Search Results

Search found 39440 results on 1578 pages for 'possible homework'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 41/1578 | < Previous Page | 37 38 39 40 41 42 43 44 45 46 47 48  | Next Page >

  • Lexical Analyzer(Scanner) for Language G by using C/C++

    - by udsha
    int a = 20; int b =30; float c; c = 20 + a; if(c) { a = c*b + a; } else { c = a - b + c; } use C++ / C to Implement a Lexer. 1. Create Unambiguous grammer for language G. 2. Create Lexical Analyzer for Language G. 3. It should identified tokens and lexemes for that language. 4. create a parse tree. 5. to use attribute grammer on a parse tree the values of the intrinsic attributes should be available on the symbol table.

    Read the article

  • overflow technique in stack

    - by metashockwave
    int main(void) { problem2(); } void doit2(void) { int overflowme[16]; //overflowme[37] =0; } void problem2(void) { int x = 42; doit2(); printf("x is %d\n", x); printf("the address of x is 0x%x\n", &x); } Would someone help me understand why overflowme[37] =0; from the doit2 function will overwrite the value of x? (please include Program Counter and Frame Pointer of the function doit2 in your explanation) Thank you! It works every time with Project properties-Configuration properties-C/C++ -Code Generation-Basic Runtime Checks set to "Default". so it's not an undefined behavior.

    Read the article

  • Returnimng collection of interfaces

    - by apoorv020
    I have created the following interface public interface ISolutionSpace { public boolean isFeasible(); public boolean isSolution(); public Set<ISolutionSpace> generateChildren(); } However, in the implementation of ISolutionSpace in a class called EightQueenSolutionSpace, I am going to return a set of EightQueenSolutionSpace instances, like the following stub: @Override public Set<ISolutionSpace> generateChildren() { return new HashSet<EightQueenSolutionSpace>(); } However this stub wont compile. What changes do I need to make? EDIT: I tried 'HashSet' as well and had tried using the extends keyword. However since 'ISolutionSpace' is an interface and EightQueenSolutionSpace is an implementation(and not a subclass) of 'ISolutionSpace', it is still not working.

    Read the article

  • question about missing element in array

    - by davit-datuashvili
    i have following problem from book introduction algorithm second edition by MIT university problem is following An array A[1 . . n] contains all the integers from 0 to n except one. It would be easy to determine the missing integer in O(n) time by using an auxiliary array B[0 . . n] to record which numbers appear in A. In this problem, however, we cannot access an entire integer in A with a single operation. The elements of A are represented in binary, and the only operation we can use to access them is “fetch the j th bit of A[i],” which takes constant time. Show that if we use only this operation, we can still determine the missing inte- ger in O(n) time please help

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Spinning a circle in J2ME using a Canvas.

    - by JohnQPublic
    Hello all! I have a problem where I need to make a multi-colored wheel spin using a Canvas in J2ME. What I need to do is have the user increase the speed of the spin or slow the spin of the wheel. I have it mostly worked out (I think) but can't think of a way for the wheel to spin without causing my cellphone to crash. Here is what I have so far, it's close but not exactly what I need. class MyCanvas extends Canvas{ //wedgeOne/Two/Three define where this particular section of circle begins to be drawn from int wedgeOne; int wedgeTwo; int wedgeThree; int spinSpeed; MyCanvas(){ wedgeOne = 0; wedgeTwo = 120; wedgeThree = 240; spinSpeed = 0; } //Using the paint method to public void paint(Graphics g){ //Redraw the circle with the current wedge series. g.setColor(255,0,0); g.fillArc(getWidth()/2, getHeight()/2, 100, 100, wedgeOne, 120); g.setColor(0,255,0); g.fillArc(getWidth()/2, getHeight()/2, 100, 100, wedgeTwo, 120); g.setColor(0,0,255); g.fillArc(getWidth()/2, getHeight()/2, 100, 100, wedgeThree, 120); } protected void keyPressed(int keyCode){ switch (keyCode){ //When the 6 button is pressed, the wheel spins forward 5 degrees. case KEY_NUM6: wedgeOne += 5; wedgeTwo += 5; wedgeThree += 5; repaint(); break; //When the 4 button is pressed, the wheel spins backwards 5 degrees. case KEY_NUM4: wedgeOne -= 5; wedgeTwo -= 5; wedgeThree -= 5; repaint(); } } I have tried using a redraw() method that adds the spinSpeed to each of the wedge values while(spinSpeed0) and calls the repaint() method after the addition, but it causes a crash and lockup (I assume due to an infinite loop). Does anyone have any tips or ideas how I could automate the spin so you do not have the press the button every time you want it to spin? (P.S - I have been lurking for a while, but this is my first post. If it's too general or asking for too much info (sorry if it is) and I either remove it or fix it. Thank you!)

