Search Results

Search found 32913 results on 1317 pages for 'open office'.

Page 425/1317 | < Previous Page | 421 422 423 424 425 426 427 428 429 430 431 432  | Next Page >

• How to connect devices behind Comcast router/modem with devices behind wireless router

  - by deeperDATA

  I know this is going to seem like a simple solution but I have been unable to find a clear answer through Google. Simple office setup: I have a Comcast modem/router that has 4 hard wired ports. In one of those ports I have a Cisco wireless router which also has 4 of its own ports. What is the method for getting devices behind the modem/router to ping/communicate with devices behind the wireless router? They are all on the same subnet but the IP ranges differ. The router produces 192.168.1.1 by default while the Comcast modem/router produces 10.1.10.1 by default. I think what I'm attempting to do might be considered "extending" the modem/router's network but I'm not sure. Thank you in advance for your assistance.

  Read the article

• jquery boxy plugin: prevent multiple instances of the same dialog when clicking the link multiple ti

  - by Lyon

  Hi, I'm using the Boxy jQuery plugin to open dialog windows and populating it through ajax. http://onehackoranother.com/projects/jquery/boxy/ Here's my code so far: $("a.create").click(function (e) { url = $(e.target).attr('href'); Boxy.load(url, {title:'Test'}); }); This opens up a dialog alright. However, if I click the link again, another dialog will open. How can I make it such that the previously opened Boxy dialog will come into focus? I only want one instance of this dialog. I tried assigning a variable to var ele = Boxy.load(); but the variable ele returns undefined... Alas, I can't make out much from the limited Boxy documentation available. Enabling the option modal: true would prevent the user from clicking on the link multiple times, but I don't want the overlay to show. Thanks for any light you can shed on this. -Lyon

  Read the article

• C# file Decryption - Bad Data

  - by Jon

  Hi all, I am in the process of rewriting an old application. The old app stored data in a scoreboard file that was encrypted with the following code: private const String SSecretKey = @"?B?n?Mj?"; public DataTable GetScoreboardFromFile() { FileInfo f = new FileInfo(scoreBoardLocation); if (!f.Exists) { return setupNewScoreBoard(); } DESCryptoServiceProvider DES = new DESCryptoServiceProvider(); //A 64 bit key and IV is required for this provider. //Set secret key For DES algorithm. DES.Key = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Set initialization vector. DES.IV = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Create a file stream to read the encrypted file back. FileStream fsread = new FileStream(scoreBoardLocation, FileMode.Open, FileAccess.Read); //Create a DES decryptor from the DES instance. ICryptoTransform desdecrypt = DES.CreateDecryptor(); //Create crypto stream set to read and do a //DES decryption transform on incoming bytes. CryptoStream cryptostreamDecr = new CryptoStream(fsread, desdecrypt, CryptoStreamMode.Read); DataTable dTable = new DataTable("scoreboard"); dTable.ReadXml(new StreamReader(cryptostreamDecr)); cryptostreamDecr.Close(); fsread.Close(); return dTable; } This works fine. I have copied the code into my new app so that I can create a legacy loader and convert the data into the new format. The problem is I get a "Bad Data" error: System.Security.Cryptography.CryptographicException was unhandled Message="Bad Data.\r\n" Source="mscorlib" The error fires at this line: dTable.ReadXml(new StreamReader(cryptostreamDecr)); The encrypted file was created today on the same machine with the old code. I guess that maybe the encryption / decryption process uses the application name / file or something and therefore means I can not open it. Does anyone have an idea as to: A) Be able explain why this isn't working? B) Offer a solution that would allow me to be able to open files that were created with the legacy application and be able to convert them please? Thank you

  Read the article

• Squid traffic tunneled through VPN

  - by NerdyNick

  So what I'm trying to do is have a Squid Proxy run on 1 machine along side a VPN connection. What I want to happen is all traffic running though the Squad Proxy would run though the VPN for its outbound. ie Desktop - (Squid Proxy - VPN) The goal is to allow my desktop selective tunneling through the VPN. So that Instant Messaging and the like that do not need to run through the VPN can go through my normal traffic. Typically I would go though a SSH Proxy but currently am forced to use VPN to gain entry into the office, and a Squid proxy seemed like it might work out the easiest for what I am needing. EDIT Realize I forgot to actually state what problem I'm running into. I have the Squid setup and verified it works, but once I connect to the VPN. All requests to Squid get accepted but Squid is unable to make the request over the VPN. So the client ends up just sitting there.

