10.0) { System.out.println(value + " x 10^" + powerOfTen); } else if (value < 1.0) { printScientificNotation(value * 10, powerOfTen - 1); } else // value >= 10.0 { printScientificNotation(value / 10, powerOfTen + 1); } } I understand how the method goes but I cannot figure out a way to represent the method. For example, if value was 0.00000009 or 9e-8, the method will call on printScientificNotation(value * 10, powerOfTen - 1); eight times and System.out.println(value + " x 10^" + powerOfTen); once. So the it is called recursively by the exponent for e. But how do I represent this by big O notation? Thanks!

    Read the article

  • Sum of even fibonacci numbers

    - by user300484
    This is a Project Euler problem. If you don't want to see candidate solutions don't look here. Hello you all! im developping an application that will find the sum of all even terms of the fibonacci sequence. The last term of this sequence is 4,000,000 . There is something wrong in my code but I cannot find the problem since it makes sense to me. Can you please help me? using System.Collections.Generic; using System.Linq; using System.Text; namespace ConsoleApplication1 { class Program { static void Main(string[] args) { long[] arr = new long [1000000] ; long i= 2; arr[i-2]=1; arr[i-1]=2; long n= arr[i]; long s=0; for (i=2 ; n <= 4000000; i++) { arr[i] = arr[(i - 1)] + arr[(i - 2)]; } for (long f = 0; f <= arr.Length - 1; f++) { if (arr[f] % 2 == 0) s += arr[f]; } Console.Write(s); Console.Read(); } } }

    Read the article

  • m:n relationship must have properties?

    - by nax
    I'm doing a E/R model for a project. I finished the ER model and, for me, all is okay. Maybe not perfect, but it's okay. When I gave the ER model to my teacher, he told me this: "the m:n relations MUST HAVE some properties" He said if the m:n relationship doesn't have the properties it will be wrong. In my opinion m:n doesn't need forcer attributes to the relationship, but if you have someone that can fit in it, just put there. What do you think? Who is wrong in this, me, or my teacher? NOTE: Reading again, it seems what he said was not due to my ER diagram, but was a general statement. The diagram I gave him doesn't have relations yet, so there where just entities and atributes.

    Read the article

  • consts and other animals

    - by bks
    Hello i have a cpp code wich i'm having trouble reading. a class B is defined now, i understand the first two lines, but the rest isn't clear enough. is the line "B const * pa2 = pa1" defines a const variable of type class B? if so, what does the next line do? B a2(2); B *pa1 = new B(a2); B const * pa2 = pa1; B const * const pa3 = pa2; also, i'm having trouble figuring out the difference between these two: char const *cst = “abc”; const int ci = 15; thank you

    Read the article

  • Decrypt PHP encrypted string in C#

    - by NotDan
    I have a string encrypted in PHP that I would like to decrypt in C#. I used the tutorial below to do the encryption, but am having problems decrypting. Can anyone post an example on how to do this? http://www.sanity-free.org/131/triple_des_between_php_and_csharp.html

    Read the article

  • Getter/Setter (composition, Java, HW)

