Search Results

Search found 11961 results on 479 pages for 'boot arguments'.

Page 413/479 | < Previous Page | 409 410 411 412 413 414 415 416 417 418 419 420  | Next Page >

  • Why is my Scala function returning type Unit and not whatever is the last line?

    - by Andy
    I am trying to figure out the issue, and tried different styles that I have read on Scala, but none of them work. My code is: .... val str = "(and x y)"; def stringParse ( exp: String, pos: Int, expreshHolder: ArrayBuffer[String], follow: Int ) var b = pos; //position of where in the expression String I am currently in val temp = expreshHolder; //holder of expressions without parens var arrayCounter = follow; //just counts to make sure an empty spot in the array is there to put in the strings if(exp(b) == '(') { b = b + 1; while(exp(b) == ' '){b = b + 1} //point of this is to just skip any spaces between paren and start of expression type if(exp(b) == 'a') { temp(arrayCounter) = exp(b).toString; b = b+1; temp(arrayCounter)+exp(b).toString; b = b+1; temp(arrayCounter) + exp(b).toString; arrayCounter+=1} temp; } } val hold: ArrayBuffer[String] = stringParse(str, 0, new ArrayBuffer[String], 0); for(test <- hold) println(test); My error is: Driver.scala:35: error: type mismatch; found : Unit required: scala.collection.mutable.ArrayBuffer[String] ho = stringParse(str, 0, ho, 0); ^one error found When I add an equals sign after the arguments in the method declaration, like so: def stringParse ( exp: String, pos: Int, expreshHolder: ArrayBuffer[String], follow: Int ) ={....} It changes it to "Any". I am confused on how this works. Any ideas? Much appreciated.

    Read the article

  • Breaking dependencies when you can't make changes to other files?

    - by codemuncher
    I'm doing some stealth agile development on a project. The lead programmer sees unit testing, refactoring, etc as a waste of resources and there is no way to convince him otherwise. His philosophy is "If it ain't broke don't fix it" and I understand his point of view. He's been working on the project for over a decade and knows the code inside and out. I'm not looking to debate development practices. I'm new to the project and I've been tasked with adding a new feature. I've worked on legacy projects before and used agile development practices with good result but those teams were more receptive to the idea and weren't afraid of making changes to code. I've been told I can use whatever development methodology I want but I have to limit my changes to only those necessary to add the feature. I'm using tdd for the new classes I'm writing but I keep running into road blocks caused by the liberal use of global variables and the high coupling in the classes I need to interact with. Normally I'd start extracting interfaces for these classes and make their dependence on the global variables explicit by injecting them as constructor arguments or public properties. I could argue that the changes are necessary but considering the lead never had to make them I doubt he would see it my way. What techniques can I use to break these dependencies without ruffling the lead developer's feathers? I've made some headway using: Extract Interface (for the new classes I'm creating) Extend and override the wayward classes with test stubs. (luckily most methods are public virtual) But these two can only get me so far.

    Read the article

  • Slightly different execution times between python2 and python3

    - by user557634
    Hi. Lastly I wrote a simple generator of permutations in python (implementation of "plain changes" algorithm described by Knuth in "The Art... 4"). I was curious about the differences in execution time of it between python2 and python3. Here is my function: def perms(s): s = tuple(s) N = len(s) if N <= 1: yield s[:] raise StopIteration() for x in perms(s[1:]): for i in range(0,N): yield x[:i] + (s[0],) + x[i:] I tested both using timeit module. My tests: $ echo "python2.6:" && ./testing.py && echo "python3:" && ./testing3.py python2.6: args time[ms] 1 0.003811 2 0.008268 3 0.015907 4 0.042646 5 0.166755 6 0.908796 7 6.117996 8 48.346996 9 433.928967 10 4379.904032 python3: args time[ms] 1 0.00246778964996 2 0.00656183719635 3 0.01419159912 4 0.0406293644678 5 0.165960511097 6 0.923101452814 7 6.24257639835 8 53.0099868774 9 454.540967941 10 4585.83498001 As you can see, for number of arguments less than 6, python 3 is faster, but then roles are reversed and python2.6 does better. As I am a novice in python programming, I wonder why is that so? Or maybe my script is more optimized for python2? Thank you in advance for kind answer :)

