Search Results

Search found 725 results on 29 pages for 'scanning'.

Page 4/29 | < Previous Page | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >

  • Looking for simple windows scan (multiple pages) to one pdf application?

    - by Troggy
    I would like to find some simple scan software for a windows machine that can scan to pdf, but I would like it to do batch or multiple pages into one big pdf. I saw a couple questions on scan to pdf software, but did not see anything talking about scanning to large multiple page pdf's. EDIT: I am surprised there are not more options out there. Do many of the scanners/all in one devices come with included software that perform this function? EDIT 2: I tried Scan2PDF and it locked up on me multiple times in the middle of the scan job and then gave me non-english error messages. Otherwise, I liked how simple the app was, just select number of pages and hit ok. Any other success stories out there?

    Read the article

  • I need scanning software to use with my scanner.

    - by D Connors
    So, I got this (HP F4280) printer/scanner about a year ago, and I'm really happy with it. The only thing is that I never really liked the HP scanning software that came with it. A few months ago I reformatted and reinstalled windows 7. Then, once I plugged in the printer, I noticed that windows recognized it automatically, and offered to install all the drivers by itself. So instead of manually installing the driver that came in the CD, I simply let windows automatically install it from its servers, and so far it's great. Instead of HP's scanning software (that really wasn't pleasing me), I got a very simplified interface that is more than enough for my ocasional scanning habits. Until today. Today I had to scan a bunch of old pictures for my father. And that simple interface felt like it was lacking quite a few features to make this repetitive task a little easier. And that's why I'm now looking for a good software to use for scanning. By "good" I mean anything well thought out, and specially anything that will make my life easier when repetitive-scanning. It doesn't need to have professional tweaking options, but having them is not a problem either. You guys got anything?

    Read the article

  • How to scan multiple pages from a book under Linux?

    - by rumtscho
    I want the process to look like: I choose the correct scan settings (dpi, color depth, etc) I lay the first page on the scanner and trigger the process The scanner scans the page and waits for me to position the next page correctly I confirm that the next page is ready for scanning Repeat the above two steps until I tell the scanner that there are no more pages to come The scanner saves everything into a single PDF. I tried both xsane and gscan2pdf. First problem: they want me to know how many pages will be scanned. This is already a nuisance, but I can do the counting if needed. The main problem is that in step 3, the scanner does not pause. It is probably optimised for being fed loose sheets. The next scan process is triggered automatically as soon as the CCD has returned to the start position. The time the scanner needs to return the CCD is very short and I can't turn the page and position the book properly. Is there a software which can do the scan process in the way I described above, or did I just miss a setting available in xsane or gscan2pdf to make the scanner pause? If it makes any difference, the scanner is an Epson Stylus SX620FW, I run it using the manufacturer-provided driver.

    Read the article

  • Code Golf: Zigzag pattern scanning

    - by fbrereto
    The Challenge The shortest code by character count that takes a single input integer N (N = 3) and returns an array of indices that when iterated would traverse an NxN matrix according to the JPEG "zigzag" scan pattern. The following is an example traversal over an 8x8 matrix (referenced from here:) Examples (The middle matrix is not part of the input or output, just a representation of the NxN matrix the input represents.) 1 2 3 (Input) 3 --> 4 5 6 --> 1 2 4 7 5 3 6 8 9 (Output) 7 8 9 1 2 3 4 (Input) 4 --> 5 6 7 8 --> 1 2 5 9 6 3 4 7 10 13 14 11 8 12 15 16 (Output) 9 10 11 12 13 14 15 16 Notes: The resulting array's base should be appropriate for your language (e.g., Matlab arrays are 1-based, C++ arrays are 0-based). This is related to this question.

    Read the article

  • Stop MediaScanner scanning of certain directory

    - by kape123
    Is there a way to notify MediaScanner service on Android platform not to scan certain directories? I have application that encrypts images on SD card and after I do that MediaScanner goes wild in LogCat (writing out "not JPEG" exception... and there are time I have over 1000 pics in directory). Thanks

    Read the article

  • Ignore errors when scanning for files in C:\

    - by Shane
    I am trying to search the C:\ drive for all files with a certain extension. I am using the following code which is working fine, however when it encounters an error the whole process stops rather than continuing with the scan. (running in backgroundworker, hence the invoke) Private Sub ScanFiles(ByVal rootFolder As String, ByVal fileExtension As String) 'Determine if the current folder contains any sub folders Dim subFolders() As String = System.IO.Directory.GetDirectories(rootFolder) For Each subFolder As String In subFolders ScanFiles(subFolder, fileExtension) Next For Each file As String In System.IO.Directory.GetFiles(rootFolder, fileExtension) lb.BeginInvoke(New AddValue(AddressOf AddItems), file) Next End Sub How can I make this code continue once an error is encountered? Thanks for your help.