    Read the article

  • help implementing All Nearest Smaller Values algorithm

    - by davit-datuashvili
    http://en.wikipedia.org/wiki/All_nearest_smaller_values this is site of the problem and here is my code but i have some trouble to implement it import java.util.*; public class stack{ public static void main(String[]args){ int x[]=new int[]{ 0, 8, 4, 12, 2, 10, 6, 14, 1, 9, 5, 13, 3, 11, 7, 15 }; Stack<Integer> st=new Stack<Integer>(); for (int a:x){ while (!st.empty() && st.pop()>=a){ System.out.println( st.pop()); if (st.empty()){ break; } else{ st.push(a); } } } } } and here is pseudo code from site S = new empty stack data structure for x in the input sequence: while S is nonempty and the top element of S is greater than or equal to x: pop S if S is empty: x has no preceding smaller value else: the nearest smaller value to x is the top element of S push x onto S

    Read the article

  • How to turn this simple 10 digit hex number back into 8 digits?

    - by Babil
    The algorithm to convert input 8 digit hex number into 10 digit are following: Given that the 8 digit number is: '12 34 56 78' x1 = 1 * 16^8 * 2^3 x2 = 2 * 16^7 * 2^2 x3 = 3 * 16^6 * 2^1 x4 = 4 * 16^4 * 2^4 x5 = 5 * 16^3 * 2^3 x6 = 6 * 16^2 * 2^2 x7 = 7 * 16^1 * 2^1 x8 = 8 * 16^0 * 2^0 Final 10 digit hex is: = x1 + x2 + x3 + x4 + x5 + x6 + x7 + x8 = '08 86 42 98 E8' The problem is - how to go back to 8 digit hex from a given 10 digit hex (for example: 08 86 42 98 E8 to 12 34 56 78) Some sample input and output are following: input output 11 11 11 11 08 42 10 84 21 22 22 33 33 10 84 21 8C 63 AB CD 12 34 52 D8 D0 88 64 45 78 96 32 21 4E 84 98 62 FF FF FF FF 7B DE F7 BD EF

    Read the article

  • help implementing algorithm

    - by davit-datuashvili
    http://en.wikipedia.org/wiki/All_nearest_smaller_values this is site of the problem and here is my code but i have some trouble to implement it import java.util.*; public class stack{ public static void main(String[]args){ int x[]=new int[]{ 0, 8, 4, 12, 2, 10, 6, 14, 1, 9, 5, 13, 3, 11, 7, 15 }; Stack<Integer> st=new Stack<Integer>(); for (int a:x){ while (!st.empty() && st.pop()>=a){ System.out.println( st.pop()); if (st.empty()){ break; } else{ st.push(a); } } } } } and here is pseudo code from site S = new empty stack data structure for x in the input sequence: while S is nonempty and the top element of S is greater than or equal to x: pop S if S is empty: x has no preceding smaller value else: the nearest smaller value to x is the top element of S push x onto S