    Read the article

  • C: incompatible types in assignment

    - by The.Anti.9
    I'm writing a program to check to see if a port is open in C. One line in particular copies one of the arguments to a char array. However, when I try to compile, it says: error: incompatible types in assignment Heres the code. The error is on the assignment of addr #include <sys/socket.h> #include <sys/time.h> #include <sys/types.h> #include <arpa/inet.h> #include <netinet/in.h> #include <errno.h> #include <fcntl.h> #include <stdio.h> #include <netdb.h> #include <stdlib.h> #include <string.h> #include <unistd.h> int main(int argc, char **argv) { u_short port; /* user specified port number */ char addr[1023]; /* will be a copy of the address entered by u */ struct sockaddr_in address; /* the libc network address data structure */ short int sock = -1; /* file descriptor for the network socket */ port = atoi(argv[1]); addr = strncpy(addr, argv[2], 1023); bzero((char *)&address, sizeof(address)); /* init addr struct */ address.sin_addr.s_addr = inet_addr(addr); /* assign the address */ address.sin_port = htons(port); /* translate int2port num */ sock = socket(AF_INET, SOCK_STREAM, 0); if (connect(sock,(struct sockaddr *)&address,sizeof(address)) == 0) { printf("%i is open\n", port); } if (errno == 113) { fprintf(stderr, "Port not open!\n"); } close(sock); return 0; } I'm new to C, so I'm not sure why it would do this.

    Read the article

  • Why does Python sometimes upgrade a string to unicode and sometimes not?

    - by samtregar
    I'm confused. Consider this code working the way I expect: >>> foo = u'Émilie and Juañ are turncoats.' >>> bar = "foo is %s" % foo >>> bar u'foo is \xc3\x89milie and Jua\xc3\xb1 are turncoats.' And this code not at all working the way I expect: >>> try: ... raise Exception(foo) ... except Exception as e: ... foo2 = e ... >>> bar = "foo2 is %s" % foo2 ------------------------------------------------------------ Traceback (most recent call last): File "<ipython console>", line 1, in <module> UnicodeEncodeError: 'ascii' codec can't encode characters in position 0-1: ordinal not in range(128) Can someone explain what's going on here? Why does it matter whether the unicode data is in a plain unicode string or stored in an Exception object? And why does this fix it: >>> bar = u"foo2 is %s" % foo2 >>> bar u'foo2 is \xc3\x89milie and Jua\xc3\xb1 are turncoats.' I am quite confused! Thanks for the help! UPDATE: My coding buddy Randall has added to my confusion in an attempt to help me! Send in the reinforcements to explain how this is supposed to make sense: >>> class A: ... def __str__(self): return "string" ... def __unicode__(self): return "unicode" ... >>> "%s %s" % (u'niño', A()) u'ni\xc3\xb1o unicode' >>> "%s %s" % (A(), u'niño') u'string ni\xc3\xb1o' Note that the order of the arguments here determines which method is called!

    Read the article

  • Core jQuery event modification problem

    - by DSKVR
    I am attempting to overwrite a core jQuery event, in this case the keydown event. My intention is to preventDefault() functionality of Left(37), Up(38), Right(39) and Down(40) to maintain the consistency of hot keys in my web application. I am using the solution provided here for the conditional charCode preventDefault problem. For some reason, my function overwrite is simply not firing, and I cannot put my finger on the problem. I am afraid that over the past 30 minutes this issue has resulted in some hair loss. Anybody have the remedy? /* Modify Keydown Event to prevent default PageDown and PageUp functionality */ (function(){ var charCodes = new Array(37,38,39,40); var original = jQuery.fn.keydown; jQuery.fn.keydown = function(e){ var key=e.charCode ? e.charCode : e.keyCode ? e.keyCode : 0; alert('now why is my keydown mod not firing?'); if($.inArray(key,charCodes)) { alert('is one of them, do not scroll page'); e.preventDefault(); return false; } original.apply( this, arguments ); } })();

    Read the article

  • How to mimic polymorphism in classes with template methods (c++)?

