Search Results

Search found 11961 results on 479 pages for 'boot arguments'.

Page 412/479 | < Previous Page | 408 409 410 411 412 413 414 415 416 417 418 419  | Next Page >

  • Convincing why testing is good

    - by FireAphis
    Hello, In my team of real-time-embedded C/C++ developers, most people don't have any culture of testing their code beyond the casual manual sanity checks. I personally strongly believe in advantages of autonomous automatic tests, but when I try to convince I get some reappearing arguments like: We will spend more time on writing the tests than writing the code. It takes a lot of effort to maintain the tests. Our code is spaghetti; no way we can unit-test it. Our requirement are not sealed – we’ll have to rewrite all the tests every time the requirements are changed. Now, I'd gladly hear any convincing tips and advises, but what I am really looking for are references to researches, articles, books or serious surveys that show (preferably in numbers) how testing is worth the effort. Something like "We in IBM/Microsoft/Google, surveying 3475 active projects, found out that putting 50% more development time into testing decreased by 75% the time spent on fixing bugs" or "after half a year, the time needed to write code with test was only marginally longer than what used to take without tests". Any ideas? P.S.: I'm adding C++ tag too in case someone has a specific experience with convincing this, usually elitist, type of developers :-)

    Read the article

  • Learn Prolog Now! DCG Practice Example

    - by Timothy
    I have been progressing through Learn Prolog Now! as self-study and am now learning about Definite Clause Grammars. I am having some difficulty with one of the Practical Session's tasks. The task reads: The formal language anb2mc2mdn consists of all strings of the following form: an unbroken block of as followed by an unbroken block of bs followed by an unbroken block of cs followed by an unbroken block of ds, such that the a and d blocks are exactly the same length, and the c and d blocks are also exactly the same length and furthermore consist of an even number of cs and ds respectively. For example, ε, abbccd, and aaabbbbccccddd all belong to anb2mc2mdn. Write a DCG that generates this language. I am able to write rules that generate andn, b2mc2m, and even anb2m and c2mndn... but I can't seem to join all these rules into anb2mc2mdn. The following are my rules that can generate andn and b2mc2m. s1 --> []. s1 --> a,s1,d. a --> [a]. d --> [d]. s2 --> []. s2 --> c,c,s2,d,d. c --> [c]. d --> [d]. Is anb2mc2mdn really a CFG, and is it possible to write a DCG using only what was taught in the lesson (no additional arguments or code, etc)? If so, can anyone offer me some guidance how I can join these so that I can solve the given task?

    Read the article

  • recvfrom returns invalid argument when *from* is passed

    - by Aditya Sehgal
    I am currently writing a small UDP server program in linux. The UDP server will receive packets from two different peers and will perform different operations based on from which peer it received the packet. I am trying to determine the source from where I receive the packet. However, when select returns and recvfrom is called, it returns with an error of Invalid Argument. If I pass NULL as the second last arguments, recvfrom succeeds. I have tried declaring fromAddr as struct sockaddr_storage, struct sockaddr_in, struct sockaddr without any success. Is their something wrong with this code? Is this the correct way to determine the source of the packet? The code snippet follows. ` /*TODO : update for TCP. use recv */ if((pkInfo->rcvLen=recvfrom(psInfo->sockFd, pkInfo->buffer, MAX_PKTSZ, 0, /* (struct sockaddr*)&fromAddr,*/ NULL, &(addrLen) )) < 0) { perror("RecvFrom failed\n"); } else { /*Apply Filter */ #if 0 struct sockaddr_in* tmpAddr; tmpAddr = (struct sockaddr_in* )&fromAddr; printf("Received Msg From %s\n",inet_ntoa(tmpAddr->sin_addr)); #endif printf("Packet Received of len = %d\n",pkInfo->rcvLen); } `

