Search Results

Search found 39440 results on 1578 pages for 'possible homework'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 39/1578 | < Previous Page | 35 36 37 38 39 40 41 42 43 44 45 46  | Next Page >

  • What data stucture should I use for BigInt class

    - by user1086004
    I would like to implement a BigInt class which will be able to handle really big numbers. I want only to add and multiply numbers, however the class should also handle negative numbers. I wanted to represent the number as a string, but there is a big overhead with converting string to int and back for adding. I want to implement addition as on the high school, add corresponding order and if the result is bigger than 10, add the carry to next order. Then I thought that it would be better to handle it as a array of unsigned long long int and keep the sign separated by bool. With this I'm afraid of size of the int, as C++ standard as far as I know guarantees only that int < float < double. Correct me if I'm wrong. So when I reach some number I should move in array forward and start adding number to the next array position. Is there any data structure that is appropriate or better for this? Thanks in advance.

    Read the article

  • Where can I find the transaction protocol used by Automated Teller Machines?

    - by Dave
    I'm doing a grad-school software engineering project and I'm looking for the protocol that governs communications between ATMs and bank networks. I've been googling for quite a while now, and though I'm finding all sorts of interesting information about ATMs, I'm surprised to find that there seems to be no industry standard for high-level communications. I'm not talking about 3DES or low-level transmission protocols, but something along the lines of an Interface Control Document; something that governs the sequence of events for various transactions: verify credentials, withdrawal, check balance, etc. Any ideas? Does anything like this even exist? I can't believe that after all this time the banks and ATM manufacturers are still just making this up as they go. A shorter question: if I wanted to go into the ATM software manufacturing business, where would I start looking for standards?

    Read the article

  • Is there a work around for invalid octal digit in an array?

    - by sircrisp
    I'm trying to create an array which will hold the hours in a day so I can loop through it for a clock. I have: int hourArray[24] = {12, 01, 02, 03, 04, 05, 06, 07, 08, 09, 10, 11, 12, 01, 02, 03, 04, 05, 06, 07, 08, 09, 10, 11}; I am getting the error on the following numbers in order 08, 09, 08, 09. It tells me: Error: invalid octal digit I've never run into this before and I'm wondering if there is any way around it?

    Read the article

  • Constructors taking references in C++

    - by sasquatch
    I'm trying to create constructor taking reference to an object. After creating object using reference I need to prints field values of both objects. Then I must delete first object, and once again show values of fields of both objects. My class Person looks like this : class Person { char* name; int age; public: Person(){ int size=0; cout << "Give length of char*" << endl; cin >> size; name = new char[size]; age = 0; } ~Person(){ cout << "Destroying resources" << endl; delete[] name; delete age; } void init(char* n, int a) { name = n; age = a; } }; Here's my implementation (with the use of function show() ). My professor said that if this task is written correctly it will return an error. #include <iostream> using namespace std; class Person { char* name; int age; public: Person(){ int size=0; cout << "Give length of char*" << endl; cin >> size; name = new char[size]; age = 0; } Person(const Person& p){ name = p.name; age = p.age; } ~Person(){ cout << "Destroying resources" << endl; delete[] name; delete age; } void init(char* n, int a) { name = n; age = a; } void show(char* n, int a){ cout << "Name: " << name << "," << "age: " << age << "," << endl; } }; int main(void) { Person *p = new Person; p->init("Mary", 25); p->show(); Person &p = pRef; pRef->name = "Tom"; pRef->age = 18; Person *p2 = new Person(pRef); p->show(); p2->show(); system("PAUSE"); return 0; }

    Read the article

  • [java] Returning the element number of the longest string in an array

    - by JohnRoberts
    Hoookay, so. I'm trying to get the longestS method to take the user-inputted array of strings, then return the element number of the longest string in that array. I got it to the point where I was able to return the number of chars in the longest string, but I don't believe that will work for what I need. My problem is that I keep getting incompatible type errors when trying to figure this out. I don't understand the whole data type thing with strings yet. It's confusing me how I go about return a number of the array yet the array is of strings. The main method is fine, I got stuck on the ???? part. { public static void main(String [] args) { Scanner inp = new Scanner( System.in ); String [] responseArr= new String[4]; for (int i=0; i<4; i++) { System.out.println("Enter string "+(i+1)); responseArr[i] = inp.nextLine(); } int highest=longestS(responseArr); } public static int longestS(String[] values) { int largest=0 for( int i = 1; i < values.length; i++ ) { if ( ????? ) } return largest; } }