    - by Crystal
    I have one class called Person that basically looks like: public class Person { String firstName; String lastName; String telephone; String email; public Person() { firstName = ""; lastName = ""; telephone = ""; email = ""; } public Person(String firstName, String lastName, String telephone, String email) { this.firstName = firstName; this.lastName = lastName; this.telephone = telephone; this.email = email; } public String getFirstName() { return firstName; } public void setFirstName(String firstName) { this.firstName = firstName; } .... Using that class, I setup an abstract class called Loan that looks like: public abstract class Loan { public void setClient(Person client) { this.client = client; } public Person getClient() { return client; } public void setLoanId(int nextId) { loanId = nextId; nextId++; } public int getLoanId() { return loanId; } public void setInterestRate(double interestRate) { this.interestRate = interestRate; } public double getInterestRate() { return interestRate; } public void setLoanLength(int loanLength) { this.loanLength = loanLength; } public int getLoanLength() { return loanLength; } public void setLoanAmount(double loanAmount) { this.loanAmount = loanAmount; } public double getLoanAmount(double loanAmount) { return loanAmount; } private Person client; private int loanId; private double interestRate; private int loanLength; private double loanAmount; private static int nextId = 1; } I have to extend the Loan class with CarLoan and it looks like: public class CarLoan extends Loan { public CarLoan(Person client, double vehiclePrice, double downPayment, double salesTax, double interestRate, CAR_LOAN_TERMS length) { super.setClient(client); super.setInterestRate(interestRate); this.client = client; this.vehiclePrice = vehiclePrice; this.downPayment = downPayment; this.salesTax = salesTax; this.length = length; } public void setVehiclePrice(double vehiclePrice) { this.vehiclePrice = vehiclePrice; } public double getVehiclePrice() { return vehiclePrice; } public void setDownPayment(double downPayment) { this.downPayment = downPayment; } public double getDownPayment() { return downPayment; } public void setSalesTax(double salesTax) { this.salesTax = salesTax; } public double getSalesTax() { return salesTax; } public String toString() { return getClass().getName() + "[vehiclePrice = " + vehiclePrice + '\n' + "downPayment = " + downPayment + '\n' + "salesTax = " + salesTax + "]"; } public enum CAR_LOAN_TERMS {TWO_YEAR, THREE_YEAR, SIX_YEAR}; private double vehiclePrice; private double downPayment; private double salesTax; Few questions. (a) Is what I did in the Loan class to setClient correct given what I have in the Person class? (e.g.this.client = client) (b) Can I call super twice in a method? I have to set two attributes from the Loan class from the constructor in the CarLoan class and I thought that would be a way to do it. (c) Do you have to set attributes for enumeration types differently in a constructor or getter/setter methods? I get an error for (this.length = length) in my CarLoan class and I was unsure of how enumeration values should be set. Thanks!

    Read the article

  • Filtering string in Python

    - by Ecce_Homo
    I am making algorithm for checking the string (e-mail) - like "E-mail addres is valid" but their are rules. First part of e-mail has to be string that has 1-8 characters (can contain alphabet, numbers, underscore [ _ ]...all the parts that e-mail contains) and after @ the second part of e-mail has to have string that has 1-12 characters (also containing all legal expressions) and it has to end with top level domain .com EDIT email = raw_input ("Enter the e-mail address:") length = len (email) if length > 20 print "Address is too long" elif lenght < 5: print "Address is too short" if not email.endswith (".com"): print "Address doesn't contain correct domain ending" first_part = len (splitting[0]) second_part = len(splitting[1]) account = splitting[0] domain = splitting[1] for c in account: if c not in "abcdefghijklmopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ0123456789_.": print "Invalid char", "->", c,"<-", "in account name of e-mail" for c in domain: if c not in "abcdefghijklmopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ0123456789_.": print "Invalid char", "->", c,"<-", "in domain of e-mail" if first_part == 0: print "You need at least 1 character before the @" elif first_part> 8: print "The first part is too long" if second_part == 4: print "You need at least 1 character after the @" elif second_part> 16: print "The second part is too long" else: # if everything is fine return this print "E-mail addres is valid" EDIT: After reproting what is wrong with our input, now I need to make Python recognize valid address and return ("E-mail adress is valid") This is the best i can do with my knowledge....and we cant use regular expressions, teacher said we are going to learn them later.