    Read the article

  • Google App Engine: TypeError problem with Models

    - by Rosarch
    I'm running Google App Engine on the dev server. Here is my models file: from google.appengine.ext import db import pickle import re re_dept_code = re.compile(r'[A-Z]{2,}') re_course_number = re.compile(r'[0-9]{4}') class DependencyArcHead(db.Model): sink = db.ReferenceProperty() tails = db.ListProperty() class DependencyArcTail(db.Model): courses = db.ListProperty() It gives this error: Traceback (most recent call last): File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 3192, in _HandleRequest self._Dispatch(dispatcher, self.rfile, outfile, env_dict) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 3135, in _Dispatch base_env_dict=env_dict) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 516, in Dispatch base_env_dict=base_env_dict) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 2394, in Dispatch self._module_dict) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 2304, in ExecuteCGI reset_modules = exec_script(handler_path, cgi_path, hook) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 2200, in ExecuteOrImportScript exec module_code in script_module.__dict__ File "main.py", line 19, in <module> from src.Models import Course, findCourse, validateCourse, dictForJSON, clearAndBuildDependencyGraph File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 1279, in Decorate return func(self, *args, **kwargs) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 1929, in load_module return self.FindAndLoadModule(submodule, fullname, search_path) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 1279, in Decorate return func(self, *args, **kwargs) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 1831, in FindAndLoadModule description) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 1279, in Decorate return func(self, *args, **kwargs) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 1782, in LoadModuleRestricted description) File "src\Models.py", line 14, in <module> class DependencyArcHead(db.Model): File "src\Models.py", line 17, in DependencyArcHead tails = db.ListProperty() TypeError: __init__() takes at least 2 arguments (1 given) What am I doing wrong?

    Read the article

  • Should we retire the term "Context"?

    - by MrGumbe
    I'm not sure if there is a more abused term in the world of programming than "Context." A word that has a very clear meaning in the English language has somehow morphed into a hot mess in software development, where the definition where the connotation can be completely different based on what library you happen to be developing in. Tomcat uses the word context to mean the configuration of a web application. Java applets, on the other hand, use an AppletContext to define attributes of the browser and HTML tag that launched it, but the BeanContext is defined as a container. ASP.NET uses the HttpContext object as a grab bag of state - containing information about the current request / response, session, user, server, and application objects. Context Oriented Programming defines the term as "Any information which is computationally accessible may form part of the context upon which behavioral variations depend," which I translate as "anything in the world." The innards of the Windows OS uses the CONTEXT structure to define properties about the hardware environment. The .NET installation classes, however, use the InstallContext property to represent the command line arguments entered to the installation class. The above doesn't even touch how all of us non-framework developers have used the term. I've seen plenty of developers fall into the subconscious trap of "I can't think of anything else to call this class, so I'll name it 'WidgetContext.'" Do you all agree that before naming our class a "Context," we may want to first consider some more descriptive terms? "Environment", "Configuraton", and "ExecutionState" come readily to mind.

    Read the article

  • Getting ellipses function parameters without an initial argument

    - by Tox1k
    So I've been making a custom parser for a scripting language, and I wanted to be able to pass only ellipses arguments. I don't need or want an initial variable, however Microsoft and C seem to want something else. FYI, see bottom for info. I've looked at the va_* definitions #define _crt_va_start(ap,v) ( ap = (va_list)_ADDRESSOF(v) + _INTSIZEOF(v) ) #define _crt_va_arg(ap,t) ( *(t *)((ap += _INTSIZEOF(t)) - _INTSIZEOF(t)) ) #define _crt_va_end(ap) ( ap = (va_list)0 ) and the part I don't want is the v in va_start. As a little background I'm competent in goasm and I know how the stack works so I know what's happening here. I was wondering if there is a way to get the function stack base without having to use inline assembly. Ideas I've had: #define im_va_start(ap) (__asm { mov [ap], ebp }) and etc... but really I feel like that's messy and I'm doing it wrong. struct function_table { const char* fname; (void)(*fptr)(...); unsigned char maxArgs; }; function_table mytable[] = { { "MessageBox", &tMessageBoxA, 4 } }; ... some function that sorts through a const char* passed to it to find the matching function in mytable and calls tMessageBoxA with the params. Also, the maxArgs argument is just so I can check that a valid number of parameters is being sent. I have personal reasons for not wanting to send it in the function, but in the meantime we can just say it's because I'm curious. This is just an example; custom libraries are what I would be implementing so it wouldn't just be calling WinAPI stuff. void tMessageBoxA(...) { // stuff to load args passed MessageBoxA(arg1, arg2, arg3, arg4); } I'm using the __cdecl calling convention and I've looked up ways to reliably get a pointer to the base of the stack (not the top) but I can't seem to find any. Also, I'm not worried about function security or typechecking.