    - by davide
    in the problem i am facing i need something which works more or less like a polymorphic class, but which would allow for virtual template methods. the point is, i would like to create an array of subproblems, each one being solved by a different technique implemented in a different class, but holding the same interface, then pass a set of parameters (which are functions/functors - this is where templates jump up) to all the subproblems and get back a solution. if the parameters would be, e.g., ints, this would be something like: struct subproblem { ... virtual void solve (double& solution, double parameter)=0; } struct subproblem0: public subproblem { ... virtual void solve (double& solution, double parameter){...}; } struct subproblem1: public subproblem { ... virtual void solve (double* solution, double parameter){...}; } int main{ subproblem problem[2]; subproblem[0] = new subproblem0(); subproblem[1] = new subproblem1(); double argument0(0), argument1(1), sol0[2], sol1[2]; for(unsigned int i(0);i<2;++i) { problem[i]->solve( &(sol0[i]) , argument0); problem[i]->solve( &(sol1[i]) , argument1); } return 0; } but the problem is, i need the arguments to be something like Arg<T1,T2> argument0(f1,f2) and thus the solve method to be something of the likes of template<T1,T2> solve (double* solution, Arg<T1,T2> parameter) which cant obviously be declared virtual ( so cant be called from a pointer to the base class)... now i'm pretty stuck and don't know how to procede...

    Read the article

  • DBD::CSV: Problem with userdefined functions

    - by sid_com
    From the SQL::Statement::Functions documentation: Creating User-Defined Functions ... More complex functions can make use of a number of arguments always passed to functions automatically. Functions always receive these values in @_: sub FOO { my( $self, $sth, $rowhash, @params ); } #!/usr/bin/env perl use 5.012; use warnings; use strict; use DBI; my $dbh = DBI->connect( "DBI:CSV:", undef, undef, { RaiseError => 1, } ); my $table = 'wages'; my $array_ref = [ [ 'id', 'number' ], [ 0, 6900 ], [ 1, 3200 ], [ 2, 1800 ], ]; $dbh->do( "CREATE TEMP TABLE $table AS import( ? )", {}, $array_ref ); sub routine { my $self = shift; my $sth = shift; my $rowhash = shift; # return $_[0] / 30; }; $dbh->do( "CREATE FUNCTION routine" ); my $sth = $dbh->prepare( "SELECT id, routine( number ) AS result FROM $table" ); $sth->execute(); $sth->dump_results(); When I try this I get an error-message: DBD::CSV::st execute failed: Use of uninitialized value $_[0] in division (/) at ./so.pl line 27. [for Statement "SELECT id, routine( number ) AS result FROM "wages""] at ./so.pl line 34. When I comment out the third argument I works as expected ( because it looks as if the third argument is missing ): #!/usr/bin/env perl ... sub routine { my $self = shift; my $sth = shift; #my $rowhash = shift; return $_[0] / 30; }; ... 0, 230 1, 106.667 2, 60 3 rows Is this a bug?