  Read the article

• String search and write into file in jython

  - by kdev

  hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

  Read the article

• Wacom Bamboo tablet for Doctors

  - by thandasoru

  My friend is a Skin specialist (Tricologist) and she has a computer with WinXP in her office. She asked me if I can recommend a hardware which would enable her to write on a graphics tablet that would appear on the screen. Her requirement is thus: There is a prescription paper, a sheet of paper (A4 size) which has a letter head (With the title of the Clinic, Doctor's name etc). The exact image of the paper is available on the Computer. She takes the pictures of the patient's head with a camera and pastes the photo over the sheet of paper. So the top half of the prescription paper will have the photo of the patient's head. In the second half, she wants to write the medication required. I have heard of Bamboo graphics tablet and I saw video in Youtube. But I am not sure if it would be the right solution for her. Can anyone please advise me on this?

  Read the article

• How would I setup reverse DNS for 2 email servers?

  - by Solignis

  I have an interesting DNS question (well interesting to me atleast). I just installed an hmail server in our remote office to act as an MX backup in the event our exchange server goes down. The 2 host names are mail.campbellsurvey.com mail2.campbellsurvey.com mail points to the address 98.XXX.91.XXX mail2 points to the address 70.XXX.190.XXX How would I setup a PTR record on the ISP end to reflect both hostnames? Does the PTR have to point to EXACTLY mail.campbellsurvey.com or can it point to just campbellsurvey.com? because right now anything passing through the primary static address in our pool (the one used for standard internet) is identified as mail.campbellsurvey.com. My only idea to fix this was to move the mail server to the next available address and give it only it the name mail.campbellsurvey.com but I wanted to see if there was another way. Thanks in advance.

  Read the article

• gdb+osx: no output when using printf/CFShow

  - by yairchu

  I attached to a program with gdb in OSX and I want to use CFShow in the gdb console etc. However, nothing shows up. printf shows nothing as well: (gdb) call (int) printf("Hello\n") $10 = 6 (gdb) call (int) printf("Hello World!\n") $11 = 13 Apple suggests the following tip for when attaching with gdb, to make the output appear in the gdb console: (gdb) call (void) close(1) (gdb) call (void) close(2) (gdb) shell tty /dev/ttyp1 (gdb) call (int) open("/dev/ttyp1", 2, 0) $1 = 1 (gdb) call (int) open("/dev/ttyp1", 2, 0) $2 = 2 In xcode's gdb console tty gives "not a tty", so I tried it in gdb in a terminal. There tty does work but after redirecting stdout there's still no output. Also no output if I direct stdout to a file.. :/ Any salvation?

  Read the article

• OCS 2007: Issues with /LiveServer/MCUFactory

  - by routeNpingme

  I'm not really an Office Communications Server expert, but just trying to resolve some seemingly minor issues with a new install... The following error is occurring in the OCS event log, and when I try to visit https://servername:444/LiveServer/MCUFactory in Internet Explorer to test the address, I just get a "page cannot be displayed" error. I can telnet to port 444 on the server and verify that the port is open and listening. Any ideas? Event Type: Error Event Source: OCS MCU Infrastructure Event Category: (1022) Event ID: 61013 Date: 7/28/2009 Time: 8:47:42 AM User: N/A Computer: COMM2 Description: The process DataMCUSvc(1284) failed to send health notifications to the MCU factory at https://servername:444/LiveServer/MCUFactory/. Failure occurrences: 29, since 7/28/2009 8:40:27 AM. For more information, see Help and Support Center at http://go.microsoft.com/fwlink/events.asp.