    Read the article

  • ASP.NET Web Application: use 1 or multiple virtual directories

    - by tster
    I am working on a (largish) internal web application which has multiple modules (security, execution, features, reports, etc.). All the pages in the app share navigation, CSS, JS, controls, etc. I want to make a single "Web Application" project, which includes all the pages for the app, then references various projects which will have the database and business logic in them. However, some of the people on the project want to have separate projects for the pages of each module. To make this more clear, this is what I'm advocating to be the projects. /WebInterface* /SecurityLib /ExecutionLib etc... And here is what they are advocating: /SecurityInterface* /SecutiryLib /ExecutionInterface* /ExecutionLib etc... *project will be published to a virtual directory of IIS Basically What I'm looking for is the advantages of both approaches. Here is what I can think of so far: Single Virtual Directory Pros Modules can share a single MasterPage Modules can share UserControls (this will be common) Links to other modules are within the same Virtual directory, and thus don't need to be fully qualified. Less chance of having incompatible module versions together. Multiple Virtual Directories Pros Can publish a new version of a single module without disrupting other modules Module is more compartmentalized. Less likely that changes will break other modules. I don't buy those arguments though. First, using load balanced servers (which we will have) we should be able to publish new versions of the project with zero downtime assuming there are no breaking database changes. Second, If something "breaks" another module, then there is either an improper dependency or the break will show up eventually in the other module, when the developers copy over the latest version of the UserControl, MasterPage or dll. As a point of reference, there are about 10 developers on the project for about 50% of their time. The initial development will be about 9 months.

    Read the article

  • Specifying character

    - by danutenshu
    So below I have a code in C++ that is supposed to invert the arguments in a vector, but not the sequence. I have listed my problems as sidenotes in the code below. The invert function is supposed to invert each argument, and then the main function just outputs the inverted words in same order For instance, program("one two three four")=ruof eerth owt eno #include <iostream> #include <string> using namespace std; int invert(string normal) { string inverted; for (int num=normal.size()-1; num>=0; num--) { inverted.append(normal[num]); //I don't know how to get each character //I need another command for append } return **inverted**; <---- } int main(int argc, char* argv[]) { string text; for (int a=1; a<argc; a++) { text.append(invert(argv[a])); //Can't run the invert function text.append(" "); } cout << text << endl; return 0; }

    Read the article

  • Execute a function to affect different template class instances

    - by Samer Afach
    I have a complicated problem, and I need help. I have a base case, class ParamBase { string paramValue; //... } and a bunch of class templates with different template parameters. template <typename T> class Param : public ParamBase { T value; //... } Now, each instance of Param has different template parameter, double, int, string... etc. To make it easier, I have a vector to their base class pointers that contains all the instances that have been created: vector<ParamBase*> allParamsObjects; The question is: How can I run a single function (global or member or anything, your choice), that converts all of those different instances' strings paramValue with different templates arguments and save the conversion result to the appropriate type in Param::value. This has to be run over all objects that are saved in the vector allParamsObjects. So if the template argument of the first Param is double, paramValue has to be converted to double and saved in value; and if the second Param's argument is int, then the paramValue of the second has to be converted to int and saved in value... etc. I feel it's almost impossible... Any help would be highly appreciated :-)

    Read the article

  • Java data structure suggestion.

