Search Results

Search found 15210 results on 609 pages for 'technical writing'.

Page 423/609 | < Previous Page | 419 420 421 422 423 424 425 426 427 428 429 430  | Next Page >

• Can I subscribe to window-docking events in windows 7 from C#

  - by www.mortenbock.dk

  Hi. I am wondering if it is possible to create an application that could receive a notification when any other application/window is docked with the new windows 7 docking feature (f.ex. Winkey + left arrow) The purpose of my application would be to set up custom rules for certain windows. So for example if I am using Chrome and I press the Win+LEFT keys, then my application would receive a notification, and would be able to say that the window should not resize to 50% of the screen, but should use 70%. I am not very familiar with writing windows applications (mostly do web), so any pointers at how this might be achieved are very welcome. Thanks.

  Read the article

• Wildcard App IDs for iPhone/iPod Touch Apps

  - by Can Berk Güder

  I'm writing my third app, and I already have an app in the App Store, but I still don't get this App ID business. I created the App IDs for my first two applications like this: XXXXXXXXXX.me.cbg.FirstApp YYYYYYYYYY.me.cbg.SecondApp but then Apple introduced the App ID wizard, which I used to create the App ID and provisioning profiles for my third application: ZZZZZZZZZZ.* So my question is: What is the "proper" way of creating App IDs for three completely independent apps? Should I use the XXXXXXXXXX.* format or XXXXXXXXXX.me.cbg.*? Should I create three different App IDs, or just one wildcard ID?

  Read the article

• Extension methods on a static object

  - by Max Malygin

  I know (or so I hear) that writing extension methods for a single stand alone .net class (not an implementation of IEnumerable) is potential code smell. However, for the sake of making the life easier I need to attach a method to the ConfigurationManager class in asp.net. It's a static object so this won't work: public static List<string> GetSupportedDomains(this ConfigurationManager manager) { //the manager needs to be static. } So the question is - is it possible to write an extension method for a static class in .net?

  Read the article

• Running commands though PHP/Perl scripts as a priviledged user on Linux.

  - by jtd

  Background: I am writing a script for a company that will allow users to create FTP accounts through a web interface. In the background, the script must run a bunch of commands: Add the user to the system (useradd) Open and edit various files mail the user via sendmail and a few other things... I'm basically looking for the most secure way of doing this. I've heard of the setuid method, the sudo method, and of course, running httpd as a priviledged user. There will be sanity checks on the data entered of course before any commands are executed (ie. only alphanumeric characters in usernames) What is the method used by the popular scripts out there (webmin for example), as it must be fairly secure?

  Read the article

• Singly-Linked Lists insert_back and isIncreasing

  - by rezivor

  I just finished writing a program that I can add, remove or print objects to a list, but I am having difficulty implementing two more functions that is insert_back, which inserts a value to the end of a list. Also,I have to modify the representation of a List and alter whatever methods are necessary to make insert_back run in constant time: O(1). This new operation should have the signature: void List::insert_back( const Object& data ); Also, isIncreasing, For example, for a list containing head-() (11) (8) (15) (3), isIncreasing() should return false. However, it would return true when working on a list containing head- () (7) (9) (15). This new operation should have the signature: bool List::isIncreasing() const; Thank you

  Read the article

• Test Driven Development (TDD) with Rails

  - by macek

  I am looking for TDD resources that are specific to Rails. I've seen the Rails Guide: The Basics of Creating a Rails Plugin which really spurred my interest in the topic. I have the Agile Development with Rails book and I see there's some testing-related information there. However, it seems like the author takes you through the steps of building the app, then adds testing afterward. This isn't really Test Driven Development. Ideally, I'd like a book on this, but a collection of other tutorials or articles would be great if such a book doesn't exist. Things I'd like to learn: Primary goal: Best Practices Unit testing How to utilize Fixtures Possibly using existing development data in place of fixtures What's the community standard here? Writing tests for plugins Testing with session data User is logged in User can access URL /foo/bar Testing success of sending email Thanks for any help!