  Read the article

• Windows XP-64 loses audio sounds, drive letters... why?

  - by Ira Baxter

  Until sometime in early December, I had a wonderfully functioning XP-64 system. It was configured to auto download/install MS patches. I occassionally update the software on it, e.g. Open Office, Adobe Reader, Skype, but I don't fetch hundreds of tools or anything much beyond what I just mentioned. In December, suddenly my audio stopped, and drive letters assigned to various mount points on other machines quit being available. Apparantly, the services that support these (and some others) are now not starting up when I boot/login. There isn't anything obvious in the event log. If I manually restart the associated services, these facilities come back on line and work for awhile (a day) but pretty soon the problem reappears. I don't reboot very often, nor do I log out out much. Hints?

  Read the article

• Calling a .NET web service (WSE 3.0, WS-Security) from JAXWS-RI

  - by elduff

  I'm writing a JAXWS-RI client that must call a .NET Web Service that is using WS-Security. The service's WSDL does not contain any WS-Security info, but I have an example soap message from the service's authors and know that I must include wsse:Security headers, including X:509 tokens. I've been researching, and I've seen example of folks calling this type of web service from Axis and CXF (in conjunction with Rampart and/or WSS4J), but nothing about using plain JAXWS-RI itself. However, I'm (unfortunately) constrained to using JAXWS-RI by my gov't client. Does anyone have any examples/documentation of doing this from JAXWS-RI? I need to ultimately generate a SOAP header that looks something like the one below - this is a sample soap:header from a .NET client written by the service's authors. (Note: I've put the 'VALUE_HERE' string in places where I need to provide my own values) <soapenv:Envelope xmlns:iri="http://EOIR/IRIES" xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xenc="http://www.w3.org/2001/04/xmlenc#"> <soapenv:Header xmlns:wsa="http://www.w3.org/2005/08/addressing"> <wsse:Security xmlns:wsse="http://docs.oasis-open.org/wss/2004/01/oasis-200401- wss-wssecurity-secext-1.0.xsd"> <xenc:EncryptedKey Id="VALUE_HERE"> <xenc:EncryptionMethod Algorithm="http://www.w3.org/2001/04/xmlenc#rsa-oaep-mgf1p"/> <ds:KeyInfo xmlns:ds="http://www.w3.org/2000/09/xmldsig#"> <wsse:SecurityTokenReference> <wsse:KeyIdentifier EncodingType="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-soap-message-security-1.0#Base64Binary" ValueType="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-x509-token-profile-1.0#X509v3"> VALUE_HERE </wsse:KeyIdentifier> </wsse:SecurityTokenReference> </ds:KeyInfo> <xenc:CipherData> <xenc:CipherValue>VALUE_HERE</xenc:CipherValue> </xenc:CipherData> <xenc:ReferenceList> <xenc:DataReference URI="#EncDataId-8"/> </xenc:ReferenceList> </xenc:EncryptedKey> </wsse:Security>

  Read the article

• Windows 7: app crashing/hanging on "save as" dialog

  - by Fuxi

  now this is really annoying - I'm having a global problem in Windows 7: when using the system's "save as"-file dialog, the main app will just hang. the mouse-cursor is showing progress, the whole app is hanging and I need to terminate it manually. it's happening with every app! (notepad, word, graphics app). I'm assuming it's something with the system enumerating the harddisk-drivenames or something. any idea how to fix this? by the way - when viewing the problem details - it's telling the module - it's msonsext.dll, looks like some office thing to me.

  Read the article

• Why is LOGON_USER Server Variable is blank on New Windows / New Tab?