    Read the article

  • summing functions handles in matlab

    - by user552231
    Hi I am trying to sum two function handles, but it doesn't work. for example: y1=@(x)(x*x); y2=@(x)(x*x+3*x); y3=y1+y2 The error I receive is "??? Undefined function or method 'plus' for input arguments of type 'function_handle'." This is just a small example, in reality I actually need to iteratively sum about 500 functions that are dependent on each other. EDIT The solution by Clement J. indeed works but I couldn't manage to generalize this into a loop and ran into a problem. I have the function s=@(x,y,z)((1-exp(-x*y)-z)*exp(-x*y)); And I have a vector v that contains 536 data points and another vector w that also contains 536 data points. My goal is to sum up s(v(i),y,w(i)) for i=1...536 Thus getting one function in the variable y which is the sum of 536 functions. The syntax I tried in order to do this is: sum=@(y)(s(v(1),y,z2(1))); for i=2:536 sum=@(y)(sum+s(v(i),y,z2(i))) end

    Read the article

  • How do i make multi call with SudzC

    - by laxonline
    I am developing magento eCommerce stores in iPhone. For that, i have using Sudzc service class for SOAP WS call. Now, I'm trying to create a cart session its working fine. im getting the cardid. And i need to add one product to cart with some arguments. below is the php request example i need to call same this PHP Request Example $proxy = new SoapClient('http://beta.saletab.com/api/soap/?wsdl'); $sessionId = $proxy->login('xxxx', 'zzzzzzzzzzzzzzzzzzzzzzzzz'); //print_r($sessionId); $shoppingCartId = $proxy->call( $sessionId, 'cart.create'); $result = $proxy->call($sessionId,'cart_product.add',array($shoppingCartId,array('product_id'=>"3109",'qty' => 2)),0); echo "REQUEST HEADERS:\n" . $result->__getLastRequestHeaders() . "\n"; IOS Request im trying to send some product details like productid, sku & cardid SDZMagentoService *service = [SDZMagentoService service]; NSString *sessionId = [IMAPP_DELEGATE getUserDefault:IMAPI_SESSIONID]; NSString *cartId = [IMAPP_DELEGATE getUserDefault:IMAPI_CARTSESSIONID]; NSDictionary *argu = [[NSDictionary alloc] initWithObjectsAndKeys:@"3109",@"product_id",@"2",@"qty",cartId,@"card_id", nil]; [service call:self action:@selector(cartTest:) sessionId:sessionId resourcePath:@"cart_product.add" args:argu];

    Read the article

  • Error while sending mail (attachment file)

    - by Surya sasidhar
    hi, in my application i am using to send mail with attachments i write the code like this Using System.Net.Mail; MailMessage mail = new MailMessage(); mail.Body = "<html><body><b> Name Of The Job Seeker: " + txtName.Text + "<br><br>" + "The Mail ID:" + txtEmail.Text + "<br><br>" + " The Mobile Number: " + txtmobile.Text + "<br><br>" + "Position For Applied: " + txtPostionAppl.Text + "<br><br>" + "Description " + txtdescript.Text + "<br><br></b></body></html>"; mail.From = new MailAddress ( txtEmail.Text); mail.To .Add (new MailAddress ( mailid)); mail.Priority = MailPriority.High; FileUpload1.PostedFile.SaveAs("~/Resume/" + FileUpload1.FileName); mail.Attachments.Add(filenme); SmtpMail sm = new SmtpMail(); sm.Send(mail); it is giving error at attachment like mail.Attachemts.Add(filena) like this 'System.Collections.ObjectModel.Collection.Add(System.Net.Mail.Attachment)' has some invalid arguments.

    Read the article

  • How to solve this problem with Python

    - by morpheous
    I am "porting" an application I wrote in C++ into Python. This is the current workflow: Application is started from the console Application parses CLI args Application reads an ini configuration file which specifies which plugins to load etc Application starts a timer Application iterates through each loaded plugin and orders them to start work. This spawns a new worker thread for the plugin The plugins carry out their work and when completed, they die When time interval (read from config file) is up, steps 5-7 is repeated iteratively Since I am new to Python (2 days and counting), the distinction between script, modules and packages are still a bit hazy to me, and I would like to seek advice from Pythonista as to how to implement the workflow described above, using Python as the programing language. In order to keep things simple, I have decided to leave out the time interval stuff out, and instead run the python script/scripts as a cron job instead. This is how I am thinking of approaching it: Encapsulate the whole application in a package which is executable (i.e. can be run from the command line with arguments. Write the plugins as modules (I think maybe its better to implement each module in a separate file?) I havent seen any examples of using threading in Python yet. Could someone provide a snippet of how I could spawn a thread to run a module. Also, I am not sure how to implement the concept of plugins in Python - any advice would be helpful - especially with a code snippet.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Compile C++ in Visual Studio