  Read the article

• Log4J - Speed of resolving class/method/line references

  - by Jeach

  Does log4J still gather the class, method and line numbers by generating exceptions and inspecting the stack trace? Or has Java been optimized since Sun included their own logging framework. If not, why has there not been any optimizations made since. What is the main challenges in obtaining class, method and line numbers quickly and efficiently? Although I hate annotations and try to avoid them, has log4J not made use of this, such as: @log4j-class MyClass @log4j-method currentMethodOne At least this would avoid some companies bad habit of repeatedly writing/copying the method name as the first part of their logging message (which is seriously annoying). Thanks, Jeach!

  Read the article

• Boost ASIO read X bytes synchroniously into a vector

  - by xeross

  Hey, I've been attempting to write a client/server app with boost now, so far it sends and receives but I can't seem to just read X bytes into a vector. If I use the following code vector<uint8_t> buf; for (;;) { buf.resize(4); boost::system::error_code error; size_t len = socket.read_some(boost::asio::buffer(buf), error); if (error == boost::asio::error::eof) break; // Connection closed cleanly by peer. else if (error) throw boost::system::system_error(error); // Some other error. } And the packet is bigger then 4 bytes then it seems it keeps writing into those 4 bytes until the entire packet has been received, however I want it to fetch 4 bytes, then allow me to parse them, and then get the rest of the packet. Can anyone provide me with a working example, or at least a pointer on how to make it work properly ? Regards, Xeross

  Read the article

• What format is your documentation in?

  - by Ek0nomik

  I am going to be writing documentation for two web services that I developed, and I started wondering what people on here do for documentation. Do you create it in an HTML file so it can be viewed in the browser? Word document? Wiki? What do you guys/gals use? I was originally leaning towards creating an HTML page since it seems a little more open and friendly than a word document. Plus I can use the prettify javascript to make code samples look nice. Our company has a Sharepoint though, so an HTML file may not be the best choice given that most documentation is put up in spreadsheets and word documents.

  Read the article

• PHP preg_match Math Function

  - by Matt

  I'm writing a script that will allow a user to input a string that is a math statement, to then be evaluated. I however have hit a roadblock. I cannot figure out how, using preg_match, to dissallow statements that have variables in them. Using this, $calc = create_function("", "return (" . $string . ");" ); $calc();, allows users to input a string that will be evaluated, but it crashes whenever something like echo 'foo'; is put in place of the variable $string.

  Read the article

• Operator as and generic classes

  - by abatishchev

  I'm writing .NET On-the-Fly compiler for CLR scripting and want execution method make generic acceptable: object Execute() { return type.InvokeMember(..); } T Execute<T>() { return Execute() as T; /* doesn't work: The type parameter 'T' cannot be used with the 'as' operator because it does not have a class type constraint nor a 'class' constraint */ // also neither typeof(T) not T.GetType(), so on are possible return (T) Execute(); // ok } But I think operator as will be very useful: if result type isn't T method will return null, instead of an exception! Is it possible to do?

  Read the article

• Performance when accessing class members

  - by Dr. Acula

  I'm writing something performance-critical and wanted to know if it could make a difference if I use: int test( int a, int b, int c ) { // Do millions of calculations with a, b, c } or class myStorage { public: int a, b, c; }; int test( myStorage values ) { // Do millions of calculations with values.a, values.b, values.c } Does this basically result in similar code? Is there an extra overhead of accessing the class members? I'm sure that this is clear to an expert in C++ so I won't try and write an unrealistic benchmark for it right now

  Read the article

• Why is 'using namespace std;' considered a bad practice in C++?

  - by Mana

  Okay, sorry for the simplistic question, but this has been bugging me ever since I finished high school C++ last year. I've been told by others on numerous occasions that my teacher was wrong in saying that we should have "using namespace std;" in our programs, and that std::cout and std::cin are more proper. However, they would always be vague as to why this is a bad practice. So, I'm asking now: Why is "using namespace std;" considered bad? Is it really that inefficient, or risk declaring ambiguous vars(variables that share the same name as a function in std namespace) that much? Or does this impact program performance noticeably as you get into writing larger applications? I'm sorry if this is something I should have googled to solve; I figured it would be nice to have this question on here regardless in case anyone else was wondering.

  Read the article

• finding the numbers in a given range?

