Search Results

Search found 39440 results on 1578 pages for 'possible homework'.

Page 39/1578 | < Previous Page | 35 36 37 38 39 40 41 42 43 44 45 46  | Next Page >

  • Convert integer to equivalent number of blank spaces.

    - by mike
    I was wondering what the easiest way is to convert an integer to the equivalent number of blank spaces. I need it for the spaces between nodes when printing a binary search tree. I tried this `int position = printNode.getPosition(); String formatter = "%1"+position+"s%2$s\n"; System.out.format(formatter, "", node.element);` But I am getting almost 3 times as many spaces compared to the int value of position. I'm not really sure if I am formatting the string right either. Any suggestions would be great! If it makes it clearer, say position = 6; I want 6 blank spaces printed before my node element.

    Read the article

  • SQL HAVING COUNT and JOIN

    - by user1833274
    I have tried to this query: What are the doctors that work on less than 2 Hospitals. I have these tables: CREATE TABLE Hospital ( hid INT PRIMARY KEY, name VARCHAR(127) UNIQUE, country VARCHAR(127), area INT ); CREATE TABLE Doctor ( ic INT PRIMARY KEY, name VARCHAR(127), date_of_birth INT, ); CREATE TABLE Work ( hid INT, ic INT, since INT, FOREIGN KEY (hid) REFERENCES Hospital (hid), FOREIGN KEY (ic) REFERENCES Doctor (ic), PRIMARY KEY (hid,ic) ); I tried with this: SELECT DISTINCT D.ic FROM Doctor D, Work W JOIN Hospital H ON (H.hid = W.hid) WHERE D.bi = W.bi GROUP BY (D.ic) HAVING COUNT(H.hid) < 2 ;

    Read the article

  • Fastest way to find sum of digits on big numbers

    - by dada
    I have some big numbers (again) and i need to find if the sum of the digits is an even number. I tried this: finding the sum of the digits with a while loop and then checking if that sum % 2 equals 0 and it's working but it's too slow for big numbers, because i am given intervals of numbers and if the input is 1999999 19999999999 then my program fails, i cannot complete within the time limit which is 0,1 sec. What to do ? Is there any other faster way to do this ? EDIT: The input 1999999 19999999999 means it will start with 1999999 and check all the numbers like i wrote above until 19999999999, and because we are talking about big numbers (< 2^30) my program is not worthy.

    Read the article

  • java.lang.ClassNotFoundException in Netbeans. 5 hours to fix

    - by user1304281
    Hi I've got to submit an interpreter assignment tonight and all of a sudden it stopped working! It was working yesterday but now when I try to create a class instance at runtime I get classnotfoundexception. My project has no libraries or dependencies, I've written everything myself. I've googled around and it seems to be an issue with classpath but I've had no luck fooling with the project properties on netbeans. Here's some code: package interpreter; import interpreter.bytecode.ByteCode; import java.io.*; import java.lang.reflect.*; class ByteCodeLoader { //.... String codeClass = CodeTable.CodeTable.get(args[0]); ByteCode bytecode = (ByteCode)(Class.forName("interpreter.bytecode."+codeClass).newInstance()); //this throws exception } all of my ByteCodes are contained within a subpackage of interpreter called interpreter.bytecode. I'll be watching this thread so I can answer/clarify any questions immediately. Thanks for your time!

    Read the article

  • Getter/Setter (composition, Java, HW)