    - by Kasun
    Hi All.. I use this method to compile C++ file in VS. But even i provide the correct file it returns false. Can any one help me... This is class called CL class CL { private const string clexe = @"cl.exe"; private const string exe = "Test.exe", file = "test.cpp"; private string args; public CL(String[] args) { this.args = String.Join(" ", args); this.args += (args.Length > 0 ? " " : "") + "/Fe" + exe + " " + file; } public Boolean Compile(String content, ref string errors) { if (File.Exists(exe)) File.Delete(exe); if (File.Exists(file)) File.Delete(file); File.WriteAllText(file, content); Process proc = new Process(); proc.StartInfo.UseShellExecute = false; proc.StartInfo.RedirectStandardOutput = true; proc.StartInfo.RedirectStandardError = true; proc.StartInfo.FileName = clexe; proc.StartInfo.Arguments = this.args; proc.StartInfo.CreateNoWindow = true; proc.Start(); //errors += proc.StandardError.ReadToEnd(); errors += proc.StandardOutput.ReadToEnd(); proc.WaitForExit(); bool success = File.Exists(exe); return success; } } This is my button click event private void button1_Click(object sender, EventArgs e) { string content = "#include <stdio.h>\nmain(){\nprintf(\"Hello world\");\n}\n"; string errors = ""; CL k = new CL(new string[] { }); if (k.Compile(content, ref errors)) Console.WriteLine("Success!"); else MessageBox.Show("Errors are : ", errors); }

    Read the article

  • Haskell quiz: a simple function

    - by levy
    I'm not a Haskell programmer, but I'm curious about the following questions. Informal function specification: Let MapProduct be a function that takes a function called F and multiple lists. It returns a list containing the results of calling F with one argument from each list in each possible combination. Example: Call MapProduct with F being a function that simply returns a list of its arguments, and two lists. One of the lists contains the integers 1 and 2, the other one contains the strings "a" and "b". It should return a list that contains the lists: 1 and "a", 1 and "b", 2 and "a", 2 and "b". Questions: How is MapProduct implemented? What is the function's type? What is F's type? Can one guess what the function does just by looking at its type? Can you handle inhomogeneous lists as input? (e.g. 1 and "a" in one of the input lists) What extra limitation (if any) do you need to introduce to implement MapProduct?

    Read the article

  • How to write an R function that evaluates an expression within a data-frame

    - by Prasad Chalasani
    Puzzle for the R cognoscenti: Say we have a data-frame: df <- data.frame( a = 1:5, b = 1:5 ) I know we can do things like with(df, a) to get a vector of results. But how do I write a function that takes an expression (such as a or a > 3) and does the same thing inside. I.e. I want to write a function fn that takes a data-frame and an expression as arguments and returns the result of evaluating the expression "within" the data-frame as an environment. Never mind that this sounds contrived (I could just use with as above), but this is just a simplified version of a more complex function I am writing. I tried several variants ( using eval, with, envir, substitute, local, etc) but none of them work. For example if I define fn like so: fn <- function(dat, expr) { eval(expr, envir = dat) } I get this error: > fn( df, a ) Error in eval(expr, envir = dat) : object 'a' not found Clearly I am missing something subtle about environments and evaluation. Is there a way to define such a function?