    Read the article

  • Creating ActionEvent object for CustomButton in Java

    - by Crystal
    For a hw assignment, we were supposed to create a custom button to get familiar with swing and responding to events. We were also to make this button an event source which confuses me. I have an ArrayList to keep track of listeners that would register to listen to my CustomButton. What I am getting confused on is how to notify the listeners. My teacher hinted at having a notify and overriding actionPerformed which I tried doing, but then I wasn't sure how to create an ActionEvent object looking at the constructor documentation. The source, id, string all confuses me. Any help would be appreciated. Thanks! code: import java.awt.*; import java.awt.event.*; import javax.swing.*; import java.util.List; import java.util.ArrayList; public class CustomButton { public static void main(String[] args) { EventQueue.invokeLater(new Runnable() { public void run() { CustomButtonFrame frame = new CustomButtonFrame(); frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); frame.setVisible(true); } }); } public void addActionListener(ActionListener al) { listenerList.add(al); } public void removeActionListener(ActionListener al) { listenerList.remove(al); } public void actionPerformed(ActionEvent e) { System.out.println("Button Clicked!"); } private void notifyListeners() { ActionEvent event = new ActionEvent(CONFUSED HERE!!!!; for (ActionListener action : listenerList) { action.actionPerfomed(event); } } List<ActionListener> listenerList = new ArrayList<ActionListener>(); } class CustomButtonFrame extends JFrame { // constructor for CustomButtonFrame public CustomButtonFrame() { setTitle("Custom Button"); CustomButtonSetup buttonSetup = new CustomButtonSetup(); this.add(buttonSetup); this.pack(); } } class CustomButtonSetup extends JComponent { public CustomButtonSetup() { ButtonAction buttonClicked = new ButtonAction(); this.addMouseListener(buttonClicked); } // because frame includes borders and insets, use this method public Dimension getPreferredSize() { return new Dimension(200, 200); } public void paintComponent(Graphics g) { Graphics2D g2 = (Graphics2D) g; // first triangle coords int x[] = new int[TRIANGLE_SIDES]; int y[] = new int[TRIANGLE_SIDES]; x[0] = 0; y[0] = 0; x[1] = 200; y[1] = 0; x[2] = 0; y[2] = 200; Polygon firstTriangle = new Polygon(x, y, TRIANGLE_SIDES); // second triangle coords x[0] = 0; y[0] = 200; x[1] = 200; y[1] = 200; x[2] = 200; y[2] = 0; Polygon secondTriangle = new Polygon(x, y, TRIANGLE_SIDES); g2.drawPolygon(firstTriangle); g2.setColor(firstColor); g2.fillPolygon(firstTriangle); g2.drawPolygon(secondTriangle); g2.setColor(secondColor); g2.fillPolygon(secondTriangle); // draw rectangle 10 pixels off border int s1[] = new int[RECT_SIDES]; int s2[] = new int[RECT_SIDES]; s1[0] = 5; s2[0] = 5; s1[1] = 195; s2[1] = 5; s1[2] = 195; s2[2] = 195; s1[3] = 5; s2[3] = 195; Polygon rectangle = new Polygon(s1, s2, RECT_SIDES); g2.drawPolygon(rectangle); g2.setColor(thirdColor); g2.fillPolygon(rectangle); } private class ButtonAction implements MouseListener { public void mousePressed(MouseEvent e) { System.out.println("Click!"); firstColor = Color.GRAY; secondColor = Color.WHITE; repaint(); } public void mouseReleased(MouseEvent e) { System.out.println("Released!"); firstColor = Color.WHITE; secondColor = Color.GRAY; repaint(); } public void mouseEntered(MouseEvent e) {} public void mouseExited(MouseEvent e) {} public void mouseClicked(MouseEvent e) {} } public static final int TRIANGLE_SIDES = 3; public static final int RECT_SIDES = 4; private Color firstColor = Color.WHITE; private Color secondColor = Color.DARK_GRAY; private Color thirdColor = Color.LIGHT_GRAY; }

    Read the article

  • Constructor/Destructor involving a class and a struct

    - by Bogdan Maier
    I am working on a program and need to make an array of objects, specifically I have a 31x1 array where each position is an object, (each object is basically built out of 6 ints). Here is what I have but something is wrong and i could use some help thank you. 31x1 struct header" const int days=31; struct Arr{ int days; int *M; }; typedef Arr* Array; 31x1 matrix constructor: void constr(){ int *M; M = new Expe[31]; // Expe is the class class header: class Expe { private: //0-HouseKeeping, 1-Food, 2-Transport, 3-Clothing, 4-TelNet, 5-others int *obj; } Class object constructor: Expe::Expe() { this->obj=new int[6]; } help please... because i`m pretty lost.

    Read the article

  • single user dungeon

    - by mario estes
    hey dudes, my first question anyway, i have made a single user dungeon and am looking to change it in to a multi user dungoen how can i do this by the way im using python to make the sud in to a mud lol

    Read the article

  • What data stucture should I use for BigInt class

    - by user1086004
    I would like to implement a BigInt class which will be able to handle really big numbers. I want only to add and multiply numbers, however the class should also handle negative numbers. I wanted to represent the number as a string, but there is a big overhead with converting string to int and back for adding. I want to implement addition as on the high school, add corresponding order and if the result is bigger than 10, add the carry to next order. Then I thought that it would be better to handle it as a array of unsigned long long int and keep the sign separated by bool. With this I'm afraid of size of the int, as C++ standard as far as I know guarantees only that int < float < double. Correct me if I'm wrong. So when I reach some number I should move in array forward and start adding number to the next array position. Is there any data structure that is appropriate or better for this? Thanks in advance.