  - by Alex Papadimoulis

  We are noticing some very strange behavior on an installation of a .NET2-based webapp on Server 2008. Our app uses "old school" Integrated Windows Authentication and simply reads the LOGIN_USER server variable from the request collection. There's a good reason for this, but that's somewhat irrelevant to the question, since the underlying WindowsAuthentication code from ASP.NET does the same thing. Anyway... When you enter the URL in the browser, it loads up just fine and displays the username (from LOGIN_USER) no problem. When you click on a link within the web app, it loads the page just fine and authenticates without any problems. When you "hard refresh" (Ctrl-F5) it also works just fine. However, when you click "open in a new window" or "open in a new tab", the LOGON_USER variable is blank Any ideas? Am I missing some IIS7 setting somewhere? Tested clients are Windows 7 with IE8 or Windows XP with IE6.

  Read the article

• which ASP.NET hosting site allows listening on different ports than 80 and uses .NET 4?

  - by ijjo

  I'm trying to take advantage of HTML 5 web sockets in .NET and the easiest way appears to be something like what this guy does. I've already tested this myself and it works great, but there are a few problems if I try to deploy this to my hosting site (discountasp.net). Basically, I am not allowed to open up a port on 8080 and listen on it. I then tried to figure out a way to listen on port 80 with IIS as well, but using the HTTPListener, I run into sercurity issues as well. This doesn't seem like it will help since I can't mess with this stuff on the hosting site server either. So to make my life easier, I think I need to find a hosting site that simply allows me to open up a socket on port 8080 and listen on it. Anyone know of one? Or does anyone know of a workaround (besides sniffing all the traffic on port 80)?

  Read the article

• Serial Mac OS X constantly freezes/locks/dissappears for USB to Arduino

  - by Niraj D

  I have a problem with my C++ code running in Xcode with both the AMSerial library as well as the generic C (ioctl, termios). After a fresh restart, my application works well but after I "kill" the program the Serial (I think) is not released. I have checked my open files under /dev and have killed the connection to serial USB from there, but my C++ still can't open the USB port. I have narrowed this down to being a low level Mac OS X issue, regarding blocking the port indefinitely, regardless of closing it using the aforementioned libraries. Just for context, I'm trying to send numbers through my USB port, serially to an Arduino Duemilanove at 9600 baud. Running Serial Monitor in Arduino is perfectly fine, however, running through a C++ application it freezes up my computer, occasionally, my mouse/keyboard freeze up: requiring a hard reset. How can this problem be fixed? It seems like Mac OS X is not USB friendly!

  Read the article

• Bonjour/mDNS Broadcast across subnets

  - by Matthew Savage

  I have just setup a new OSX Server in our office and verified that everything is working fine over our wired network (192.168.126.0/24). The problem that I am having is that our clients (Mac Laptops) are mainly connected via Wireless, which are running on a different subnet (192.168.1.0/24), and the mDNS Broadcast isn't reaching this subnet. The network configuration is somewhat foreign to myself (I don't manage the network in this location, but as of just recently the servers), however I don't believe there is any firewalls or routing rules between the two subnets which might cause the traffic to be rejected. I'm wondering if this is simply the mDNS broadcast not able to broadcast over the two different subnets (I'm still reading up on broadcast to understand it more) or there is something else which I might be able to try.

  Read the article

• Installing fonts

  - by Lazar

  I have "white nights" trying to install Hebrew/Arabic fonts on my level 7 (API 2.1) aka Nexus emulator. I can't understand why Google guys will want to waist my skills do something helpful for the community using Hebrew/Arabic fonts. After rw mount/remount I can do it for level 3 devices, but for Nexus - nada! Why? What can be done? Real devices guys already broke this peace of hardware, but I am sitting and looking wide eyes open like a sheep. Please make me happy and give the chance to install the fonts. That's what must be done for some of us: We need system image saved on exit for tomorrow to continue the work Open emulator to work in peace cp command included with the SDK. Thanks for any help

  Read the article

• which asp net hosting site allows to listen on differnt port than 80 and uses .net 4?