    Read the article

  • Best way to use Google's hosted jQuery, but fall back to my hosted library on Google fail

    - by Nosredna
    What would be a good way to attempt to load the hosted jQuery at Google (or other Google hosted libs), but load my copy of jQuery if the Google attempt fails? I'm not saying Google is flaky. There are cases where the Google copy is blocked (apparently in Iran, for instance). Would I set up a timer and check for the jQuery object? What would be the danger of both copies coming through? Not really looking for answers like "just use the Google one" or "just use your own." I understand those arguments. I also understand that the user is likely to have the Google version cached. I'm thinking about fallbacks for the cloud in general. Edit: This part added... Since Google suggests using google.load to load the ajax libraries, and it performs a callback when done, I'm wondering if that's the key to serializing this problem. I know it sounds a bit crazy. I'm just trying to figure out if it can be done in a reliable way or not. Update: jQuery now hosted on Microsoft's CDN. http://www.asp.net/ajax/cdn/

    Read the article

  • Node.js/Express Partials problem: Can't be nested too deep?

    - by heorling
    I'm learning Node.js, Express, haml.js and liking it. I've run into a prety annoying problem though. I'm pretty new to this but have been getting nice results so far. I'm writing a jquery heavy web app that relies on a table containing divs. The divs slide around, switch back and fourth and are resized etc to my hearts content. What I'm looking for a way to switch (template?) the divs. Since I've been building in express and mimicking the chat example it would make sense to use partials. The rub is that I've been using inexplicit divs in haml, held within a td. The divs are cunstructed as follows: %tr %td .class1.class2.class3.classetc Which has worked fine cross browser. Parsing the classes works great for the js code to pass arguments around, fetch values etc. What I'd like to be able to do is something like: %tr %td .class1.class2.class3.classetc %ul#messages != this.partial('message.html.haml', { collection: messages }) Any combination I've tried with this has failed however. And I might have tried them all. If I could put a partial into that div I'd probably be set. And you can nest them as long as you use #ids instead of .classes. But if you use more than one class it breaks! I think that's the most accurate way of summing it up. How do you do this? I've checked out various templating solutions like mu.js and micro template like by John Resig. I earlier checked out this thread on templating engines. It's very possible I'm making some fundamental mistake here, I'm new to this. What's a good way to do this?

    Read the article

  • Select rows from table1 and all the children from table2 into an object

    - by Patrick
    I want to pull data from table "Province_Notifiers" and also fetch all corresponding items from table "Province_Notifier_Datas". The table "Province_Notifier" has a guid to identify it (PK), table "Province_Notifier_Datas" has a column called BelongsToProvinceID witch is a foreign key to the "Province_Notifier" tables guid. I tried something like this: var records = from data in ctx.Province_Notifiers where DateTime.Now >= data.SendTime && data.Sent == false join data2 in ctx.Province_Notifier_Datas on data.Province_ID equals data2.BelongsToProvince_ID select new Province_Notifier { Email = data.Email, Province_ID = data.Province_ID, ProvinceName = data.ProvinceName, Sent = data.Sent, UserName = data.UserName, User_ID = data.User_ID, Province_Notifier_Datas = (new List<Province_Notifier_Data>().AddRange(data2)) }; This line is not working and i am trying to figure out how topull the data from table2 into that Province_Notifier_Datas variable. Province_Notifier_Datas = (new List<Province_Notifier_Data>().AddRange(data2)) I can add a record easily by adding the second table row into the Province_Notifier_Datas but i can't fetch it back. Province_Notifier dbNotifier = new Province_Notifier(); // set some values for dbNotifier dbNotifier.Province_Notifier_Datas.Add( new Province_Notifier_Data { BelongsToProvince_ID = userInput.Value.ProvinceId, EventText = GenerateNotificationDetail(notifierDetail) }); This works and inserts the data correctly into both tables. Edit: These error messages is thrown: Cannot convert from 'Province_Notifier_Data' to 'System.Collections.Generic.IEnumerable' If i look in Visual Studio, the variable "Province_Notifier_Datas" is of type System.Data.Linq.EntitySet The best overloaded method match for 'System.Collections.Generic.List.AddRange(System.Collections.Generic.IEnumerable)' has some invalid arguments Edit: var records = from data in ctx.Province_Notifiers where DateTime.Now >= data.SendTime && data.Sent == false join data2 in ctx.Province_Notifier_Datas on data.Province_ID equals data2.BelongsToProvince_ID into data2list select new Province_Notifier { Email = data.Email, Province_ID = data.Province_ID, ProvinceName = data.ProvinceName, Sent = data.Sent, UserName = data.UserName, User_ID = data.User_ID, Province_Notifier_Datas = new EntitySet<Province_Notifier_Data>().AddRange(data2List) }; Error 3 The name 'data2List' does not exist in the current context.