  - by Jamis

  Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

  Read the article

• Likelihood of IOError during print vs. write

  - by jkasnicki

  I recently encountered an IOError writing to a file on NFS. There wasn't a disk space or permission issue, so I assume this was just a network hiccup. The obvious solution is to wrap the write in a try-except, but I was curious whether the implementation of print and write in Python make either of the following more or less likely to raise IOError: f_print = open('print.txt', 'w') print >>f_print, 'test_print' f_print.close() vs. f_write = open('write.txt', 'w') f_write.write('test_write\n') f_write.close() (If it matters, specifically in Python 2.4 on Linux).

  Read the article

• How to write a xpath to match all elements except a particular element

  - by Unmesh Kondolikar

  I am writing an XSL transformation. I want to write a template which matches all the child elements of the document except one particular node. My xml looks like this - <Document> <NodeA><\NodeA> <NodeB><\NodeB> <ServiceNode><\ServiceNode> <NodeX><\NodeX> </Document> I want to write a template that matches all nodes except ServiceNode i.e. NodeA to NodeX. How to write this Xpath to get - <xsl:template match="ALL Nodex Except ServiceNode">

  Read the article

• Python: How to use code.InteractiveConsole?

  - by Rosarch

  I'm trying to use InteractiveConsole to create a new front-end for a Python interpreter. These code fragments are from me playing around with InteractiveConsole in IDLE: >>> ses = code.InteractiveConsole() >>> ses.runsource("def foo():") True >>> ses.runsource(" return 2") File "<input>", line 1 SyntaxError: 'return' outside function (<input>, line 1) False Why does it raise a syntax error? How else can I finish writing the function? Also, for something like this: >>> ses.runsource("x = 1") False >>> ses.runsource("x") 1 False How can I capture the 1 value from above? False is the return value, but 1 is written to some stream.

  Read the article

• dealing with IO vs pure code in haskell

  - by Drakosha

  I'm writing a shell script (my 1st non-example in haskell) which is supposed to list a directory, get every file size, do some string manipulation (pure code) and then rename some files. I'm not sure what i'm doing wrong, so 2 questions: How should i arrange the code in such program? I have a specific issue, i get the following error, what am i doing wrong? error: Couldn't match expected type [FilePath]' against inferred typeIO [FilePath]' In the second argument of mapM', namelyfileNames' In a stmt of a 'do' expression: files <- (mapM getFileNameAndSize fileNames) In the expression: do { fileNames <- getDirectoryContents; files <- (mapM getFileNameAndSize fileNames); sortBy cmpFilesBySize files } code: getFileNameAndSize fname = do (fname, (withFile fname ReadMode hFileSize)) getFilesWithSizes = do fileNames <- getDirectoryContents files <- (mapM getFileNameAndSize fileNames) sortBy cmpFilesBySize files

  Read the article

• What happens when I MPI_Send to a process that has finished?

  - by nieldw

  What happens when I MPI_Send to a process that has finished? I am learning MPI, and writing a small sugar distribution-simulation in C. When the factories stop producing, those processes end. When warehouses run empty, they end. Can I somehow tell if the shop's order to a warehouse did not succeed(because the warehouse process has ended) by looking at the return value of MPI_Send? The documentation doesn't mention a specific error code for this situation, but that no error is returned for success. Can I do: if (MPI_Send(...)) { ... /* destination has ended */ ... } And disregard the error code? Thanks

  Read the article

• networkstream always empty!

  - by ALEX

  hey I'm writing on an Server-Client program but when my client sends something, it never reaches my server! I'm sending like this: public void Send(string s) { char[] chars = s.ToCharArray(); byte[] bytes = chars.CharToByte(); nstream.Write(bytes, 0, bytes.Length); nstream.Flush(); } and Receiving in a background thread like this void CheckIncoming(object dd) { RecievedDelegate d = (RecievedDelegate)dd; try { while (true) { List<byte> bytelist = new List<byte>(); System.Threading.Thread.Sleep(1000); int ssss; ssss = nstream.ReadByte(); if (ssss > 1) { System.Diagnostics.Debugger.Break(); } if (bytelist.Count != 0) { d.Invoke(bytelist.ToArray()); } } } catch (Exception exp) { MSGBOX("ERROR:\n" + exp.Message); } } the ssss int is never 1 whats happening here???