  - by ijjo

  i'm trying to take advantage of html 5 web sockets in .NET and the easiest way appears to do something like this guy does: http://www.codeproject.com/KB/webservices/c_sharp_web_socket_server.aspx?msg=3485900#xx3485900xx i've already tested this myself and it works great, but there are a few problems if i try to deploy this to my hosting site (discountasp.net). basically i am not allowed to open up a port on 8080 and listen on it. i then tried to figure out a way to listen non port 80 with IIS as well, but using the HTTPListener runs into sercurity issues as well that doesn't seem like will help since i can't mess with this stuff on the hosting site server either: http://stackoverflow.com/questions/169904/can-i-listen-on-a-port-using-httplistener-or-other-net-code-on-vista-without-r so to make my life easier, i think i need to find a hosting site that simply allows me to open up a socket on port 8080 and listen on it. anyone know of one? or anyone know of a workaround (besides sniffing ALL the traffic on port 80)?

  Read the article

• Using WSUS to update machines not on the domain

  - by Arcath

  I have a WSUS server providing updates for for the computers on my domain. We also bring allot of machines back to our office and run windows update on them as build image, this means that we end up downloading the same updates over and over again. Is there anyway to get a machine to download its updates from our WSUS Server? i found that theres something running on port 8530 but its just an empty document, in fact every folder listed in IIS config returns a blank document anyone know if this is possible? and how i would do it?

  Read the article

• Python urllib.urlopen IOError

  - by Michael

  So I have the following lines of code in a function sock = urllib.urlopen(url) html = sock.read() sock.close() and they work fine when I call the function by hand. However, when I call the function in a loop (using the same urls as earlier) I get the following error: > Traceback (most recent call last): File "./headlines.py", line 256, in <module> main(argv[1:]) File "./headlines.py", line 37, in main write_articles(headline, output_folder + "articles_" + term +"/") File "./headlines.py", line 232, in write_articles print get_blogs(headline, 5) File "/Users/michaelnussbaum08/Documents/College/Sophmore_Year/Quarter_2/Innovation/Headlines/_code/get_content.py", line 41, in get_blogs sock = urllib.urlopen(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 87, in urlopen return opener.open(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 203, in open return getattr(self, name)(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 314, in open_http if not host: raise IOError, ('http error', 'no host given') IOError: [Errno http error] no host given Any ideas?

  Read the article

• NETWORK_ERROR: XMLHttpRequest Exception 101

  - by pawan Mangal

  I am getting this Error NETWORK_ERROR: XMLHttpRequest Exception 101 when trying to get XML content from one site. Here is my code var xmlhttp; if(window.XMLHttpRequest) { xmlhttp = new XMLHttpRequest(); } if (xmlhttp==null) { alert ("Your browser does not support XMLHTTP!"); return; } xmlhttp.onReadyStateChange=function() { if(xmlhttp.readyState==4) { var value =xmlhttp.responseXML; alert(value); } } xmlhttp.open("GET",url,false); xmlhttp.send(); //alert(xmlhttp.responseXML); } xmlhttp.open("GET",url,false); xmlhttp.send(null); Does any one have a solution?

  Read the article

• Kerberos SSO browser integration?

  - by MrZombie

  I'm installing a bunch of web apps for the office, and one of the wants would be Kerberos-managed SSO. Now, I have found some information on the matter, and I wondered, what browsers integrate Kerberos SSO? Of course I could just use the underlying web app to authenticate in case of lack of Kerberos capability, which is exactly the plan, but I'd like to know which browsers would work for that, so I can plan ahead and decide if it's even worth it to do that, which I believe it would considering that one of the web apps I'm implementing will be an ERP.

  Read the article

• Error when starting Outlook 2007 on Windows 7

  - by Jared

  Every time I start Outlook 2007 SP2 on my Windows 7 box Outlook will look like its loading fine, then I get this error message: cannot start microsoft office outlook. cannot open the outlook window and outlook will close. I was able to get outlook to start by using outlook.exe /resetnavpane in the Start-Search box, a nice tip which I got from this social.microsoft.com page. But it didn't fix the problem since outlook is still complaining when it starts after a reboot. What can I do to get outlook to startup normally?

  Read the article

• How do you fix an SVN 409 Conflict Error

  - by NerdStarGamer

  I used to use SVN 1.4 on OS X Leopard and everything was fine. A couple of weeks ago I installed a fresh copy of OS X 10.6. The version of SVN that comes with Snow Leopard is 1.6.5. I went ahead and built my own copy with 1.6.6. I'm using the built in apache server and just hosting repositories locally. Everything appeared to work fine until I actually tried to commit something. Everytime I try to commit a change, I get the following message: Transmitting file data .svn: Commit failed (details follow): svn: MERGE of '/svn/svn2': 409 Conflict (http://localhost) This happens with my old repositories, so I created a couple of new ones. Same deal. I also tried using the 1.6.5 version that comes with the system...same. Finally, I tried upgrading to the latest stable SVN (1.6.9) and still got the same problem. The Apache error logs the following for each failed commit: [Mon Mar 29 19:53:10 2010] [error] [client ::1] Could not MERGE resource "/svn/svn2/!svn/act/d399326f-c20f-424f-bb68-3bb40503b5b1" into "/svn/svn2". [409, #0] [Mon Mar 29 19:53:10 2010] [error] [client ::1] An error occurred while committing the transaction. [409, #2] [Mon Mar 29 19:53:10 2010] [error] [client ::1] Can't open directory '/usr/local/svn/svn2/db/transactions/5-6.txn/\xeb\xa9\x0f\x1f': No such file or directory [409, #2] [Mon Mar 29 19:53:11 2010] [error] [client ::1] Could not DELETE /svn/svn2/!svn/act/d399326f-c20f-424f-bb68-3bb40503b5b1. [500, #0] [Mon Mar 29 19:53:11 2010] [error] [client ::1] could not open transaction. [500, #2] [Mon Mar 29 19:53:11 2010] [error] [client ::1] Can't open file '/usr/local/svn/svn2/db/transactions/5-6.txn/props': No such file or directory [500, #2] And from the access log: ::1 - - [30/Mar/2010:13:02:20 -0400] "OPTIONS /svn/svn2 HTTP/1.1" 401 401 ::1 - user [30/Mar/2010:13:02:20 -0400] "OPTIONS /svn/svn2 HTTP/1.1" 200 188 ::1 - user [30/Mar/2010:13:02:20 -0400] "PROPFIND /svn/svn2 HTTP/1.1" 207 647 ::1 - user [30/Mar/2010:13:02:20 -0400] "PROPFIND /svn/svn2 HTTP/1.1" 207 647 ::1 - user [30/Mar/2010:13:02:20 -0400] "PROPFIND /svn/svn2/!svn/vcc/default HTTP/1.1" 207 398 ::1 - user [30/Mar/2010:13:02:20 -0400] "PROPFIND /svn/svn2/!svn/bln/6 HTTP/1.1" 207 449 ::1 - user [30/Mar/2010:13:02:20 -0400] "REPORT /svn/svn2/!svn/vcc/default HTTP/1.1" 200 1172 Curiously, the commit does actually commit the changes, but the working copy doesn't see that and everything gets screwy. I've tried to Google every variation I can think of for this problem, but the search results are pretty much useless. I'm not using TortoiseSVN or anything special and commits fail on a new repository, so I know it's not a problem with my old repos. Any help would be greatly appreciated.

  Read the article

• vs 2005 and vwd 2008

  - by kenom

  Can i open Visual Web developer 2008 projects with Visual studio 2005?

  Read the article

< Previous Page | 421 422 423 424 425 426 427 428 429 430 431 432  | Next Page >