    - by techoverflow
    Hi folks, I am a newbie in this field so please excuse my silly mistakes :) So the issue I am facing is: On my webpage, I am displaying a table. For now my issue is concerned with three columns of the table. First is : Area Code Second is : Zone Code Third is: Value The relationship between these three is: 1 Area Code has 6 different Zone code's and all those 6 Zone codes have corresponding "Value" I need a data structer that would give me the flexibility to get a "Value" for a Zone code, which falls under a particular Area code. I have the same zone codes for all the Area codes: Zone codes are: 111, 222, 333, 444, 555, 666 After surfing your stackoverflow, I thought I can go with this structure: Map<Integer, Map<Integer, Double>> retailPrices = new HashMap<Integer, Map<Integer, Double>>(); Map<Integer, Double> codes = new HashMap<Integer, Double>(); where reatailPrices would hold an Area Code and a Map of Zone code as Key and "Value" as Value. but when I am trying to populate this through a SQL resultset, I am getting the following error: The method put(Integer, Map<Integer,Double>) in the type Map is not applicable for the arguments (Integer, Double) on line: `while(oResult.next()) retailPrices.put((new Integer(oResult.getString("AREA"))), (pegPlPrices.put(new Integer(oResult.getString("ZONE_CODE")), new Double(oResult.getString("VALUE"))))); }` please help me figure out this problem. Am I following the right approach?

    Read the article

  • Scala: Correcting type inference of representation type over if statement

    - by drhagen
    This is a follow-up to two questions on representation types, which are type parameters of a trait designed to represent the type underlying a bounded type member (or something like that). I've had success creating instances of classes, e.g ConcreteGarage, that have instances cars of bounded type members CarType. trait Garage { type CarType <: Car[CarType] def cars: Seq[CarType] def copy(cars: Seq[CarType]): Garage def refuel(car: CarType, fuel: CarType#FuelType): Garage = copy( cars.map { case `car` => car.refuel(fuel) case other => other }) } class ConcreteGarage[C <: Car[C]](val cars: Seq[C]) extends Garage { type CarType = C def copy(cars: Seq[C]) = new ConcreteGarage(cars) } trait Car[C <: Car[C]] { type FuelType <: Fuel def fuel: FuelType def copy(fuel: C#FuelType): C def refuel(fuel: C#FuelType): C = copy(fuel) } class Ferrari(val fuel: Benzin) extends Car[Ferrari] { type FuelType = Benzin def copy(fuel: Benzin) = new Ferrari(fuel) } class Mustang(val fuel: Benzin) extends Car[Mustang] { type FuelType = Benzin def copy(fuel: Benzin) = new Mustang(fuel) } trait Fuel case class Benzin() extends Fuel I can easily create instances of Cars like Ferraris and Mustangs and put them into a ConcreteGarage, as long as it's simple: val newFerrari = new Ferrari(Benzin()) val newMustang = new Mustang(Benzin()) val ferrariGarage = new ConcreteGarage(Seq(newFerrari)) val mustangGarage = new ConcreteGarage(Seq(newMustang)) However, if I merely return one or the other, based on a flag, and try to put the result into a garage, it fails: val likesFord = true val new_car = if (likesFord) newFerrari else newMustang val switchedGarage = new ConcreteGarage(Seq(new_car)) // Fails here The switch alone works fine, it is the call to ConcreteGarage constructor that fails with the rather mystical error: error: inferred type arguments [this.Car[_ >: this.Ferrari with this.Mustang <: this.Car[_ >: this.Ferrari with this.Mustang <: ScalaObject]{def fuel: this.Benzin; type FuelType<: this.Benzin}]{def fuel: this.Benzin; type FuelType<: this.Benzin}] do not conform to class ConcreteGarage's type parameter bounds [C <: this.Car[C]] val switchedGarage = new ConcreteGarage(Seq(new_car)) // Fails here ^ I have tried putting those magic [C <: Car[C]] representation type parameters everywhere, but without success in finding the magic spot.

    Read the article

  • Breaking dependencies when you can't make changes to other files?

    - by codemuncher
    I'm doing some stealth agile development on a project. The lead programmer sees unit testing, refactoring, etc as a waste of resources and there is no way to convince him otherwise. His philosophy is "If it ain't broke don't fix it" and I understand his point of view. He's been working on the project for over a decade and knows the code inside and out. I'm not looking to debate development practices. I'm new to the project and I've been tasked with adding a new feature. I've worked on legacy projects before and used agile development practices with good result but those teams were more receptive to the idea and weren't afraid of making changes to code. I've been told I can use whatever development methodology I want but I have to limit my changes to only those necessary to add the feature. I'm using tdd for the new classes I'm writing but I keep running into road blocks caused by the liberal use of global variables and the high coupling in the classes I need to interact with. Normally I'd start extracting interfaces for these classes and make their dependence on the global variables explicit by injecting them as constructor arguments or public properties. I could argue that the changes are necessary but considering the lead never had to make them I doubt he would see it my way. What techniques can I use to break these dependencies without ruffling the lead developer's feathers? I've made some headway using: Extract Interface (for the new classes I'm creating) Extend and override the wayward classes with test stubs. (luckily most methods are public virtual) But these two can only get me so far.

    Read the article

  • Why is my Scala function returning type Unit and not whatever is the last line?

    - by Andy
    I am trying to figure out the issue, and tried different styles that I have read on Scala, but none of them work. My code is: .... val str = "(and x y)"; def stringParse ( exp: String, pos: Int, expreshHolder: ArrayBuffer[String], follow: Int ) var b = pos; //position of where in the expression String I am currently in val temp = expreshHolder; //holder of expressions without parens var arrayCounter = follow; //just counts to make sure an empty spot in the array is there to put in the strings if(exp(b) == '(') { b = b + 1; while(exp(b) == ' '){b = b + 1} //point of this is to just skip any spaces between paren and start of expression type if(exp(b) == 'a') { temp(arrayCounter) = exp(b).toString; b = b+1; temp(arrayCounter)+exp(b).toString; b = b+1; temp(arrayCounter) + exp(b).toString; arrayCounter+=1} temp; } } val hold: ArrayBuffer[String] = stringParse(str, 0, new ArrayBuffer[String], 0); for(test <- hold) println(test); My error is: Driver.scala:35: error: type mismatch; found : Unit required: scala.collection.mutable.ArrayBuffer[String] ho = stringParse(str, 0, ho, 0); ^one error found When I add an equals sign after the arguments in the method declaration, like so: def stringParse ( exp: String, pos: Int, expreshHolder: ArrayBuffer[String], follow: Int ) ={....} It changes it to "Any". I am confused on how this works. Any ideas? Much appreciated.

    Read the article

  • C: incompatible types in assignment

    - by The.Anti.9
    I'm writing a program to check to see if a port is open in C. One line in particular copies one of the arguments to a char array. However, when I try to compile, it says: error: incompatible types in assignment Heres the code. The error is on the assignment of addr #include <sys/socket.h> #include <sys/time.h> #include <sys/types.h> #include <arpa/inet.h> #include <netinet/in.h> #include <errno.h> #include <fcntl.h> #include <stdio.h> #include <netdb.h> #include <stdlib.h> #include <string.h> #include <unistd.h> int main(int argc, char **argv) { u_short port; /* user specified port number */ char addr[1023]; /* will be a copy of the address entered by u */ struct sockaddr_in address; /* the libc network address data structure */ short int sock = -1; /* file descriptor for the network socket */ port = atoi(argv[1]); addr = strncpy(addr, argv[2], 1023); bzero((char *)&address, sizeof(address)); /* init addr struct */ address.sin_addr.s_addr = inet_addr(addr); /* assign the address */ address.sin_port = htons(port); /* translate int2port num */ sock = socket(AF_INET, SOCK_STREAM, 0); if (connect(sock,(struct sockaddr *)&address,sizeof(address)) == 0) { printf("%i is open\n", port); } if (errno == 113) { fprintf(stderr, "Port not open!\n"); } close(sock); return 0; } I'm new to C, so I'm not sure why it would do this.