    Read the article

  • Picking apples off a tree

    - by John Retallack
    I have the following problem: I am given a tree with N apples, for each apple I am given it's weight and height. I can pick apples up to a given height H, each time I pick an apple the height of every apple is increased with U. I have to find out the maximum weight of apples I can pick. 1 = N = 100000 0 < {H, U, apples' weight and height, maximum weight} < 231 Example: N=4 H=100 U=10 height weight 82 30 91 10 93 5 94 15 The answer is 45: first pick the apple with the weight of 15 then the one with the weight of 30. Could someone help me approach this problem?

    Read the article

  • consts and other animals

    - by bks
    Hello i have a cpp code wich i'm having trouble reading. a class B is defined now, i understand the first two lines, but the rest isn't clear enough. is the line "B const * pa2 = pa1" defines a const variable of type class B? if so, what does the next line do? B a2(2); B *pa1 = new B(a2); B const * pa2 = pa1; B const * const pa3 = pa2; also, i'm having trouble figuring out the difference between these two: char const *cst = “abc”; const int ci = 15; thank you

    Read the article

  • Can someone help with big O notation?

    - by Dann
    void printScientificNotation(double value, int powerOfTen) { if (value >= 1.0 && value < 10.0) { System.out.println(value + " x 10^" + powerOfTen); } else if (value < 1.0) { printScientificNotation(value * 10, powerOfTen - 1); } else // value >= 10.0 { printScientificNotation(value / 10, powerOfTen + 1); } } I understand how the method goes but I cannot figure out a way to represent the method. For example, if value was 0.00000009 or 9e-8, the method will call on printScientificNotation(value * 10, powerOfTen - 1); eight times and System.out.println(value + " x 10^" + powerOfTen); once. So the it is called recursively by the exponent for e. But how do I represent this by big O notation? Thanks!

    Read the article

  • pyschool is wrong ?

    - by geekkid
    I'm currently learning python and trying to do exercises at pyschools (if anyone knows what it is). Anyway, i have an exercise that asks me to do the following : Write a function percent(value, total) that takes in two numbers as arguments, and returns the percentage value as an integer. Here's my code: def percent(value, total): percent = value / total * 100 return int(percent) It works great in my Python Idle and it gives all the correct answers. however, when i run it in the pyschools website, it says that , for example , when the function is called with parameters 46 and 90 , the function returns 0. However, in my python idle , it correctly returns 51. What might be the problem ? Thank you very much for your help!

    Read the article

  • Sum of even fibonacci numbers

    - by user300484
    This is a Project Euler problem. If you don't want to see candidate solutions don't look here. Hello you all! im developping an application that will find the sum of all even terms of the fibonacci sequence. The last term of this sequence is 4,000,000 . There is something wrong in my code but I cannot find the problem since it makes sense to me. Can you please help me? using System.Collections.Generic; using System.Linq; using System.Text; namespace ConsoleApplication1 { class Program { static void Main(string[] args) { long[] arr = new long [1000000] ; long i= 2; arr[i-2]=1; arr[i-1]=2; long n= arr[i]; long s=0; for (i=2 ; n <= 4000000; i++) { arr[i] = arr[(i - 1)] + arr[(i - 2)]; } for (long f = 0; f <= arr.Length - 1; f++) { if (arr[f] % 2 == 0) s += arr[f]; } Console.Write(s); Console.Read(); } } }

    Read the article

  • Getter/Setter (composition, Java, HW)

    - by Crystal
    I have one class called Person that basically looks like: public class Person { String firstName; String lastName; String telephone; String email; public Person() { firstName = ""; lastName = ""; telephone = ""; email = ""; } public Person(String firstName, String lastName, String telephone, String email) { this.firstName = firstName; this.lastName = lastName; this.telephone = telephone; this.email = email; } public String getFirstName() { return firstName; } public void setFirstName(String firstName) { this.firstName = firstName; } .... Using that class, I setup an abstract class called Loan that looks like: public abstract class Loan { public void setClient(Person client) { this.client = client; } public Person getClient() { return client; } public void setLoanId(int nextId) { loanId = nextId; nextId++; } public int getLoanId() { return loanId; } public void setInterestRate(double interestRate) { this.interestRate = interestRate; } public double getInterestRate() { return interestRate; } public void setLoanLength(int loanLength) { this.loanLength = loanLength; } public int getLoanLength() { return loanLength; } public void setLoanAmount(double loanAmount) { this.loanAmount = loanAmount; } public double getLoanAmount(double loanAmount) { return loanAmount; } private Person client; private int loanId; private double interestRate; private int loanLength; private double loanAmount; private static int nextId = 1; } I have to extend the Loan class with CarLoan and it looks like: public class CarLoan extends Loan { public CarLoan(Person client, double vehiclePrice, double downPayment, double salesTax, double interestRate, CAR_LOAN_TERMS length) { super.setClient(client); super.setInterestRate(interestRate); this.client = client; this.vehiclePrice = vehiclePrice; this.downPayment = downPayment; this.salesTax = salesTax; this.length = length; } public void setVehiclePrice(double vehiclePrice) { this.vehiclePrice = vehiclePrice; } public double getVehiclePrice() { return vehiclePrice; } public void setDownPayment(double downPayment) { this.downPayment = downPayment; } public double getDownPayment() { return downPayment; } public void setSalesTax(double salesTax) { this.salesTax = salesTax; } public double getSalesTax() { return salesTax; } public String toString() { return getClass().getName() + "[vehiclePrice = " + vehiclePrice + '\n' + "downPayment = " + downPayment + '\n' + "salesTax = " + salesTax + "]"; } public enum CAR_LOAN_TERMS {TWO_YEAR, THREE_YEAR, SIX_YEAR}; private double vehiclePrice; private double downPayment; private double salesTax; Few questions. (a) Is what I did in the Loan class to setClient correct given what I have in the Person class? (e.g.this.client = client) (b) Can I call super twice in a method? I have to set two attributes from the Loan class from the constructor in the CarLoan class and I thought that would be a way to do it. (c) Do you have to set attributes for enumeration types differently in a constructor or getter/setter methods? I get an error for (this.length = length) in my CarLoan class and I was unsure of how enumeration values should be set. Thanks!

    Read the article

  • Writing an Eval Procedure in Scheme?

    - by Planeman
    My problem isn't with the built-in eval procedure but how to create a simplistic version of it. Just for starters I would like to be able to take this in '(+ 1 2) and have it evaluate the expression + where the quote usually takes off the evaluation. I have been thinking about this and found a couple things that might be useful: Unquote: , (quasiquote) (apply) My main problem is regaining the value of + as a procedure and not a symbol. Once I get that I think I should just be able to use it with the other contents of the list. Any tips or guidance would be much appreciated.

    Read the article

  • single user dungeon

    - by mario estes
    hey dudes, my first question anyway, i have made a single user dungeon and am looking to change it in to a multi user dungoen how can i do this by the way im using python to make the sud in to a mud lol

    Read the article

  • How do I make software that preserves database integrity and correctness? Please help, confused.

    - by user287745
    i have made an application project in vs 08 c#, sql server from vs 08. the database has like 20 tables and many fields in each have made an interface for adding deleting editting and retrieving data according to predefined needs of the users. now i have to 1) make to project in to a software which i can deliver to professor. that is he can just double click the icon and the software simply starts. no vs 08 needed to start the debugging 2) the database will be on one powerful computer (dual core latest everything win xp) and the user will access it from another computer connected using LAN i am able to change the connection string to the shared database using vs 08/ debugger whenever the server changes but how am i supposed to do that when its a software? 3)there will by many clients am i supposed to give the same software to every one, so they all can connect to the database, how will the integrity and correctness of the database be maintained? i mean the db.mdf file will be in a folder which will be shared with read and write access. so its not necessary that only one user will write at a time. so is there any coding for this or? please help me out here i am stuck do not know what to do i have no practical experience, would appreciate all the help thank you

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Creating ActionEvent object for CustomButton in Java

    - by Crystal
    For a hw assignment, we were supposed to create a custom button to get familiar with swing and responding to events. We were also to make this button an event source which confuses me. I have an ArrayList to keep track of listeners that would register to listen to my CustomButton. What I am getting confused on is how to notify the listeners. My teacher hinted at having a notify and overriding actionPerformed which I tried doing, but then I wasn't sure how to create an ActionEvent object looking at the constructor documentation. The source, id, string all confuses me. Any help would be appreciated. Thanks! code: import java.awt.*; import java.awt.event.*; import javax.swing.*; import java.util.List; import java.util.ArrayList; public class CustomButton { public static void main(String[] args) { EventQueue.invokeLater(new Runnable() { public void run() { CustomButtonFrame frame = new CustomButtonFrame(); frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); frame.setVisible(true); } }); } public void addActionListener(ActionListener al) { listenerList.add(al); } public void removeActionListener(ActionListener al) { listenerList.remove(al); } public void actionPerformed(ActionEvent e) { System.out.println("Button Clicked!"); } private void notifyListeners() { ActionEvent event = new ActionEvent(CONFUSED HERE!!!!; for (ActionListener action : listenerList) { action.actionPerfomed(event); } } List<ActionListener> listenerList = new ArrayList<ActionListener>(); } class CustomButtonFrame extends JFrame { // constructor for CustomButtonFrame public CustomButtonFrame() { setTitle("Custom Button"); CustomButtonSetup buttonSetup = new CustomButtonSetup(); this.add(buttonSetup); this.pack(); } } class CustomButtonSetup extends JComponent { public CustomButtonSetup() { ButtonAction buttonClicked = new ButtonAction(); this.addMouseListener(buttonClicked); } // because frame includes borders and insets, use this method public Dimension getPreferredSize() { return new Dimension(200, 200); } public void paintComponent(Graphics g) { Graphics2D g2 = (Graphics2D) g; // first triangle coords int x[] = new int[TRIANGLE_SIDES]; int y[] = new int[TRIANGLE_SIDES]; x[0] = 0; y[0] = 0; x[1] = 200; y[1] = 0; x[2] = 0; y[2] = 200; Polygon firstTriangle = new Polygon(x, y, TRIANGLE_SIDES); // second triangle coords x[0] = 0; y[0] = 200; x[1] = 200; y[1] = 200; x[2] = 200; y[2] = 0; Polygon secondTriangle = new Polygon(x, y, TRIANGLE_SIDES); g2.drawPolygon(firstTriangle); g2.setColor(firstColor); g2.fillPolygon(firstTriangle); g2.drawPolygon(secondTriangle); g2.setColor(secondColor); g2.fillPolygon(secondTriangle); // draw rectangle 10 pixels off border int s1[] = new int[RECT_SIDES]; int s2[] = new int[RECT_SIDES]; s1[0] = 5; s2[0] = 5; s1[1] = 195; s2[1] = 5; s1[2] = 195; s2[2] = 195; s1[3] = 5; s2[3] = 195; Polygon rectangle = new Polygon(s1, s2, RECT_SIDES); g2.drawPolygon(rectangle); g2.setColor(thirdColor); g2.fillPolygon(rectangle); } private class ButtonAction implements MouseListener { public void mousePressed(MouseEvent e) { System.out.println("Click!"); firstColor = Color.GRAY; secondColor = Color.WHITE; repaint(); } public void mouseReleased(MouseEvent e) { System.out.println("Released!"); firstColor = Color.WHITE; secondColor = Color.GRAY; repaint(); } public void mouseEntered(MouseEvent e) {} public void mouseExited(MouseEvent e) {} public void mouseClicked(MouseEvent e) {} } public static final int TRIANGLE_SIDES = 3; public static final int RECT_SIDES = 4; private Color firstColor = Color.WHITE; private Color secondColor = Color.DARK_GRAY; private Color thirdColor = Color.LIGHT_GRAY; }