    Read the article

  • Regular Expressions .NET

    - by Fosa
    I need a regular expression for some arguments that must match on a string. here it is... The string exists out of minimum 8 en maximum 20 characters. These characters of this string may be characters of the alfabet or special chars --With other words..all charachters except from the whitespaces In the complete string there must be atleast 1 number. The string cannot start with a number or an underscore The last 2 characters of the string must be identical, But it doenst matter if those last --identical characters are capital or non-capital (case insensitive) Must match all : +234567899 a_1de*Gg xy1Me*__ !41deF_hij2lMnopq3ss C234567890123$^67800 *5555555 sDF564zer"" !!!!!!!!!4!!!!!!!!!! abcdefghijklmnopq9ss May not match : Cannot be less then 8 or more then 20 chars: a_1+Eff B41def_hIJ2lmnopq3stt Cannot contain a whitespace: A_4 e*gg b41def_Hij2l nopq3ss Cannot start with a number or an underscore: __1+Eff 841DEf_hij2lmnopq3stt cannot end on 2 diffrent characters: a_1+eFg b41DEf_hij2lmnopq3st Cannot be without a number in the string: abCDefghijklmnopqrss abcdef+++dF !!!!!!!!!!!!!!!!!!!! ------------------------------------------------------ This is what I have so far...But I'm really breaking my head on this... If you Don't know the answer completely it's not a problem... I just want to get in the right direction ([^0-9_])(?=.*\d)(\S{8,20})(?i:[\S])\1

    Read the article

  • Method not being resolved for dynamic generic type

    - by kelloti
    I have these types: public class GenericDao<T> { public T Save(T t) { return t; } } public abstract class DomainObject { // Some properties protected abstract dynamic Dao { get; } public virtual void Save() { var dao = Dao; dao.Save(this); } } public class Attachment : DomainObject { protected dynamic Dao { get { return new GenericDao<Attachment>(); } } } Then when I run this code it fails with RuntimeBinderException: Best overloaded method match for 'GenericDAO<Attachment.Save(Attachment)' has some invalid arguments var obj = new Attachment() { /* set properties */ }; obj.Save(); I've verified that in DomainObject.Save() "this" is definitely Attachment, so the error doesn't really make sense. Can anyone shed some light on why the method isn't resolving? Some more information - It succeeds if I change the contents of DomainObject.Save() to use reflection: public virtual void Save() { var dao = Dao; var type = dao.GetType(); var save = ((Type)type).GetMethod("Save"); save.Invoke(dao, new []{this}); }

    Read the article

  • Change Sequence to Choice

    - by Gordon
    In my Schema File I defined a Group with a Sequence of possible Elements. <group name="argumentGroup"> <sequence> <element name="foo" type="double" /> <element name="bar" type="string" /> <element name="baz" type="integer" /> </sequence> </group> I then reference this Group like this: <element name="arguments"> <complexType> <group ref="my:argumentGroup"/> </complexType> </element> Is it possible to reference the Group at some other point but restrict it so it's a Choice instead of a Sequence. The position where I want to reuse it would only allow one of the Elements within. <element name="argument" minOccurs="0" maxOccurs="1"> <complexType> <group name="my:argumentGroup"> <! -- Somehow change argumentGroup sequence to choice here --> </group> <complexType> </element>