    Read the article

  • converting code from non-(C)ontinuation (P)assing (S)tyle to CPS

    - by Delirium tremens
    before: function sc_startSiteCompare(){ var visitinguri; var validateduri; var downloaduris; var compareuris; var tryinguri; sc_setstatus('started'); visitinguri = sc_getvisitinguri(); validateduri = sc_getvalidateduri(visitinguri); downloaduris = new Array(); downloaduris = sc_generatedownloaduris(validateduri); compareuris = new Array(); compareuris = sc_generatecompareuris(validateduri); tryinguri = 0; sc_finishSiteCompare(downloaduris, compareuris, tryinguri); } function sc_getvisitinguri() { var visitinguri; visitinguri = content.location.href; return visitinguri; } after (I'm trying): function sc_startSiteCompare(){ var visitinguri; sc_setstatus('started'); visitinguri = sc_getvisitinguri(sc_startSiteComparec1); } function sc_startSiteComparec1 (visitinguri) { var validateduri; validateduri = sc_getvalidateduri(visitinguri, sc_startSiteComparec2); } function sc_startSiteComparec2 (visitinguri, c) { var downloaduris; downloaduris = sc_generatedownloaduris(validateduri, sc_startSiteComparec3); } function sc_startSiteComparec3 (validateduri, c) { var compareuris; compareuris = sc_generatecompareuris(downloaduris, validateduri, sc_startSiteComparec4); } function sc_startSiteComparec4 (downloaduris, compareuris, validateduri, c) { var tryinguri; tryinguri = 0; sc_finishSiteCompare(downloaduris, compareuris, tryinguri); } function sc_getvisitinguri(c) { var visitinguri; visitinguri = content.location.href; c(visitinguri); } I'm having to pass lots of arguments to functions now. global in procedural code look like this / self in modular code. Any difference? Will I really have to use OO now? As a last resort, does CPS have an alternative?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Saving ntext data from SQL Server to file directory using asp

    - by April
    A variety of files (pdf, images, etc.) are stored in a ntext field on a MS SQL Server. I am not sure what type is in this field, other than it shows question marks and undefined characters, I am assuming they are binary type. The script is supposed to iterate through the rows and extract and save these files to a temp directory. "filename" and "contenttype" are given, and "data" is whatever is in the ntext field. I have tried several solutions: 1) data.SaveToFile "/temp/"&filename, 2 Error: Object required: '????????????????????' ??? 2) File.WriteAllBytes "/temp/"&filename, data Error: Object required: 'File' I have no idea how to import this, or the Server for MapPath. (Cue: what a noob!) 3) Const adTypeBinary = 1 Const adSaveCreateOverWrite = 2 Dim BinaryStream Set BinaryStream = CreateObject("ADODB.Stream") BinaryStream.Type = adTypeBinary BinaryStream.Open BinaryStream.Write data BinaryStream.SaveToFile "C:\temp\" & filename, adSaveCreateOverWrite Error: Arguments are of the wrong type, are out of acceptable range, or are in conflict with one another. 4) Response.ContentType = contenttype Response.AddHeader "content-disposition","attachment;" & filename Response.BinaryWrite data response.end This works, but the file should be saving to the server instead of popping up save-as dialog. I am not sure if there is a way to save the response to file. Thanks for shedding light on any of these problems!

    Read the article

  • Haskell quiz: a simple function

    - by levy
    I'm not a Haskell programmer, but I'm curious about the following questions. Informal function specification: Let MapProduct be a function that takes a function called F and multiple lists. It returns a list containing the results of calling F with one argument from each list in each possible combination. Example: Call MapProduct with F being a function that simply returns a list of its arguments, and two lists. One of the lists contains the integers 1 and 2, the other one contains the strings "a" and "b". It should return a list that contains the lists: 1 and "a", 1 and "b", 2 and "a", 2 and "b". Questions: How is MapProduct implemented? What is the function's type? What is F's type? Can one guess what the function does just by looking at its type? Can you handle inhomogeneous lists as input? (e.g. 1 and "a" in one of the input lists) What extra limitation (if any) do you need to introduce to implement MapProduct?