    Read the article

  • iphone scanning a dat file for data

    - by Brodie4598
    I am trying to remake a program I have made in C# in OBJ-C.In C# I used streamreader to search the data file for the line I am looking for then convert that line into a string that I can work with. I have looked at NSScanner but I'm not sure if thats quite waht I'm looking for but I'm by no means a cocoa expert. All I would like to be able to do is have it search a data file for an occurance of a string, then when/if it finds an occurance of that string, it returns the line that string was found on as a string. Any ideas?

    Read the article

  • Controlling QR Code Scanning Actions

    - by Elijah
    I am looking to create a QR code that does the following: When scanned from inside an application, it dislpays a custom alert, (Ex. "You won $5") When scanned with a different QR code reader (non app) it goes to a mobile web page that directs the user to download the application. My main question is: Can you control what happens when a QR code is scanned by a reader that is not your own? (A 'default' action, if you will)

    Read the article

  • Hibernate configuration - session factory scanning?

    - by Marcus
    We have this hibernate.cfg.xml file. Is there a way to tell Hibernate to just scan a directory instead of having to add an entry here for each class? <hibernate-configuration> <session-factory> <mapping class="com.abc.domain.model.A" /> <mapping class="com.abc.domain.model.B" /> <mapping class="com.abc.domain.model.C" /> <mapping class="com.abc.domain.model.D" /> <mapping class="com.abc.domain.model.E" /> </session-factory> </hibernate-configuration>

    Read the article

  • Specify directory for tasks scanning in Netbeans

    - by hsz
    Hello ! Is it possible in Netbeans to specify a list of directories that it should scan for tasks (@todo) ? I want to be able to exclude some subdirectories from my project - for example /lib/Zend - and only allow to scan /lib/Cms /config /app ... Is it possible to do this ?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Scanning string in perl

    - by Alphaneo
    What is the best way to achieve sscanf like functionality in perl? I am looking now looking at the sscanf module, Which is better, Option-1: Going sscanf way? Option-2: Regex way? [I am a beginner when it comes to Regex]

    Read the article

  • C/C++: Scanning a TIFF file using LIBTIFF

    - by Matt07
    My problem is to scan a tiff image in C and get all the pixel value (let's say for saving them in a txt file) in C/C++. I scanned the web and i found a library named "TIFFLIB" that should do what i was looking for. I downloaded it using the ubuntu package manager, but the gcc doesn't recognize the library. How do i link the library to the compiler? Have I installed it correctly? Is there any better/easier way to do that?

    Read the article

  • Lubuntu 14.04 Problem starting lxsession-default-apps

    - by user278179
    I have one problem, I can't execute lxsession-default-apps on Lubuntu 14.04 because I get because said to me "The database is updating, please wait" If I try to run lxsession-default-apps, I get this error: ** Message: utils.vala:30: config_path_directory: /home/USER/.config/lxsession-default-apps ** Message: desktop-files-backend.vala:171: test config_path: /home/USER/.config/lxsession-default-apps/settings.conf ** Message: desktop-files-backend.vala:237: Scanning folder: /usr/share/applications ** Message: desktop-files-backend.vala:278: Start scanning ** Message: desktop-files-backend.vala:257: Scanning folder: /usr/share/app-install/desktop ** Message: desktop-files-backend.vala:278: Start scanning Error: list_files failed: No such file or directory ** Message: desktop-files-backend.vala:333: Finishing scanning ** Message: desktop-files-backend.vala:189: Signal finish scanning with mode: write ** Message: desktop-files-backend.vala:333: Finishing scanning Any help would be appreciated. Thanks. Regards.

    Read the article

  • What is the best way to scan for COM ports in C#?

    - by Jim Fell
    Does C# provide an effective means of scanning the available COM ports? I would like to have a dropdown list in my application wherein the user can select one of the detected COM ports. Creating and populating the dropdown list is not a problem. I just need to know how to scan for the available COM ports using C#. I am using Microsoft Visual C# 2008 Express Edition. Thanks.

    Read the article

  • How to scale page size down in Adobe Acrobat X Pro?

    - by WilliamKF
    I scanned a document on a scanner at a friend's house and the pdf ended up being 35 inches by 45 inches in size. I think this the cause of the trouble had for the person I sent it to, they get the error "insufficient image". How can I scale this down in Adobe Acrobat X Pro to a normal 8.5x11 inch sheet so that I can see if that resolves their issue and I can share the document with them. I cannot rescan the document, as I no longer have it. Acrobat is running on Windows 7 OS. The scanner was an HP OfficeJet Pro L7650 All-in-one.

    Read the article

  • Is my dns server being attacked? And what should I do about it?