    Read the article

  • Can't get Jacobi algorithm to work in Objective-C

    - by Chris Long
    Hi, For some reason, I can't get this program to work. I've had other CS majors look at it and they can't figure it out either. This program performs the Jacobi algorithm (you can see step-by-step instructions and a MATLAB implementation here). BTW, it's different from the Wikipedia article of the same name. Since NSArray is one-dimensional, I added a method that makes it act like a two-dimensional C array. After running the Jacobi algorithm many times, the diagonal entries in the NSArray (i[0][0], i[1][1], etc.) are supposed to get bigger and the others approach 0. For some reason though, they all increase exponentially. For instance, i[2][4] should equal 0.0000009, not 9999999, while i[2][2] should be big. Thanks in advance, Chris NSArray+Matrix.m @implementation NSArray (Matrix) @dynamic offValue, transposed; - (double)offValue { double sum = 0.0; for ( MatrixItem *item in self ) if ( item.nonDiagonal ) sum += pow( item.value, 2.0 ); return sum; } - (NSMutableArray *)transposed { NSMutableArray *transpose = [[[NSMutableArray alloc] init] autorelease]; int i, j; for ( i = 0; i < 5; i++ ) { for ( j = 0; j < 5; j++ ) { [transpose addObject:[self objectAtRow:j andColumn:i]]; } } return transpose; } - (id)objectAtRow:(NSUInteger)row andColumn:(NSUInteger)column { NSUInteger index = 5 * row + column; return [self objectAtIndex:index]; } - (NSMutableArray *)multiplyWithMatrix:(NSArray *)array { NSMutableArray *result = [[NSMutableArray alloc] init]; int i = 0, j = 0, k = 0; double value; for ( i = 0; i < 5; i++ ) { value = 0.0; for ( j = 0; j < 5; j++ ) { for ( k = 0; k < 5; k++ ) { MatrixItem *firstItem = [self objectAtRow:i andColumn:k]; MatrixItem *secondItem = [array objectAtRow:k andColumn:j]; value += firstItem.value * secondItem.value; } MatrixItem *item = [[MatrixItem alloc] initWithValue:value]; item.row = i; item.column = j; [result addObject:item]; } } return result; } @end Jacobi_AlgorithmAppDelegate.m // ... - (void)jacobiAlgorithmWithEntry:(MatrixItem *)entry { MatrixItem *b11 = [matrix objectAtRow:entry.row andColumn:entry.row]; MatrixItem *b22 = [matrix objectAtRow:entry.column andColumn:entry.column]; double muPlus = ( b22.value + b11.value ) / 2.0; muPlus += sqrt( pow((b22.value - b11.value), 2.0) + 4.0 * pow(entry.value, 2.0) ); Vector *u1 = [[[Vector alloc] initWithX:(-1.0 * entry.value) andY:(b11.value - muPlus)] autorelease]; [u1 normalize]; Vector *u2 = [[[Vector alloc] initWithX:-u1.y andY:u1.x] autorelease]; NSMutableArray *g = [[[NSMutableArray alloc] init] autorelease]; for ( int i = 0; i <= 24; i++ ) { MatrixItem *item = [[[MatrixItem alloc] init] autorelease]; if ( i == 6*entry.row ) item.value = u1.x; else if ( i == 6*entry.column ) item.value = u2.y; else if ( i == ( 5*entry.row + entry.column ) || i == ( 5*entry.column + entry.row ) ) item.value = u1.y; else if ( i % 6 == 0 ) item.value = 1.0; else item.value = 0.0; [g addObject:item]; } NSMutableArray *firstResult = [[g.transposed multiplyWithMatrix:matrix] autorelease]; matrix = [firstResult multiplyWithMatrix:g]; } // ...

    Read the article

  • How do I implement an higher lower game algorithm?

    - by lazorde
    The computer will guess a player’s number between 1 and 100. After each guess the human player should respond “higher”, “lower” or “correct”. Your program should be able to guess the player’s number in no more than 7 tries. Begin by explaining the game to the player, telling him/her to think of a number between 1 and 100. Make the computer do what you would normally do to guess a number in a certain range. Allow the user to respond with “higher”, “lower”, or “correct” after each computer guess. Output the number of tries it took the computer to guess the number. Make the game as user friendly as you can.

    Read the article

  • How to compare two arrays of integers order-insensitively

    - by stdnoit
    I want Java code that can compare in this way (for example): <1 2 3 4> = <3 1 2 4> <1 2 3 4> != <3 4 1 1> I can't use hashmap table or anything; just pure code without library. I know there are two ways. sort them and compare the array index by index use two for loops and compare the outer index with the inner index. I have been trying with this but still not working: for(int i = 0; i < n; i++) { for(int j = 0; j < n; j++) { if(a[i] != a[j] && j == n) return false; } } return true; anything wrong with the code ? thanks

    Read the article

  • Java Sql Udate error, data type missmatch

    - by codo
    I have created a table in ms access. I have set the data type of ID to Auto Number in MS-access. In java when I try to update a record. the netBeans IDE gives me the error of " data type missmatch in criteria expression". But when I changed the ID number that was not in the table already it works well. The code is below. String sql = "Update table1 set price ='" + txtPrice.getText() + "', quantity='" + txtQuantity.getText() + "', description='" + txtDescription.getText() + "' where id= " + txtid.getText() + ""; try { pst = conn.prepareStatement(sql); pst.executeUpdate(); JOptionPane.showMessageDialog(null, "Updated"); UpdateJTable(); } catch (Exception e) { JOptionPane.showMessageDialog(null, e); }