    Read the article

  • Slightly different execution times between python2 and python3

    - by user557634
    Hi. Lastly I wrote a simple generator of permutations in python (implementation of "plain changes" algorithm described by Knuth in "The Art... 4"). I was curious about the differences in execution time of it between python2 and python3. Here is my function: def perms(s): s = tuple(s) N = len(s) if N <= 1: yield s[:] raise StopIteration() for x in perms(s[1:]): for i in range(0,N): yield x[:i] + (s[0],) + x[i:] I tested both using timeit module. My tests: $ echo "python2.6:" && ./testing.py && echo "python3:" && ./testing3.py python2.6: args time[ms] 1 0.003811 2 0.008268 3 0.015907 4 0.042646 5 0.166755 6 0.908796 7 6.117996 8 48.346996 9 433.928967 10 4379.904032 python3: args time[ms] 1 0.00246778964996 2 0.00656183719635 3 0.01419159912 4 0.0406293644678 5 0.165960511097 6 0.923101452814 7 6.24257639835 8 53.0099868774 9 454.540967941 10 4585.83498001 As you can see, for number of arguments less than 6, python 3 is faster, but then roles are reversed and python2.6 does better. As I am a novice in python programming, I wonder why is that so? Or maybe my script is more optimized for python2? Thank you in advance for kind answer :)

    Read the article

  • how do Google and Yahoo replace the URL in the browser status bar?

    - by Mike W
    On the Google and Yahoo search pages, the URLs of the 10 search result links actually point to google.com or yahoo.com. The URLs have extra arguments that allow google.com or yahoo.com to redirect to the actual search result when the link is clicked. When the user mouses over the link, the search result URL (and not the google.com or yahoo.com URL) is displayed in the browser's status bar. I'm wondering how they do that. Many years ago, this would have been accomplished by having some javascript that sets window.status, but that doesn't seem to work anymore, as is explained by http://stackoverflow.com/questions/876390/reliable-cross-browser-way-of-setting-status-bar-text I have a link that looks like this: <a href="http://somedomain.com/ReallyLongURLThatShouldNotBeSeenInTheStatusBar" onmouseover="window.status='http://niceShourtUrl.com/'" onmouseout="window.status=''">Click Me</a> This link tried to use the window.status strategy, but it doesn't work. How do I fix this link so that it acts like the links on Google's and Yahoo's search result pages? In this example, I want "http://niceShourtUrl.com/" to be displayed in the status bar when the user mouses over the link.

    Read the article

  • Scala path dependent return type from parameter

    - by Rich Oliver
    In the following code using 2.10.0M3 in Eclipse plugin 2.1.0 for 2.10M3. I'm using the default setting which is targeting JVM 1.5 class GeomBase[T <: DTypes] { abstract class NewObjs { def newHex(gridR: GridBase, coodI: Cood): gridR.HexRT } class GridBase { selfGrid => type HexRT = HexG with T#HexTr def uniformRect (init: NewObjs) { val hexCood = Cood(2 ,2) val hex: HexRT = init.newHex(selfGrid, hexCood)// won't compile } } } Error message: Description Resource Path Location Type type mismatch; found: GeomBase.this.GridBase#HexG with T#HexTr required: GridBase.this.HexRT (which expands to) GridBase.this.HexG with T#HexTr GeomBase.scala Why does the compiler think the method returns the type projection GridBase#HexG when it should be this specific instance of GridBase? Edit transferred to a simpler code class in responce to comments now getting a different error message. package rStrat class TestClass { abstract class NewObjs { def newHex(gridR: GridBase): gridR.HexG } class GridBase { selfGrid => def uniformRect (init: NewObjs) { val hex: HexG = init.newHex(this) //error here } class HexG { val test12 = 5 } } } . Error line 11:Description Resource Path Location Type type mismatch; found : gridR.HexG required: GridBase.this.HexG possible cause: missing arguments for method or constructor TestClass.scala /SStrat/src/rStrat line 11 Scala Problem Update I've switched to 2.10.0M4 and updated the plug-in to the M4 version on a fresh version of Eclipse and switched to JVM 1.6 (and 1.7) but the problems are unchanged.

    Read the article

  • How to implement a collection (list, map?) of complicated strings in Java?