    Read the article

  • Writing an Eval Procedure in Scheme?

    - by Planeman
    My problem isn't with the built-in eval procedure but how to create a simplistic version of it. Just for starters I would like to be able to take this in '(+ 1 2) and have it evaluate the expression + where the quote usually takes off the evaluation. I have been thinking about this and found a couple things that might be useful: Unquote: , (quasiquote) (apply) My main problem is regaining the value of + as a procedure and not a symbol. Once I get that I think I should just be able to use it with the other contents of the list. Any tips or guidance would be much appreciated.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Is there a work around for invalid octal digit in an array?

    - by sircrisp
    I'm trying to create an array which will hold the hours in a day so I can loop through it for a clock. I have: int hourArray[24] = {12, 01, 02, 03, 04, 05, 06, 07, 08, 09, 10, 11, 12, 01, 02, 03, 04, 05, 06, 07, 08, 09, 10, 11}; I am getting the error on the following numbers in order 08, 09, 08, 09. It tells me: Error: invalid octal digit I've never run into this before and I'm wondering if there is any way around it?

    Read the article

  • How do I make software that preserves database integrity and correctness? Please help, confused.

    - by user287745
    i have made an application project in vs 08 c#, sql server from vs 08. the database has like 20 tables and many fields in each have made an interface for adding deleting editting and retrieving data according to predefined needs of the users. now i have to 1) make to project in to a software which i can deliver to professor. that is he can just double click the icon and the software simply starts. no vs 08 needed to start the debugging 2) the database will be on one powerful computer (dual core latest everything win xp) and the user will access it from another computer connected using LAN i am able to change the connection string to the shared database using vs 08/ debugger whenever the server changes but how am i supposed to do that when its a software? 3)there will by many clients am i supposed to give the same software to every one, so they all can connect to the database, how will the integrity and correctness of the database be maintained? i mean the db.mdf file will be in a folder which will be shared with read and write access. so its not necessary that only one user will write at a time. so is there any coding for this or? please help me out here i am stuck do not know what to do i have no practical experience, would appreciate all the help thank you

    Read the article

  • My PHP script for sending emails wont send

    - by James
    Well I'm working on a school project, and I uploaded my script to send emails. I'm pretty much using whats defined here: http://www.webcheatsheet.com/PHP/send_email_text_html_attachment.php . Now, all I really changed(other than the contents), is the receiver, to my email address. However, I'm not getting it in my inbox. Is there something else I need? Do I need to do something with the settings on the server(or have my school enable something)?

    Read the article

  • Why does this code sample produce a memory leak?

    - by citronas
    In the university we were given the following code sample and we were being told, that there is a memory leak when running this code. The sample should demonstrate that this is a situation where the garbage collector can't work. As far as my object oriented programming goes, the only codeline able to create a memory leak would be items=Arrays.copyOf(items,2 * size+1); The documentation says, that the elements are copied. Does that mean the reference is copied (and therefore another entry on the heap is created) or the object itself is being copied? As far as I know, Object and therefore Object[] are implemented as a reference type. So assigning a new value to 'items' would allow the garbage collector to find that the old 'item' is no longer referenced and can therefore be collected. In my eyes, this the codesample does not produce a memory leak. Could somebody prove me wrong? =) import java.util.Arrays; public class Foo { private Object[] items; private int size=0; private static final int ISIZE=10; public Foo() { items= new Object[ISIZE]; } public void push(final Object o){ checkSize(); items[size++]=o; } public Object pop(){ if (size==0) throw new ///... return items[--size]; } private void checkSize(){ if (items.length==size){ items=Arrays.copyOf(items,2 * size+1); } } }

    Read the article

  • Lexical Analyzer(Scanner) for Language G by using C/C++

    - by udsha
    int a = 20; int b =30; float c; c = 20 + a; if(c) { a = c*b + a; } else { c = a - b + c; } use C++ / C to Implement a Lexer. 1. Create Unambiguous grammer for language G. 2. Create Lexical Analyzer for Language G. 3. It should identified tokens and lexemes for that language. 4. create a parse tree. 5. to use attribute grammer on a parse tree the values of the intrinsic attributes should be available on the symbol table.

    Read the article

< Previous Page | 35 36 37 38 39 40 41 42 43 44 45 46  | Next Page >