  Read the article

• Is it a header file or library? in a makefile

  - by gccinac

  I already know the differences between a header file and a library. However, when I'm writing my makefile, I have some difficulties on deciding if I should put something as a dependency of the file or just at the linking rule. For example: I have 2 simple files: main.c: #include <stdio.h> main(){ printf("this is the sine or 90"); sinus(90); } and func.c: #include <math.h> sinus(int num){ return sin(num); } and my makefile is: main: main.o func.o gcc main.o func.o -lm -o main func.o: func.c main.o: main.c Well, my question is why this makefile works and this one doesn't: main: main.o func.o gcc main.o func.o -lm -o main func.o: func.c math.h main.o: main.c

  Read the article

• How do you get 100% code coverage with guards in Haskell?

  - by dan_waterworth

  I'm trying to get (and prove) 100% test coverage for some code I'm writing in Haskell using HPC. However if I write something like this: fac n | n > 0 = n * (fac (n - 1)) | otherwise = 1 Then the second expression of the guard statement has always True tagged to it. What is the easiest way to overcome this in the general case? edit: Just to clarify. This code: fac n = if n > 0 then n * (fac (n - 1)) else 1 Works fine with HPC, (running it gives 100% code coverage). I'm basically suffering from this problem: http://hackage.haskell.org/trac/ghc/ticket/3175

  Read the article

• Server Side code Pushing Data to client Browser while current thread is busy Comet (programming)

  - by h_power11

  Hello Friends, I am writing one simple web page with bunch of textboxes and a button control. Now when user finished editing the values on this text boxes user has to click the button and this button invoke heavily process intensive algorithm on server side code based on the data received from client (Textboxes) And it could some time takes up to 30 to 45 minutes to complete the whole operation so the current thread is still inside the button click event handler function. That background task only provides one event, and the web page subscribes to it to get some text data after each stage of processing I was wandering if there is any way I can keep user up-to-date with what is the current progress on that background task. I have div element to print the current status information So I am looking for some sort of reverse mechanism then "get" and "post". I have read some articles on the Comet (programming) but I can't find any easy or definitive answer Thanks in advance

  Read the article

• How to trigger Mouse-Over on iPhone?

  - by Andrew

  This might seem like a really dumb question, but I am writing an application and I have come across where my mouse-over, mouse-click and mouse-hover need different events bound to them. Now on Internet Explorer, Firefox, and Safari. It all works as expected. However, on my iPhone the actions will not trigger. Now my question is are their any specific ways I can have the Mouse-Over essentially be fired when I hold my finger down and trigger an event? An example where this doesn't work is right on this website when you hover over a comment it is supposed to display the +1 or flag icon. I am using jquery.

  Read the article

• How to create a MySQL query for time based elements with a 'safe window'?

  - by pj4533

  I am no SQL expert, far from it. I am writing a Rails application, and I am new at that as well. I come from a desktop programming background. My application has a table of data, one of the columns is the time at which the data was logged. I want to create a query with a 'safe window' around EACH row. By that I mean, it returns the first row, then for X minutes (based on the timelogged column) it won't return any data, once X minutes is up, it will return the next row. For example: ID | TimeLogged 1 | 3/5/2010 12:01:01 2 | 3/5/2010 12:01:50 3 | 3/5/2010 12:02:03 4 | 3/5/2010 12:10:30 5 | 3/5/2010 01:30:03 6 | 3/5/2010 01:31:05 With a 'safe window' of 5 minutes I want to create a query to return: 1 | 3/5/2010 12:01:01 4 | 3/5/2010 12:10:30 5 | 3/5/2010 01:30:03 (It skipped the 12:01:50 and 12:02:03 items because they occurred within 5 minutes of the first item.) Another example, with a 'safe window' of 15 minutes I want to return: 1 | 3/5/2010 12:01:01 5 | 3/5/2010 01:30:03 Perhaps I have to just return all data and parse it myself?

  Read the article

< Previous Page | 419 420 421 422 423 424 425 426 427 428 429 430  | Next Page >