    - by Alex Cheng
    Hi all. I'm new here. Problem -- I have something like the following entries, 1000 of them: args1=msg args2=flow args3=content args4=depth args6=within ==> args5=content args1=msg args2=flow args3=content args4=depth args6=within args7=distance ==> args5=content args1=msg args2=flow args3=content args6=within ==> args5=content args1=msg args2=flow args3=content args6=within args7=distance ==> args5=content args1=msg args2=flow args3=flow ==> args4=flowbits args1=msg args2=flow args3=flow args5=content ==> args4=flowbits args1=msg args2=flow args3=flow args6=depth ==> args4=flowbits args1=msg args2=flow args3=flow args6=depth ==> args5=content args1=msg args2=flow args4=depth ==> args3=content args1=msg args2=flow args4=depth args5=content ==> args3=content args1=msg args2=flow args4=depth args5=content args6=within ==> args3=content args1=msg args2=flow args4=depth args5=content args6=within args7=distance ==> args3=content I'm doing some sort of suggestion method. Say, args1=msg args2=flow args3=flow == args4=flowbits If the sentence contains msg, flow, and another flow, then I should return the suggestion of flowbits. How can I go around doing it? I know I should scan (whenever a character is pressed on the textarea) a list or array for a match and return the result, but, 1000 entries, how should I implement it? I'm thinking of HashMap, but can I do something like this? <"msg,flow,flow","flowbits" Also, in a sentence the arguments might not be in order, so assuming that it's flow,flow,msg then I can't match anything in the HashMap as the key is "msg,flow,flow". What should I do in this case? Please help. Thanks a million!

    Read the article

  • Java Generic Type and Reflection

    - by Tom Tucker
    I have some tricky generic type problem involving reflection. Here's the code. public @interface MyConstraint { Class<? extends MyConstraintValidator<?>> validatedBy(); } public interface MyConstraintValidator<T extends Annotation> { void initialize(T annotation); } /** @param annotation is annotated with MyConstraint. */ public void run(Annotation annotation) { Class<? extends MyConstraintValidator<? extends Annotation>> validatorClass = annotation.annotationType().getAnnotation(MyConstraint.class).validatedBy(); validatorClass.newInstance().initialize(annotation) // will not compile! } The run() method above will not compile because of the following error. The method initialize(capture#10-of ? extends Annotation) in the type MyConstraintValidator<capture#10-of ? extends Annotation> is not applicable for the arguments (Annotation) If I remove the wild cards, then it compiles and works fine. What would be the propert way to declare the type parameter for the vairable validatorClass? Thanks.

    Read the article

  • cmd.exe Command Line Parsing of Environment Variables

    - by Artefacto
    I can't figure how to have cmd.exe not interpret something like %PATH% as an environment variable. Given this program: #include<stdio.h> #include<windows.h> int main(int argc, char *argv[]) { int i; printf("cmd line: %s\n", GetCommandLine()); for (i = 0; i < argc; i++) { printf("%d: %s\n", i, argv[i]); } return 0; } I have these different outputs according to the position of the arguments: >args "k\" o" "^%PATH^%" cmd line: args "k\" o" "%PATH%" 0: args 1: k" o 2: %PATH% >args "^%PATH^%" "k\" o" cmd line: args "^%PATH^%" "k\" o" 0: args 1: ^%PATH^% 2: k" o I guess it's because cmd.exe doesn't recognize the escaped \" and sees the escaped double quote as closing the first, leaving in the first case %PATH% unquoted. I say this, because if I don't quote the argument, it always works: >args ^%PATH^% "k\" o" cmd line: args %PATH% "k\" o" 0: args 1: %PATH% 2: k" o but then I can have no spaces...

    Read the article

  • Argument type deduction, references and rvalues

    - by uj2
    Consider the situation where a function template needs to forward an argument while keeping it's lvalue-ness in case it's a non-const lvalue, but is itself agnostic to what the argument actually is, as in: template <typename T> void target(T&) { cout << "non-const lvalue"; } template <typename T> void target(const T&) { cout << "const lvalue or rvalue"; } template <typename T> void forward(T& x) { target(x); } When x is an rvalue, instead of T being deduced to a constant type, it gives an error: int x = 0; const int y = 0; forward(x); // T = int forward(y); // T = const int forward(0); // Hopefully, T = const int, but actually an error forward<const int>(0); // Works, T = const int It seems that for forward to handle rvalues (without calling for explicit template arguments) there needs to be an forward(const T&) overload, even though it's body would be an exact duplicate. Is there any way to avoid this duplication?

    Read the article

< Previous Page | 408 409 410 411 412 413 414 415 416 417 418 419  | Next Page >