    - by Crystal
    I have one class called Person that basically looks like: public class Person { String firstName; String lastName; String telephone; String email; public Person() { firstName = ""; lastName = ""; telephone = ""; email = ""; } public Person(String firstName, String lastName, String telephone, String email) { this.firstName = firstName; this.lastName = lastName; this.telephone = telephone; this.email = email; } public String getFirstName() { return firstName; } public void setFirstName(String firstName) { this.firstName = firstName; } .... Using that class, I setup an abstract class called Loan that looks like: public abstract class Loan { public void setClient(Person client) { this.client = client; } public Person getClient() { return client; } public void setLoanId(int nextId) { loanId = nextId; nextId++; } public int getLoanId() { return loanId; } public void setInterestRate(double interestRate) { this.interestRate = interestRate; } public double getInterestRate() { return interestRate; } public void setLoanLength(int loanLength) { this.loanLength = loanLength; } public int getLoanLength() { return loanLength; } public void setLoanAmount(double loanAmount) { this.loanAmount = loanAmount; } public double getLoanAmount(double loanAmount) { return loanAmount; } private Person client; private int loanId; private double interestRate; private int loanLength; private double loanAmount; private static int nextId = 1; } I have to extend the Loan class with CarLoan and it looks like: public class CarLoan extends Loan { public CarLoan(Person client, double vehiclePrice, double downPayment, double salesTax, double interestRate, CAR_LOAN_TERMS length) { super.setClient(client); super.setInterestRate(interestRate); this.client = client; this.vehiclePrice = vehiclePrice; this.downPayment = downPayment; this.salesTax = salesTax; this.length = length; } public void setVehiclePrice(double vehiclePrice) { this.vehiclePrice = vehiclePrice; } public double getVehiclePrice() { return vehiclePrice; } public void setDownPayment(double downPayment) { this.downPayment = downPayment; } public double getDownPayment() { return downPayment; } public void setSalesTax(double salesTax) { this.salesTax = salesTax; } public double getSalesTax() { return salesTax; } public String toString() { return getClass().getName() + "[vehiclePrice = " + vehiclePrice + '\n' + "downPayment = " + downPayment + '\n' + "salesTax = " + salesTax + "]"; } public enum CAR_LOAN_TERMS {TWO_YEAR, THREE_YEAR, SIX_YEAR}; private double vehiclePrice; private double downPayment; private double salesTax; Few questions. (a) Is what I did in the Loan class to setClient correct given what I have in the Person class? (e.g.this.client = client) (b) Can I call super twice in a method? I have to set two attributes from the Loan class from the constructor in the CarLoan class and I thought that would be a way to do it. (c) Do you have to set attributes for enumeration types differently in a constructor or getter/setter methods? I get an error for (this.length = length) in my CarLoan class and I was unsure of how enumeration values should be set. Thanks!

    Read the article

  • Lexical Analyzer(Scanner) for Language G by using C/C++

    - by udsha
    int a = 20; int b =30; float c; c = 20 + a; if(c) { a = c*b + a; } else { c = a - b + c; } use C++ / C to Implement a Lexer. 1. Create Unambiguous grammer for language G. 2. Create Lexical Analyzer for Language G. 3. It should identified tokens and lexemes for that language. 4. create a parse tree. 5. to use attribute grammer on a parse tree the values of the intrinsic attributes should be available on the symbol table.

    Read the article

  • Writing an Eval Procedure in Scheme?

    - by Planeman
    My problem isn't with the built-in eval procedure but how to create a simplistic version of it. Just for starters I would like to be able to take this in '(+ 1 2) and have it evaluate the expression + where the quote usually takes off the evaluation. I have been thinking about this and found a couple things that might be useful: Unquote: , (quasiquote) (apply) My main problem is regaining the value of + as a procedure and not a symbol. Once I get that I think I should just be able to use it with the other contents of the list. Any tips or guidance would be much appreciated.

    Read the article

  • Help with shopping cart in javascript

    - by user228390
    Hey guys, I'm having problems with my shopping cart. What I am trying to do is make a function that will add an item the cart and then and function that will view the cart and show the details. But what I have got so far does not do that, it just simply adds and goes straight to view cart. Also I wanted to store the name of each items in different global arrays (name, price and sum) but I can't get it work that way. Can any help me overcome this problem? Edit: I've tried to get it to work by adding some more items and attaching it to another html page, but now the code does not seem to work at all , before it showed the price and total and now I get nothing . javascript code function round_total (c) { var pennies = c * 100; pennies = Math.round(pennies); var strPennies = "" + pennies; var len = strPennies.length; return parseFloat(strPennies.substring(0, len - 2) + "." + strPennies.substring(len - 2, len)); } // End of round_total function. /* Start of generate_page function. */ function generate_page (form) { tax = 0.08; delivery_p = 2.99; var odate = new Date(); var qty = form.quantity.value; var product_v = new String(form.product.value); var total_price = product_v.substr(product_v.indexOf("$") + 1, product_v.length - product_v.indexOf("$")); var price_without_tax = round_total(qty * total_price); var ttax = round_total(price_without_tax * tax); var delivery = round_total(qty * delivery_p); var total_p = round_total(price_without_tax + ttax + delivery); document.writeln("Quantity: " + qty + "<br>"); document.writeln("Price: $" + total_price + "<br>"); document.writeln("Delivery: $" + delivery + "<br>"); document.writeln("Total: $" + total_p + "<br>"); document.writeln("Order placed on: " + odate.toGMTString()); } function calculate() { round_total (c)(); generate_page (form)(); } HTML code: Shopping cart Welcome, Guest Login Sign Up Stay Updated: Subscribe via RSS Email Updates <div id="header"> <div id="branding" class="container"> <h1>The Finest Toy<br /> Store Online</h1> <p class="desc">If you're looking for a toy shop then look no further.<br/> Go on, treat the kids with our huge selection of<br/>online toy shops selling toys for all ages.</p> </div><!-- end branding --> <div id="navigation"> <ul id="menu" class="container"> <li><a href="#">HOME</a></li> <li><a href="#">ABOUT</a></li> <li><a href="#">Online Store</a></li> <li><a href="#">CONTACT</a></li> </ul> </div><!-- end navigation --> </div><!-- end header --> Shopping Cart Nintendo DS Xbox Product: Console £149.99 Console + Games £169.99 Quantity: Product: Console £149.99 Console + Games £169.99 Quantity:     Playstation 3 Wii Product: Console £149.99 Console + Games £169.99 Quantity:   Product: Console £149.99 Console + Games £169.99 Quantity:        <input type="submit" value="Add to cart" name="submit" onClick="cart()";/><input , type="reset" value="Reset" name="reset" Copyright © 2010 shopping cart. Content and Header © |Back to top Do I need to show my CSS as well? (Sorry about the coding its not working properly for me, its not showing up the way it should be)