    Read the article

  • what is the best algorithm to use for this problem

    - by slim
    Equilibrium index of a sequence is an index such that the sum of elements at lower indexes is equal to the sum of elements at higher indexes. For example, in a sequence A: A[0]=-7 A[1]=1 A[2]=5 A[3]=2 A[4]=-4 A[5]=3 A[6]=0 3 is an equilibrium index, because: A[0]+A[1]+A[2]=A[4]+A[5]+A[6] 6 is also an equilibrium index, because: A[0]+A[1]+A[2]+A[3]+A[4]+A[5]=0 (sum of zero elements is zero) 7 is not an equilibrium index, because it is not a valid index of sequence A. If you still have doubts, this is a precise definition: the integer k is an equilibrium index of a sequence if and only if and . Assume the sum of zero elements is equal zero. Write a function int equi(int[] A); that given a sequence, returns its equilibrium index (any) or -1 if no equilibrium indexes exist. Assume that the sequence may be very long.

    Read the article

  • Help with shopping cart in javascript

    - by user228390
    Hey guys, I'm having problems with my shopping cart. What I am trying to do is make a function that will add an item the cart and then and function that will view the cart and show the details. But what I have got so far does not do that, it just simply adds and goes straight to view cart. Also I wanted to store the name of each items in different global arrays (name, price and sum) but I can't get it work that way. Can any help me overcome this problem? Edit: I've tried to get it to work by adding some more items and attaching it to another html page, but now the code does not seem to work at all , before it showed the price and total and now I get nothing . javascript code function round_total (c) { var pennies = c * 100; pennies = Math.round(pennies); var strPennies = "" + pennies; var len = strPennies.length; return parseFloat(strPennies.substring(0, len - 2) + "." + strPennies.substring(len - 2, len)); } // End of round_total function. /* Start of generate_page function. */ function generate_page (form) { tax = 0.08; delivery_p = 2.99; var odate = new Date(); var qty = form.quantity.value; var product_v = new String(form.product.value); var total_price = product_v.substr(product_v.indexOf("$") + 1, product_v.length - product_v.indexOf("$")); var price_without_tax = round_total(qty * total_price); var ttax = round_total(price_without_tax * tax); var delivery = round_total(qty * delivery_p); var total_p = round_total(price_without_tax + ttax + delivery); document.writeln("Quantity: " + qty + "<br>"); document.writeln("Price: $" + total_price + "<br>"); document.writeln("Delivery: $" + delivery + "<br>"); document.writeln("Total: $" + total_p + "<br>"); document.writeln("Order placed on: " + odate.toGMTString()); } function calculate() { round_total (c)(); generate_page (form)(); } HTML code: Shopping cart Welcome, Guest Login Sign Up Stay Updated: Subscribe via RSS Email Updates <div id="header"> <div id="branding" class="container"> <h1>The Finest Toy<br /> Store Online</h1> <p class="desc">If you're looking for a toy shop then look no further.<br/> Go on, treat the kids with our huge selection of<br/>online toy shops selling toys for all ages.</p> </div><!-- end branding --> <div id="navigation"> <ul id="menu" class="container"> <li><a href="#">HOME</a></li> <li><a href="#">ABOUT</a></li> <li><a href="#">Online Store</a></li> <li><a href="#">CONTACT</a></li> </ul> </div><!-- end navigation --> </div><!-- end header --> Shopping Cart Nintendo DS Xbox Product: Console £149.99 Console + Games £169.99 Quantity: Product: Console £149.99 Console + Games £169.99 Quantity:     Playstation 3 Wii Product: Console £149.99 Console + Games £169.99 Quantity:   Product: Console £149.99 Console + Games £169.99 Quantity:        <input type="submit" value="Add to cart" name="submit" onClick="cart()";/><input , type="reset" value="Reset" name="reset" Copyright © 2010 shopping cart. Content and Header © |Back to top Do I need to show my CSS as well? (Sorry about the coding its not working properly for me, its not showing up the way it should be)

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 35 36 37 38 39 40 41 42 43 44 45 46  | Next Page >