    Read the article

  • C# Finding 2 positions 1-dimArray

    - by Chris
    Hello, In a method i am calculating the longest row of elements. The 1-dim array is filled up with random values (0 or 1). The method looks up the longest row (being 0 or 1, whatever is the longest). Meaning in for example: 1110100 --> the longest row would be 3 (3 * 1) 0110000 --> the longest row would be 4 (4 * 0) My problem is i am trying to perform some type of linear search to show the position of the row in the array. The first example has the longest row of 3 elements (3 times 1). For 1110100 the position in the array would be 0 - 2 (index) For 0110000 the position in the array would be 3 - 6 (index) I have been trying with foreaches, for loops etc..but i cannot seem to get the proper indexes of both. Cannot seem to display both positions properly. For the first example the correct output wouldbe: The largest row of same elements of the array consists of 3 elements on the position 0 - 2. The longest row of elements gets of same elements get calculated as the following: public int BerekenDeelrij (int [] table) ( int count = 0; final int value = 0; int largest = 0; foreach (int value in table) ( if (value == last value) counter + +; else ( largest = Math.Max largest (largest, counter); final value = value count = 1; ) ) Math.Max return (largest, counter); ) Best Regards.

    Read the article

  • Need help with basic optimization problem

    - by ??iu
    I know little of optimization problems, so hopefully this will be didactic for me: rotors = [1, 2, 3, 4...] widgets = ['a', 'b', 'c', 'd' ...] assert len(rotors) == len(widgets) part_values = [ (1, 'a', 34), (1, 'b', 26), (1, 'c', 11), (1, 'd', 8), (2, 'a', 5), (2, 'b', 17), .... ] Given a fixed number of widgets and a fixed number of rotors, how can you get a series of widget-rotor pairs that maximizes the total value where each widget and rotor can only be used once?

    Read the article

  • output all data from db to a php page

    - by Sarit
    Hi, I'm a real beginner with PHP & mysql. Just for studying and for a simple example at school I would like to work this simple query and possibly output all the rows (or maybe even one) to a very basic output on a php page: <?php $user= "root"; $host="localhost"; $password=""; $database = "PetCatalog"; $cxn = mysqli_connect($host,$user,$password,$database) or die ("couldn’t connect to server"); $query = "SELECT * FROM Pet"; $result = mysql_query($cxn,$query) or die ("Couldn’t execute query."); $row = mysqli_fetch_assoc($result); echo "$result"; ?> this is the error message i've been getting: Warning: mysql_query() expects parameter 1 to be string, object given in C:\xampplite\htdocs\myblog\query.php on line 18 Couldn’t execute query. What should I do? Thanks!

    Read the article

  • GoTo statements and alternatives in VB.NET

    - by qais
    I've posted a code snippet on another forum asking for help and people pointed out to me that using GoTo statements is very bad programming practice. I'm wondering: why is it bad? What alternatives to GoTo are there to use in VB.NET that would be considered generally more of a better practice? Consider this snippet below where the user has to input their date of birth. If the month/date/year are invalid or unrealistic(using if statements checking the integer inputs size, if there's a better way to do this, I'd appreciate if you could tell me that also :D) How would I be able to loop back to ask the user again? retryday: Console.WriteLine("Please enter the day you were born : ") day = Console.ReadLine If day > 31 Or day < 1 Then Console.WriteLine("Please enter a valid day") GoTo retryday End If

    Read the article

  • Linked list Recursion ...

    - by epsilon_G
    hey , I'd like to make a recursive function using C++ I make this class class linklist { private: struct node { int data; node *link; }*p; void linklist::print_num(node* p) { if (p != NULL) { cout << p->data << " "; print_num (p->link); } } in the main program what should I write ...

    Read the article

  • Trouble creating a makefile

    - by catia
    Hi everyone! I'm having some trouble making a Makefile. Write now I just compile everything every time. Although, the professor is ok with that, I do want to get it working faster and to avoid unnecessary compiling. Here's what I have. FILES= p6.cpp SetIter.cpp Node.cpp Set.cpp CFLAGS= -ansi -pendantic -Wall -Wextra CC= g++ MakePg6: p6.cpp SetIter.cpp Node.cpp Set.cpp $(CC) $(CFLAGS) $(FILES) -o pg6 Node.cpp - node class Set.cpp - uses nodes. Friend of Node. SetIter.cpp - gets a set and uses a pointer to iterator through I'm confused with some of the depencies arising from the friends thing and the point of lib.o being included in the Makefile as some sites have. Any help is greatly appreciated. Thanks in advance.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 37 38 39 40 41 42 43 44 45 46 47 48  | Next Page >