    Read the article

  • Thread mutex behaviour

    - by Alberteddu
    Hi there, I'm learning C. I'm writing an application with multiple threads; I know that when a variable is shared between two or more threads, it is better to lock/unlock using a mutex to avoid deadlock and inconsistency of variables. This is very clear when I want to change or view one variable. int i = 0; /** Global */ static pthread_mutex_t mutex = PTHREAD_MUTEX_INITIALIZER; /** Thread 1. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); /** Thread 2. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); This is correct, I think. The variable i, at the end of the executions, contains the integer 2. Anyway, there are some situations in which I don't know exactly where to put the two function calls. For example, suppose you have a function obtain(), which returns a global variable. I need to call that function from within the two threads. I have also two other threads that call the function set(), defined with a few arguments; this function will set the same global variable. The two functions are necessary when you need to do something before getting/setting the var. /** (0) */ /** Thread 1, or 2, or 3... */ if(obtain() == something) { if(obtain() == somethingElse) { // Do this, sometimes obtain() and sometimes set(random number) (1) } else { // Do that, just obtain(). (2) } } else { // Do this and do that (3) // If # of thread * 3 > 10, then set(3*10) For example. (4) } /** (5) */ Where I have to lock, and where I have to unlock? The situation can be, I think, even more complex. I will appreciate an exhaustive answer. Thank you in advance. —Alberto

    Read the article

  • Array indexOf implentation for Internet Explorer

    - by Daemon
    There are plenty of solutions on how to get the indexOf implementation into the Array prototype so that it works under Internet Explorer, however I've stumbled upon an issue that doesn't seem to be addressed anywhere I've looked so far. Using the pretty well agreed upon implementation at MDC, I have the following code that's being problematic now: // indexOf support for IE (from MDC) if (!Array.prototype.indexOf) { Array.prototype.indexOf = function(elt /*, from*/) { var len = this.length >>> 0; var from = Number(arguments[1]) || 0; from = (from < 0) ? Math.ceil(from) : Math.floor(from); if (from < 0) from += len; for (; from < len; from++) { if (from in this && this[from] === elt) return from; } return -1; }; } var i = [1,2,3,4]; for (j in i) { alert(i[j]); } I am expecting to receive 4 alerts, each one containing one of the elements of the array. In Firefox and Chrome, that's exactly what I see, however in IE8 I get an additional alert containing the indexOf function code. What can be done to avoid this?

    Read the article

  • Problem consuming a dataset via a .NET web service from Flex-ActionScript

    - by DEH
    Hi, I am returning a .NET dataset to Flex Actionscript via a web service. Actionscript snippet as follows: var websvc:WebService = new WebService(); websvc.useProxy=false; websvc.wsdl = "http://localhost:13229/test/mysvc.asmx?WSDL"; websvc.loadWSDL(); var operation:Operation = new Operation(null, "GetData"); operation.arguments.command="xx_gethierdata_"+mode+"_"+identifier; operation.addEventListener(ResultEvent.RESULT, onResultHandler, false, 0, true); operation.addEventListener(FaultEvent.FAULT, onFaultHandler, false, 0, true); operation.resultFormat="object"; websvc.operations = [operation]; operation.send(); Once in the onResultHandler function I have access to the datatable - I then want to grab the column names. The following code outputs my column names: for each (var tcolumn:Object in datatable.Columns){trace('Column:'+tcolumn);} This works ok, but the column names are encoded, so a column name that is actually "1-9" is output as "_x005B_1-9_x005D_" Anyone know the best way to decode the column name? I could replace all the encoding strings, but surely there is a better way? Thanks

    Read the article

< Previous Page | 409 410 411 412 413 414 415 416 417 418 419 420  | Next Page >