    Read the article

  • Java program grading

    - by pasito15
    I've been working on this program for hours and I can't figure out how to get the program to actually print the grades from the scores Text file public class Assign7{ private double finalScore; private double private_quiz1; private double private_quiz2; private double private_midTerm; private double private_final; private final char grade; public Assign7(double finalScore){ private_quiz1 = 1.25; private_quiz2 = 1.25; private_midTerm = 0.25; private_final = 0.50; if (finalScore >= 90) { grade = 'A'; } else if (finalScore >= 80) { grade = 'B'; } else if (finalScore >= 70) { grade = 'C'; } else if (finalScore>= 60) { grade = 'D'; } else { grade = 'F'; } } public String toString(){ return finalScore+":"+private_quiz1+":"+private_quiz2+":"+private_midTerm+":"+private_final; } } this code compiles as well as this one import java.util.*; import java.io.*; public class Assign7Test{ public static void main(String[] args)throws Exception{ int q1,q2; int m = 0; int f = 0; int Record ; String name; Scanner myIn = new Scanner( new File("scores.txt") ); System.out.println( myIn.nextLine() +" avg "+"letter"); while( myIn.hasNext() ){ name = myIn.next(); q1 = myIn.nextInt(); q2 = myIn.nextInt(); m = myIn.nextInt(); f = myIn.nextInt(); Record myR = new Record( name, q1,q2,m,f); System.out.println(myR); } } public static class Record { public Record() { } public Record(String name, int q1, int q2, int m, int f) { } } } once a compile the code i get this which dosent exactly compute the numbers I have in the scores.txt Name quiz1 quiz2 midterm final avg letter Assign7Test$Record@4bcc946b Assign7Test$Record@642423 Exception in thread "main" java.until.InputMismatchException at java.until.Scanner.throwFor(Unknown Source) at java.until.Scanner.next(Unknown Source) at java.until.Scanner.nextInt(Unknown Source) at java.until.Scanner.nextInt(Unknown Source) at Assign7Test.main(Assign7Test.java:25)

    Read the article

  • java programming

    - by Baiba
    ok i have version of t code, please tell me what i need to do when i need to get out of program The INDEX NUMBER OF COLUMN IN WHICH ARE LEAST ZEROS? class Uzd{ public static void main(String args[]){ int mas[][]= {{3,4,7,5,0}, {4,5,3,0,1}, {8,2,4,0,3}, {7,0,2,0,1}, {0,0,1,3,0}}; int nul_mas[] = new int[5]; int nul=0; for(int j=0;j<5;j++){// nul=0; for(int i=0;i<5;i++){ if(mas[i][j]==0){ nul++; } } nul_mas[j]=nul; } for(int i=0;i<5;i++){ for(int j=0;j<5;j++){ System.out.print(mas[i][j]); } System.out.println(); } System.out.println();// atstarpe System.out.println("///zeros in each column///"); for(int i=0;i<5;i++){System.out.print(nul_mas[i]);} System.out.println(); }} and after running it shows: 34750 45301 82403 70201 00130 ///zeros in each column/// But i need not in each column but i need to get out index of column in which zeros are least! in this situation it is column nubmer 2!! 12032

    Read the article

  • Picking apples off a tree

    - by John Retallack
    I have the following problem: I am given a tree with N apples, for each apple I am given it's weight and height. I can pick apples up to a given height H, each time I pick an apple the height of every apple is increased with U. I have to find out the maximum weight of apples I can pick. 1 = N = 100000 0 < {H, U, apples' weight and height, maximum weight} < 231 Example: N=4 H=100 U=10 height weight 82 30 91 10 93 5 94 15 The answer is 45: first pick the apple with the weight of 15 then the one with the weight of 30. Could someone help me approach this problem?

    Read the article

  • Decrypt PHP encrypted string in C#

    - by NotDan
    I have a string encrypted in PHP that I would like to decrypt in C#. I used the tutorial below to do the encryption, but am having problems decrypting. Can anyone post an example on how to do this? http://www.sanity-free.org/131/triple_des_between_php_and_csharp.html

    Read the article

  • A two player game over the intranet..

    - by Santwana
    Hi everybody.. I am a student of 3rd year engineering and only a novice in my programming skills. I need some help with my project.. I wish to develop a two player game to be played over the network (Intranet). I want to develop a simple website with a few html pages for this.My ideas for the project run as follows: 1.People can log in from different systems and check who ever is online on the network currently. the page also shows who is playing with whom. 2.If a person is interested in playing with a player who is currently online, he sends a request of which the other player is somehow notified( using a message or an alert on his profile page..) 3.If the player accepts the request, a game is started. This is exactly where I am clueless.. How can I make them play the game? I need to develop a turn based game with two players, eg chessboard.. how can I do this? The game has to be played live.. and it is time tracked. i need your help with coding the above.. the other features i wish to include are: 4.The game could not be abruptly terminated by any one if the users.The request to terminate the game should be sent to the other player first and only if he accepts can the game be terminated. Whoever wins the game would get a plus 10 on their credit and if he terminated he gets a minus 10. The credits remains constant even if he loses but the success percentage is reduced. 6.The player with highest winning percentage is projected as the player of the week on the home page and he can post a challenge to all others.. I only have an intermediate knowledge of core java and know the basics of Swing and Awt. I am not at all familiar with networking in java right now. I have 5 to 6 weeks of time for developing the project but I hope to learn the things before I start my project. i would prefer to use a lan to illustrate the project and I know only java,jsp,oracle,html and bit of xml to develop my proj. Also I wish to know if I can code this within 6 weeks, would it be too difficult or complicated? Please spare some time to tell me. Please.. please.. I need your suggestions and help.. thank you so much..

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Creating ActionEvent object for CustomButton in Java

    - by Crystal
    For a hw assignment, we were supposed to create a custom button to get familiar with swing and responding to events. We were also to make this button an event source which confuses me. I have an ArrayList to keep track of listeners that would register to listen to my CustomButton. What I am getting confused on is how to notify the listeners. My teacher hinted at having a notify and overriding actionPerformed which I tried doing, but then I wasn't sure how to create an ActionEvent object looking at the constructor documentation. The source, id, string all confuses me. Any help would be appreciated. Thanks! code: import java.awt.*; import java.awt.event.*; import javax.swing.*; import java.util.List; import java.util.ArrayList; public class CustomButton { public static void main(String[] args) { EventQueue.invokeLater(new Runnable() { public void run() { CustomButtonFrame frame = new CustomButtonFrame(); frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); frame.setVisible(true); } }); } public void addActionListener(ActionListener al) { listenerList.add(al); } public void removeActionListener(ActionListener al) { listenerList.remove(al); } public void actionPerformed(ActionEvent e) { System.out.println("Button Clicked!"); } private void notifyListeners() { ActionEvent event = new ActionEvent(CONFUSED HERE!!!!; for (ActionListener action : listenerList) { action.actionPerfomed(event); } } List<ActionListener> listenerList = new ArrayList<ActionListener>(); } class CustomButtonFrame extends JFrame { // constructor for CustomButtonFrame public CustomButtonFrame() { setTitle("Custom Button"); CustomButtonSetup buttonSetup = new CustomButtonSetup(); this.add(buttonSetup); this.pack(); } } class CustomButtonSetup extends JComponent { public CustomButtonSetup() { ButtonAction buttonClicked = new ButtonAction(); this.addMouseListener(buttonClicked); } // because frame includes borders and insets, use this method public Dimension getPreferredSize() { return new Dimension(200, 200); } public void paintComponent(Graphics g) { Graphics2D g2 = (Graphics2D) g; // first triangle coords int x[] = new int[TRIANGLE_SIDES]; int y[] = new int[TRIANGLE_SIDES]; x[0] = 0; y[0] = 0; x[1] = 200; y[1] = 0; x[2] = 0; y[2] = 200; Polygon firstTriangle = new Polygon(x, y, TRIANGLE_SIDES); // second triangle coords x[0] = 0; y[0] = 200; x[1] = 200; y[1] = 200; x[2] = 200; y[2] = 0; Polygon secondTriangle = new Polygon(x, y, TRIANGLE_SIDES); g2.drawPolygon(firstTriangle); g2.setColor(firstColor); g2.fillPolygon(firstTriangle); g2.drawPolygon(secondTriangle); g2.setColor(secondColor); g2.fillPolygon(secondTriangle); // draw rectangle 10 pixels off border int s1[] = new int[RECT_SIDES]; int s2[] = new int[RECT_SIDES]; s1[0] = 5; s2[0] = 5; s1[1] = 195; s2[1] = 5; s1[2] = 195; s2[2] = 195; s1[3] = 5; s2[3] = 195; Polygon rectangle = new Polygon(s1, s2, RECT_SIDES); g2.drawPolygon(rectangle); g2.setColor(thirdColor); g2.fillPolygon(rectangle); } private class ButtonAction implements MouseListener { public void mousePressed(MouseEvent e) { System.out.println("Click!"); firstColor = Color.GRAY; secondColor = Color.WHITE; repaint(); } public void mouseReleased(MouseEvent e) { System.out.println("Released!"); firstColor = Color.WHITE; secondColor = Color.GRAY; repaint(); } public void mouseEntered(MouseEvent e) {} public void mouseExited(MouseEvent e) {} public void mouseClicked(MouseEvent e) {} } public static final int TRIANGLE_SIDES = 3; public static final int RECT_SIDES = 4; private Color firstColor = Color.WHITE; private Color secondColor = Color.DARK_GRAY; private Color thirdColor = Color.LIGHT_GRAY; }

    Read the article

  • errorerror C2059: syntax error : ']', i cant figure out why this coming up in c++

    - by user320950
    void display_totals(); int exam1[100][3];// array that can hold 100 numbers for 1st column int exam2[100][3];// array that can hold 100 numbers for 2nd column int exam3[100][3];// array that can hold 100 numbers for 3rd column int main() { int go,go2,go3; go=read_file_in_array; go2= calculate_total(exam1[],exam2[],exam3[]); go3=display_totals; cout << go,go2,go3; return 0; } void display_totals() { int grade_total; grade_total=calculate_total(exam1[],exam2[],exam3[]); } int calculate_total(int exam1[],int exam2[],int exam3[]) { int calc_tot,above90=0, above80=0, above70=0, above60=0,i,j; calc_tot=read_file_in_array(exam[100][3]); exam1[][]=exam[100][3]; exam2[][]=exam[100][3]; exam3[][]=exam[100][3]; for(i=0;i<100;i++); { if(exam1[i] <=90 && exam1[i] >=100) { above90++; cout << above90; } } return exam1[i],exam2[i],exam3[i]; } int read_file_in_array(int exam[100][3]) { ifstream infile; int num, i=0,j=0; infile.open("grades.txt");// file containing numbers in 3 columns if(infile.fail()) // checks to see if file opended { cout << "error" << endl; } while(!infile.eof()) // reads file to end of line { for(i=0;i<100;i++); // array numbers less than 100 { for(j=0;j<3;j++); // while reading get 1st array or element infile >> exam[i][j]; cout << exam[i][j] << endl; } } infile.close(); return exam[i][j]; }

    Read the article

  • Can't get Jacobi algorithm to work in Objective-C

    - by Chris Long
    Hi, For some reason, I can't get this program to work. I've had other CS majors look at it and they can't figure it out either. This program performs the Jacobi algorithm (you can see step-by-step instructions and a MATLAB implementation here). BTW, it's different from the Wikipedia article of the same name. Since NSArray is one-dimensional, I added a method that makes it act like a two-dimensional C array. After running the Jacobi algorithm many times, the diagonal entries in the NSArray (i[0][0], i[1][1], etc.) are supposed to get bigger and the others approach 0. For some reason though, they all increase exponentially. For instance, i[2][4] should equal 0.0000009, not 9999999, while i[2][2] should be big. Thanks in advance, Chris NSArray+Matrix.m @implementation NSArray (Matrix) @dynamic offValue, transposed; - (double)offValue { double sum = 0.0; for ( MatrixItem *item in self ) if ( item.nonDiagonal ) sum += pow( item.value, 2.0 ); return sum; } - (NSMutableArray *)transposed { NSMutableArray *transpose = [[[NSMutableArray alloc] init] autorelease]; int i, j; for ( i = 0; i < 5; i++ ) { for ( j = 0; j < 5; j++ ) { [transpose addObject:[self objectAtRow:j andColumn:i]]; } } return transpose; } - (id)objectAtRow:(NSUInteger)row andColumn:(NSUInteger)column { NSUInteger index = 5 * row + column; return [self objectAtIndex:index]; } - (NSMutableArray *)multiplyWithMatrix:(NSArray *)array { NSMutableArray *result = [[NSMutableArray alloc] init]; int i = 0, j = 0, k = 0; double value; for ( i = 0; i < 5; i++ ) { value = 0.0; for ( j = 0; j < 5; j++ ) { for ( k = 0; k < 5; k++ ) { MatrixItem *firstItem = [self objectAtRow:i andColumn:k]; MatrixItem *secondItem = [array objectAtRow:k andColumn:j]; value += firstItem.value * secondItem.value; } MatrixItem *item = [[MatrixItem alloc] initWithValue:value]; item.row = i; item.column = j; [result addObject:item]; } } return result; } @end Jacobi_AlgorithmAppDelegate.m // ... - (void)jacobiAlgorithmWithEntry:(MatrixItem *)entry { MatrixItem *b11 = [matrix objectAtRow:entry.row andColumn:entry.row]; MatrixItem *b22 = [matrix objectAtRow:entry.column andColumn:entry.column]; double muPlus = ( b22.value + b11.value ) / 2.0; muPlus += sqrt( pow((b22.value - b11.value), 2.0) + 4.0 * pow(entry.value, 2.0) ); Vector *u1 = [[[Vector alloc] initWithX:(-1.0 * entry.value) andY:(b11.value - muPlus)] autorelease]; [u1 normalize]; Vector *u2 = [[[Vector alloc] initWithX:-u1.y andY:u1.x] autorelease]; NSMutableArray *g = [[[NSMutableArray alloc] init] autorelease]; for ( int i = 0; i <= 24; i++ ) { MatrixItem *item = [[[MatrixItem alloc] init] autorelease]; if ( i == 6*entry.row ) item.value = u1.x; else if ( i == 6*entry.column ) item.value = u2.y; else if ( i == ( 5*entry.row + entry.column ) || i == ( 5*entry.column + entry.row ) ) item.value = u1.y; else if ( i % 6 == 0 ) item.value = 1.0; else item.value = 0.0; [g addObject:item]; } NSMutableArray *firstResult = [[g.transposed multiplyWithMatrix:matrix] autorelease]; matrix = [firstResult multiplyWithMatrix:g]; } // ...

    Read the article

  • How do I make software that preserves database integrity and correctness? Please help, confused.

    - by user287745
    i have made an application project in vs 08 c#, sql server from vs 08. the database has like 20 tables and many fields in each have made an interface for adding deleting editting and retrieving data according to predefined needs of the users. now i have to 1) make to project in to a software which i can deliver to professor. that is he can just double click the icon and the software simply starts. no vs 08 needed to start the debugging 2) the database will be on one powerful computer (dual core latest everything win xp) and the user will access it from another computer connected using LAN i am able to change the connection string to the shared database using vs 08/ debugger whenever the server changes but how am i supposed to do that when its a software? 3)there will by many clients am i supposed to give the same software to every one, so they all can connect to the database, how will the integrity and correctness of the database be maintained? i mean the db.mdf file will be in a folder which will be shared with read and write access. so its not necessary that only one user will write at a time. so is there any coding for this or? please help me out here i am stuck do not know what to do i have no practical experience, would appreciate all the help thank you

    Read the article

  • single user dungeon

    - by mario estes
    hey dudes, my first question anyway, i have made a single user dungeon and am looking to change it in to a multi user dungoen how can i do this by the way im using python to make the sud in to a mud lol

    Read the article

< Previous Page | 35 36 37 38 39 40 41 42 43 44 45 46  | Next Page >