    - by Mnebuerquo
    I've been having some intermittent dns problems with a web server, where certain isp's dns servers don't have my hostnames in cache and fail to look them up. At the same time, queries to opendns for those hostnames resolve correctly. It's intermittent, and it always works fine for me, so it's hard to identify the problem when someone reports connectivity problems to my site. In trying to figure this out, I've been looking at my logs to see if there are any errors I should know about. I found thousands of the following messages in my logs, from different ip's, but all requesting similar dns records: May 12 11:42:13 localhost named[26399]: client 94.76.107.2#36141: query (cache) 'burningpianos.com/MX/IN' denied May 12 11:42:13 localhost named[26399]: client 94.76.107.2#29075: query (cache) 'burningpianos.com/MX/IN' denied May 12 11:42:13 localhost named[26399]: client 94.76.107.2#47924: query (cache) 'burningpianos.com/MX/IN' denied May 12 11:42:13 localhost named[26399]: client 94.76.107.2#4727: query (cache) 'burningpianos.com/MX/IN' denied May 12 11:42:14 localhost named[26399]: client 94.76.107.2#16153: query (cache) 'burningpianos.com/MX/IN' denied May 12 11:42:14 localhost named[26399]: client 94.76.107.2#40267: query (cache) 'burningpianos.com/MX/IN' denied May 12 11:43:35 localhost named[26399]: client 82.209.240.241#63507: query (cache) 'burningpianos.com/MX/IN' denied May 12 11:43:35 localhost named[26399]: client 82.209.240.241#63721: query (cache) 'burningpianos.org/MX/IN' denied May 12 11:43:36 localhost named[26399]: client 82.209.240.241#3537: query (cache) 'burningpianos.com/MX/IN' denied I've read of Dan Kaminski's dns cache poisoning vulnerability, and I'm wondering if these log records are an attempt by some evildoer to attack my dns server. There are thousands of records in my logs, all requesting "burningpianos", some for com and some for org, most looking for an mx record. There are requests from multiple ip's, but each ip will request hundreds of times per day. So this smells to me like an attack. What is the defense against this?

    Read the article

  • CentOS Vulnerabilities - Exploits/Payloads

    - by Joao Heleno
    Greetings. I'm doing an academic work where I have to find vulnerabilities in CentOS and show how to take advantage of those same vulnerabilities. I'm no hacker and I'm finding this task to be of great difficulty, that is, I see all the security alerts and their descriptions but no explanation of how to take advantage. Maybe I'm being a little naive but all I want to know is if there is any tool I can use to show that CentOS 5.0 vulnerability XPTO exists and to show it "working". If possible something like CVE-2007-0001 exploit tool, CVE-2007-0002 payload and so on. Thanks.

    Read the article

  • scanner no longer working windows 7

    - by Sackling
    I have a windows 7 64 pro machine that for some reason no longer works with a brother all in one printer/scanner, when I try to scan. This happened seemingly out of nowhere. Printing still works. When I try to scan from photoshop, photoshop crashes. When I try to scan from device manager (which takes a really long time to access the printer) I get an error saying: "operation could not be completed. (error 0x00000015). the device is not ready. I tried uninstalling/reinstalling the printer and drivers. I have also run the brother driver cleaner and then reinstalled and get the same results every time. I had access to another HP all in one. And very strangely When I setup this new printer I have a similar issue that happens. I am able to print but when I try to scan from the HP tool nothing pops up. So my thoughts are it is something to do with the twain driver? But I don't know what to do or check. Any help is appreciated.

    Read the article

  • Has anyone run an objective comparison of Nessus and Skipfish

    - by jldugger
    We recently set up Nessus, but the annual cost is not cheap. Recently Google published SkipFish which appears to compete in the area of webapps. As best I can tell, Nessus operates via a large database of known exploits. And, as best as I can tell, Skipfish automatically generates vulnerability tests. Has anyone done a comparison of the effectiveness of these two approaches yet?

    Read the article

  • How does NMap decide to print a progress line?

    - by Andrew Bolster
    Checking a larger subnet than I normally do; mapping out a cluster suite in a university for a traffic mapping project (permission attained), and I was wondering something. NMap usually prints its progress periodically, but I'm unclear to what that 'periodically' is, because the cirrent scan printed a line for basically every 100th of a percent up to 1% done, then one at 1.5%, and has said nothing since. I suspect that it changes at different 'levels' but does anyone have an actual answer?

    Read the article

  • Finding ALL currently used IP addresses of Website

    - by Patrick R
    What steps would you take to discover all (or close to all) IP addresses that are currently used by a website? How would you be as exhaustive as possible without calling a website admin and asking for the list of IP addresses? ;) nslookup works but will vary based on dns server queried. whois is another good tool. Dig, not bad. Let's use Facebook for example. I'm blocking that site for the majority our our company's users, but some are approved for "research". I can not easily use OpenDNS because we all appear to come from the same request IP address. I could change that but don't want to add more vlans than I already have. I also could use block something like regex facebook1 "facebook\.com" (I'm running a cisco firewall) but that's pretty easy to sidestep. All that being said, I'm asking about specifically about finding ip addresses for a domain and not for other methods that I can block a domain name.

    Read the article

  • How to get a good clean newspaper scan?

    - by itsadok
    I tried a few times to scan newspaper articles, but the images I got were always blotchy and with bad colors (sort of like this). Sometimes I see some really good scans, like this. What is the trick to get such good results? Do I need some high-quality scanner, or do I need some good photoshop filters? If there was something I could do using free tools it would be awesome.

    Read the article

< Previous Page | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >