Search Results

Search found 11808 results on 473 pages for 'circular reference'.

Page 435/473 | < Previous Page | 431 432 433 434 435 436 437 438 439 440 441 442  | Next Page >

  • Few doubts regarding Bitmaps , Images & `using` blocks

    - by imageWorker
    I caught up in this problem. http://stackoverflow.com/questions/2559826/garbage-collector-not-doing-its-job-memory-consumption-1-5gb-outofmemory-exc I feel that there is something wrong in my understanding. Please clarify these things. Destructor & IDisposable.Dispose are two methods for freeing resources that are not not under the control of .NET. Which means, everything except memory. right? using blocks are just better way of calling IDisposable.Dispose() method of an object. This is the main code I'm referring to. class someclass { static someMethod(Bitmap img) { Bitmap bmp = new Bitmap(img); //statement1 // some code here and return } } here is class I'm using for testing: class someotherClass { public static voide Main() { foreach (string imagePath in imagePathsArray) { using (Bitmap img1 = new Bitmap(imagePath)) { someclass.someMethod(img1); // does some more processing on `img1` } } } } Is there any memory leak with statement1? Question1: If each image size is say 10MB. Then does this bmp object occupy atleast 10MB? What I mean is, will it make completely new copy of entire image? or just refer to it? Question2:should I or should I not put the statement1 in using block? My Argument: We should not. Because using is not for freeing memory but for freeing the resources (file handle in this case). If I use it in using block. It closes file handle here encapsulated by this bmp object. It means we are also closing filehandle for the caller's img1 object. Which is not correct? As of the memory leak. No there is no scope of memory leak here. Because reference bmp is destroyed when this method is returned. Which leaves memory it refered without any pointer. So, its garbage collected. Am I right? Edit: class someclass { static Bitmap someMethod(Bitmap img) { Bitmap bmp = new Bitmap(img); //can I use `using` block on this enclosing `return bmp`; ??? // do some processing on bmp here return bmp; } }

    Read the article

  • Assembly Load and loading the "sub-modules" dependencies - "cannot fild the file specified"

    - by Ted
    There are several questions out there that ask the same question. However the answers they received I cannot understand, so here goes: Similar questions: http://stackoverflow.com/questions/1874277/dynamically-load-assembly-and-manually-force-path-to-get-referenced-assemblies ; http://stackoverflow.com/questions/22012/loading-assemblies-and-its-dependencies-closed The question in short: I need to figure out how dependencies, ie References in my modules can be loaded dynamically. Right now I am getting "The system cannot find the file specified" on Assemblies referenced in my so called modules. I cannot really get how to use the AssemblyResolve event... The longer version I have one application, MODULECONTROLLER, that loads separate modules. These "separate modules" are located in well-known subdirectories, like appBinDir\Modules\Module1 appBinDir\Modules\Module2 Each directory contains all the DLLs that exists in the bin-directory of those projects after a build. So the MODULECONTROLLER loads all the DLLs contained in those folders using this code: byte[] bytes = File.ReadAllBytes(dllFileFullPath); Assembly assembly = null; assembly = Assembly.Load(bytes); I am, as you can see, loading the byte[]-array (so I dont lock the DLL-files). Now, in for example MODULE1, I have a static reference called MyGreatXmlProtocol. The MyGreatXmlProtocol.dll then also exists in the directory appBinDir\Modules\Module1 and is loaded using the above code When code in the MODULE1 tries to use this MyGreatXmlProtocol, I get: Could not load file or assembly 'MyGreatXmlProtocol, Version=1.0.3797.26527, Culture=neutral, PublicKeyToken=null' or one of its dependencies. The system cannot find the file specified. So, in a post (like this one) they say that To my understanding reflection will load the main assembly and then search the GAC for the referenced assemblies, if it cannot find it there, you can then incorparate an assemblyResolve event: First; is it really needed to use the AssemblyResolve-event to make this work? Shouldnt my different MODULEs themself load their DLLs, as they are statically referenced? Second; if AssemblyResolve is the way to go - how do I use it? I have attached a handler to the Event but I never get anything on MyGreatXmlProctol... === EDIT === CODE regarding the AssemblyResolve-event handler: public GUI() { InitializeComponent(); AppDomain.CurrentDomain.AssemblyResolve += new ResolveEventHandler(CurrentDomain_AssemblyResolve); ... } // Assembly CurrentDomain_AssemblyResolve(object sender, ResolveEventArgs args) { Console.WriteLine(args.Name); return null; } Hope I wasnt too fuzzy =) Thx

    Read the article

  • Marshalling non-Blittable Structs from C# to C++

    - by Greggo
    I'm in the process of rewriting an overengineered and unmaintainable chunk of my company's library code that interfaces between C# and C++. I've started looking into P/Invoke, but it seems like there's not much in the way of accessible help. We're passing a struct that contains various parameters and settings down to unmanaged codes, so we're defining identical structs. We don't need to change any of those parameters on the C++ side, but we do need to access them after the P/Invoked function has returned. My questions are: What is the best way to pass strings? Some are short (device id's which can be set by us), and some are file paths (which may contain Asian characters) Should I pass an IntPtr to the C# struct or should I just let the Marshaller take care of it by putting the struct type in the function signature? Should I be worried about any non-pointer datatypes like bools or enums (in other, related structs)? We have the treat warnings as errors flag set in C++ so we can't use the Microsoft extension for enums to force a datatype. Is P/Invoke actually the way to go? There was some Microsoft documentation about Implicit P/Invoke that said it was more type-safe and performant. For reference, here is one of the pairs of structs I've written so far: C++ /** Struct used for marshalling Scan parameters from managed to unmanaged code. */ struct ScanParameters { LPSTR deviceID; LPSTR spdClock; LPSTR spdStartTrigger; double spinRpm; double startRadius; double endRadius; double trackSpacing; UINT64 numTracks; UINT32 nominalSampleCount; double gainLimit; double sampleRate; double scanHeight; LPWSTR qmoPath; //includes filename LPWSTR qzpPath; //includes filename }; C# /// <summary> /// Struct used for marshalling scan parameters between managed and unmanaged code. /// </summary> [StructLayout(LayoutKind.Sequential)] public struct ScanParameters { [MarshalAs(UnmanagedType.LPStr)] public string deviceID; [MarshalAs(UnmanagedType.LPStr)] public string spdClock; [MarshalAs(UnmanagedType.LPStr)] public string spdStartTrigger; public Double spinRpm; public Double startRadius; public Double endRadius; public Double trackSpacing; public UInt64 numTracks; public UInt32 nominalSampleCount; public Double gainLimit; public Double sampleRate; public Double scanHeight; [MarshalAs(UnmanagedType.LPWStr)] public string qmoPath; [MarshalAs(UnmanagedType.LPWStr)] public string qzpPath; }

    Read the article

  • Flex/Air/AS3 Selecting and Populating a unFocused tab.

    - by Deyon
    I'm having a problem displaying data from a function to text box within a tab. If you run the code and click "Select Tab 2 and Fill..." I get an error; "TypeError: Error #1009: Cannot access a property or method of a null object reference." I'm guessing this is because "Tab 2" is/was not rendered yet. Now if I run the code, select "Tab 2" then select "Tab 1" and click "Select Tab 2 and Fill..." it works the way I would like. Dose any one know a way around this problem. ----Full Flex 4/Flash Builder Code just copy paste---- <?xml version="1.0" encoding="utf-8"?> <s:WindowedApplication xmlns:fx="http://ns.adobe.com/mxml/2009" xmlns:s="library://ns.adobe.com/flex/spark" xmlns:mx="library://ns.adobe.com/flex/halo" creationComplete=" "> <fx:Script> <![CDATA[ public function showtab2():void { mytextbox.text="I made it!"; tn.selectedIndex=1; } ]]> </fx:Script> <fx:Declarations> <!-- Place non-visual elements (e.g., services, value objects) here --> </fx:Declarations> <mx:Panel title="TabNavigator Container Example" height="90%" width="90%" paddingTop="10" paddingLeft="10" paddingRight="10" paddingBottom="10"> <mx:Label width="100%" color="blue" text="Select the tabs to change the panel."/> <mx:TabNavigator id="tn" width="100%" height="100%"> <!-- Define each panel using a VBox container. --> <mx:VBox label="Panel 1"> <mx:Label text="TabNavigator container panel 1"/> <mx:Button label="Select Tab 2 and Fill with Text" click="showtab2()"/> </mx:VBox> <mx:VBox label="Panel 2"> <mx:Label text="TabNavigator container panel 2"/> <s:TextInput id="mytextbox" /> </mx:VBox> </mx:TabNavigator> <mx:HBox> </mx:HBox> </mx:Panel> </s:WindowedApplication>

    Read the article

  • Need Google Map InfoWindow Hyperlink to Open Content in Overlay (Fusion Table Usage)

    - by McKev
    I have the following code established to render the map in my site. When the map is clicked, the info window pops up with a bunch of content including a hyperlink to open up a website with a form in it. I would like to utilize a function like fancybox to open up this link "form" in an overlay. I have read that fancybox doesn't support calling the function from within an iframe, and was wondering if there was a way to pass the link data to the DOM and trigger the fancybox (or another overlay option) in another way? Maybe a callback trick - any tips would be much appreciated! <style> #map-canvas { width:850px; height:600px; } </style> <script type="text/javascript" src="http://maps.google.com/maps/api/js?sensor=true"></script> <script src="http://gmaps-utility-gis.googlecode.com/svn/trunk/fusiontips/src/fusiontips.js" type="text/javascript"></script> <script type="text/javascript"> var map; var tableid = "1nDFsxuYxr54viD_fuH7fGm1QRZRdcxFKbSwwRjk"; var layer; var initialLocation; var browserSupportFlag = new Boolean(); var uscenter = new google.maps.LatLng(37.6970, -91.8096); function initialize() { map = new google.maps.Map(document.getElementById('map-canvas'), { zoom: 4, mapTypeId: google.maps.MapTypeId.ROADMAP }); layer = new google.maps.FusionTablesLayer({ query: { select: "'Geometry'", from: tableid }, map: map }); //http://gmaps-utility-gis.googlecode.com/svn/trunk/fusiontips/docs/reference.html layer.enableMapTips({ select: "'Contact Name','Contact Title','Contact Location','Contact Phone'", from: tableid, geometryColumn: 'Geometry', suppressMapTips: false, delay: 500, tolerance: 8 }); ; // Try W3C Geolocation (Preferred) if(navigator.geolocation) { browserSupportFlag = true; navigator.geolocation.getCurrentPosition(function(position) { initialLocation = new google.maps.LatLng(position.coords.latitude,position.coords.longitude); map.setCenter(initialLocation); //Custom Marker var pinColor = "A83C0A"; var pinImage = new google.maps.MarkerImage("http://chart.apis.google.com/chart?chst=d_map_pin_letter&chld=%E2%80%A2|" + pinColor, new google.maps.Size(21, 34), new google.maps.Point(0,0), new google.maps.Point(10, 34)); var pinShadow = new google.maps.MarkerImage("http://chart.apis.google.com/chart?chst=d_map_pin_shadow", new google.maps.Size(40, 37), new google.maps.Point(0, 0), new google.maps.Point(12, 35)); new google.maps.Marker({ position: initialLocation, map: map, icon: pinImage, shadow: pinShadow }); }, function() { handleNoGeolocation(browserSupportFlag); }); } // Browser doesn't support Geolocation else { browserSupportFlag = false; handleNoGeolocation(browserSupportFlag); } function handleNoGeolocation(errorFlag) { if (errorFlag == true) { //Geolocation service failed initialLocation = uscenter; } else { //Browser doesn't support geolocation initialLocation = uscenter; } map.setCenter(initialLocation); } } google.maps.event.addDomListener(window, 'load', initialize); </script>

    Read the article

  • How do I pass the value of the previous form element into an "onchange" javascript function?

    - by Jen
    Hello, I want to make some UI improvements to a page I am developing. Specifically, I need to add another drop down menu to allow the user to filter results. This is my current code: HTML file: <select name="test_id" onchange="showGrid(this.name, this.value, 'gettestgrid')"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> This is pseudo code for what I want to happen: <select name="test_id"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> <select name="statistics" onchange="showGrid(PREVIOUS.name, PREVIOUS.VALUE, THIS.value)"> <option selected>Select a data display --></option> <option value='gettestgrid'>Show averages by student</option> <option value='gethomeroomgrid'>Show averages by homeroom</option> <option value='getschoolgrid'>Show averages by school</option> </select> How do I access the previous field's name and value? Any help much appreciated, thx! Also, JS function for reference: function showGrid(name, value, phpfile) { xmlhttp=GetXmlHttpObject(); if (xmlhttp==null) { alert ("Browser does not support HTTP Request"); return; } var url=phpfile+".php"; url=url+"?"+name+"="+value; url=url+"&sid="+Math.random(); xmlhttp.onreadystatechange=stateChanged; xmlhttp.open("GET",url,true); xmlhttp.send(null); }

    Read the article

  • What is GC holes?

    - by tianyi
    I wrote a long TCP connection socket server in C#. Spike in memory in my server happens. I used dotNet Memory Profiler(a tool) to detect where the memory leaks. Memory Profiler indicates the private heap is huge, and the memory is something like below(the number is not real,what I want to show is the GC0 and GC2's Holes are very very huge, the data size is normal): Managed heaps - 1,500,000KB Normal heap - 1400,000KB Generation #0 - 600,000KB Data - 100,000KB "Holes" - 500,000KB Generation #1 - xxKB Data - 0KB "Holes" - xKB Generation #2 - xxxxxxxxxxxxxKB Data - 100,000KB "Holes" - 700,000KB Large heap - 131072KB Large heap - 83KB Overhead/unused - 130989KB Overhead - 0KB Howerver, what is GC hole? I read an article about the hole: http://kaushalp.blogspot.com/2007/04/what-is-gc-hole-and-how-to-create-gc.html The author said : The code snippet below is the simplest way to introduce a GC hole into the system. //OBJECTREF is a typedef for Object*. { PointerTable *pTBL = o_pObjectClass->GetPointerTable(); OBJECTREF aObj = AllocateObjectMemory(pTBL); OBJECTREF bObj = AllocateObjectMemory(pTBL); //WRONG!!! “aObj” may point to garbage if the second //“AllocateObjectMemory” triggered a GC. DoSomething (aOb, bObj); } All it does is allocate two managed objects, and then does something with them both. This code compiles fine, and if you run simple pre-checkin tests, it will probably “work.” But this code will crash eventually. Why? If the second call to “AllocateObjectMemory” triggers a GC, that GC discards the object instance you just assigned to “aObj”. This code, like all C++ code inside the CLR, is compiled by a non-managed compiler and the GC cannot know that “aObj” holds a root reference to an object you want kept live. ======================================================================== I can't understand what he explained. Does the sample mean aObj becomes a wild pointer after GC? Is it mean { aObj = (*aObj)malloc(sizeof(object)); free(aObj); function(aObj);? } ? I hope somebody can explain it.

    Read the article

  • Trappings MySQL Warnings on Calls Wrapped in Classes -- Python

    - by chernevik
    I can't get Python's try/else blocks to catch MySQL warnings when the execution statements are wrapped in classes. I have a class that has as a MySQL connection object as an attribute, a MySQL cursor object as another, and a method that run queries through that cursor object. The cursor is itself wrapped in a class. These seem to run queries properly, but the MySQL warnings they generate are not caught as exceptions in a try/else block. Why don't the try/else blocks catch the warnings? How would I revise the classes or method calls to catch the warnings? Also, I've looked through the prominent sources and can't find a discussion that helps me understand this. I'd appreciate any reference that explains this. Please see code below. Apologies for verbosity, I'm newbie. #!/usr/bin/python import MySQLdb import sys import copy sys.path.append('../../config') import credentials as c # local module with dbase connection credentials #============================================================================= # CLASSES #------------------------------------------------------------------------ class dbMySQL_Connection: def __init__(self, db_server, db_user, db_passwd): self.conn = MySQLdb.connect(db_server, db_user, db_passwd) def getCursor(self, dict_flag=True): self.dbMySQL_Cursor = dbMySQL_Cursor(self.conn, dict_flag) return self.dbMySQL_Cursor def runQuery(self, qryStr, dict_flag=True): qry_res = runQueryNoCursor(qryStr=qryStr, \ conn=self, \ dict_flag=dict_flag) return qry_res #------------------------------------------------------------------------ class dbMySQL_Cursor: def __init__(self, conn, dict_flag=True): if dict_flag: dbMySQL_Cursor = conn.cursor(MySQLdb.cursors.DictCursor) else: dbMySQL_Cursor = conn.cursor() self.dbMySQL_Cursor = dbMySQL_Cursor def closeCursor(self): self.dbMySQL_Cursor.close() #============================================================================= # QUERY FUNCTIONS #------------------------------------------------------------------------------ def runQueryNoCursor(qryStr, conn, dict_flag=True): dbMySQL_Cursor = conn.getCursor(dict_flag) qry_res =runQueryFnc(qryStr, dbMySQL_Cursor.dbMySQL_Cursor) dbMySQL_Cursor.closeCursor() return qry_res #------------------------------------------------------------------------------ def runQueryFnc(qryStr, dbMySQL_Cursor): qry_res = {} qry_res['rows'] = dbMySQL_Cursor.execute(qryStr) qry_res['result'] = copy.deepcopy(dbMySQL_Cursor.fetchall()) qry_res['messages'] = copy.deepcopy(dbMySQL_Cursor.messages) qry_res['query_str'] = qryStr return qry_res #============================================================================= # USAGES qry = 'DROP DATABASE IF EXISTS database_of_armaments' dbConn = dbMySQL_Connection(**c.creds) def dbConnRunQuery(): # Does not trap an exception; warning displayed to standard error. try: dbConn.runQuery(qry) except: print "dbConn.runQuery() caught an exception." def dbConnCursorExecute(): # Does not trap an exception; warning displayed to standard error. dbConn.getCursor() # try/except block does catches error without this try: dbConn.dbMySQL_Cursor.dbMySQL_Cursor.execute(qry) except Exception, e: print "dbConn.dbMySQL_Cursor.execute() caught an exception." print repr(e) def funcRunQueryNoCursor(): # Does not trap an exception; no warning displayed try: res = runQueryNoCursor(qry, dbConn) print 'Try worked. %s' % res except Exception, e: print "funcRunQueryNoCursor() caught an exception." print repr(e) #============================================================================= if __name__ == '__main__': print '\n' print 'EXAMPLE -- dbConnRunQuery()' dbConnRunQuery() print '\n' print 'EXAMPLE -- dbConnCursorExecute()' dbConnCursorExecute() print '\n' print 'EXAMPLE -- funcRunQueryNoCursor()' funcRunQueryNoCursor() print '\n'

    Read the article

  • How do I check for the existence of an external file with XSL?

    - by LOlliffe
    I've found a lot of examples that reference Java and C for this, but how do I, or can I, check for the existence of an external file with XSL. First, I realize that this is only a snippet, but it's part of a huge stylesheet, so I'm hoping it's enough to show my issue. <!-- Use this template for Received SMSs --> <xsl:template name="ReceivedSMS"> <!-- Set/Declare "SMSname" variable (local, evaluates per instance) --> <xsl:variable name="SMSname"> <xsl:value-of select=" following-sibling::Name"/> </xsl:variable> <fo:table font-family="Arial Unicode MS" font-size="8pt" text-align="start"> <fo:table-column column-width=".75in"/> <fo:table-column column-width="6.75in"/> <fo:table-body> <fo:table-row> <!-- Cell contains "speakers" icon --> <fo:table-cell display-align="after"> <fo:block text-align="start"> <fo:external-graphic src="../images/{$SMSname}.jpg" content-height="0.6in"/> What I'd like to do, is put in an "if" statement, surronding the {$SMSname}.jpg line. That is: <fo:block text-align="start"> <xsl:if test="exists( the external file {$SMSname}.jpg)"> <fo:external-graphic src="../images/{$SMSname}.jpg" content-height="0.6in"/> </xsl:if> <xsl:if test="not(exists( the external file {$SMSname}.jpg))"> <fo:external-graphic src="../images/unknown.jpg" content-height="0.6in"/> </xsl:if> </fo:block> Because of "grouping", etc., I'm using XSLT 2.0. I hope that this is something that can be done. I hope even more that it's something simple. As always, thanks in advance for any help. LO

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • SQL Native Client 10 Performance miserable (due to server-side cursors)

    - by namezero
    we have an application that uses ODBC via CDatabase/CRecordset in MFC (VS2010). We have two backends implemented. MSSQL and MySQL. Now, when we use MSSQL (with the Native Client 10.0), retrieving records with SELECT is dramatically slow via slow links (VPN, for example). The MySQL ODBC driver does not exhibit this nasty behavior. For example: CRecordset r(&m_db); r.Open(CRecordset::snapshot, L"SELECT a.something, b.sthelse FROM TableA AS a LEFT JOIN TableB AS b ON a.ID=b.Ref"); r.MoveFirst(); while(!r.IsEOF()) { // Retrieve CString strData; crs.GetFieldValue(L"a.something", strData); crs.MoveNext(); } Now, with the MySQL driver, everything runs as it should. The query is returned, and everything is lightning fast. However, with the MSSQL Native Client, things slow down, because on every MoveNext(), the driver communicates with the server. I think it is due to server-side cursors, but I didn't find a way to disable them. I have tried using: ::SQLSetConnectAttr(m_db.m_hdbc, SQL_ATTR_ODBC_CURSORS, SQL_CUR_USE_ODBC, SQL_IS_INTEGER); But this didn't help either. There are still long-running exec's to sp_cursorfetch() et al in SQL Profiler. I have also tried a small reference project with SQLAPI and bulk fetch, but that hangs in FetchNext() for a long time, too (even if there is only one record in the resultset). This however only happens on queries with LEFT JOINS, table-valued functions, etc. Note that the query doesn't take that long - executing the same SQL via SQL Studio over the same connection returns in a reasonable time. Question1: Is is possible to somehow get the native client to "cache" all results locally use local cursors in a similar fashion as the MySQL driver seems to do it? Maybe this is the wrong approach altogether, but I'm not sure how else to do this. All we want is to retrieve all data at once from a SELECT, then never talk the server again until the next query. We don't care about recordset updates, deletes, etc or any of that nonsense. We only want to retrieve data. We take that recordset, get all the data, and delete it. Question2: Is there a more efficient way to just retrieve data in MFC with ODBC?

    Read the article

  • Backbone.js (model instanceof Model) via Chrome Extension

    - by Leoncelot
    Hey guys, This is my first time ever posting on this site and the problem I'm about to pose is difficult to articulate due to the set of variables required to arrive at it. Let me just quickly explain the framework I'm working with. I'm building a Chrome Extension using jQuery, jQuery-ui, and Backbone The entire JS suite for the extension is written in CoffeeScript and I'm utilizing Rails and the asset pipeline to manage it all. This means that when I want to deploy my extension code I run rake assets:precompile and copy the resulting compressed JS to my extensions Directory. The nice thing about this approach is that I can actually run the extension js from inside my Rails app by including the library. This is basically the same as my extensions background.js file which injects the js as a content script. Anyway, the problem I've recently encountered was when I tried testing my extension on my buddy's site, whiskeynotes.com. What I was noticing is that my backbone models were being mangled upon adding them to their respective collections. So something like this.collection.add(new SomeModel) created some nonsense version of my model. This code eventually runs into Backbone's prepareModel code _prepareModel: function(model, options) { options || (options = {}); if (!(model instanceof Model)) { var attrs = model; options.collection = this; model = new this.model(attrs, options); if (!model._validate(model.attributes, options)) model = false; } else if (!model.collection) { model.collection = this; } return model; }, Now, in most of the sites on which I've tested the extension, the result is normal, however on my buddy's site the !(model instance Model) evaluates to true even though it is actually an instance of the correct class. The consequence is a super messed up version of the model where the model's attributes is a reference to the models collection (strange right?). Needless to say, all kinds of crazy things were happening afterward. Why this is occurring is beyond me. However changing this line (!(model instanceof Model)) to (!(model instanceof Backbone.Model)) seems to fix the problem. I thought maybe it had something to do with the Flot library (jQuery graph library) creating their own version of 'Model' but looking through the source yielded no instances of it. I'm just curious as to why this would happen. And does it make sense to add this little change to the Backbone source? Update: I just realized that the "fix" doesn't actually work. I can also add that my backbone Models are namespaced in a wrapping object so that declaration looks something like class SomeNamespace.SomeModel extends Backbone.Model

    Read the article

  • How do I create a thread-safe write-once read-many value in Java?

    - by Software Monkey
    This is a problem I encounter frequently in working with more complex systems and which I have never figured out a good way to solve. It usually involves variations on the theme of a shared object whose construction and initialization are necessarily two distinct steps. This is generally because of architectural requirements, similar to applets, so answers that suggest I consolidate construction and initialization are not useful. By way of example, let's say I have a class that is structured to fit into an application framework like so: public class MyClass { private /*ideally-final*/ SomeObject someObject; MyClass() { someObject=null; } public void startup() { someObject=new SomeObject(...arguments from environment which are not available until startup is called...); } public void shutdown() { someObject=null; // this is not necessary, I am just expressing the intended scope of someObject explicitly } } I can't make someObject final since it can't be set until startup() is invoked. But I would really like it to reflect it's write-once semantics and be able to directly access it from multiple threads, preferably avoiding synchronization. The idea being to express and enforce a degree of finalness, I conjecture that I could create a generic container, like so: public class WoRmObject<T> { private T object; WoRmObject() { object=null; } public WoRmObject set(T val) { object=val; return this; } public T get() { return object; } } and then in MyClass, above, do: private final WoRmObject<SomeObject> someObject; MyClass() { someObject=new WoRmObject<SomeObject>(); } public void startup() { someObject.set(SomeObject(...arguments from environment which are not available until startup is called...)); } Which raises some questions for me: Is there a better way, or existing Java object (would have to be available in Java 4)? Is this thread-safe provided that no other thread accesses someObject.get() until after it's set() has been called. The other threads will only invoke methods on MyClass between startup() and shutdown() - the framework guarantees this. Given the completely unsynchronized WoRmObject container, it is ever possible under either JMM to see a value of object which is neither null nor a reference to a SomeObject? In other words, does has the JMM always guaranteed that no thread can observe the memory of an object to be whatever values happened to be on the heap when the object was allocated.

    Read the article

  • Writing a managed wrapper for unmanaged (C++) code - custom types/structs

    - by Bobby
    faacEncConfigurationPtr FAACAPI faacEncGetCurrentConfiguration( faacEncHandle hEncoder); I'm trying to come up with a simple wrapper for this C++ library; I've never done more than very simple p/invoke interop before - like one function call with primitive arguments. So, given the above C++ function, for example, what should I do to deal with the return type, and parameter? FAACAPI is defined as: #define FAACAPI __stdcall faacEncConfigurationPtr is defined: typedef struct faacEncConfiguration { int version; char *name; char *copyright; unsigned int mpegVersion; unsigned long bitRate; unsigned int inputFormat; int shortctl; psymodellist_t *psymodellist; int channel_map[64]; } faacEncConfiguration, *faacEncConfigurationPtr; AFAIK this means that the return type of the function is a reference to this struct? And faacEncHandle is: typedef struct { unsigned int numChannels; unsigned long sampleRate; ... SR_INFO *srInfo; double *sampleBuff[MAX_CHANNELS]; ... double *freqBuff[MAX_CHANNELS]; double *overlapBuff[MAX_CHANNELS]; double *msSpectrum[MAX_CHANNELS]; CoderInfo coderInfo[MAX_CHANNELS]; ChannelInfo channelInfo[MAX_CHANNELS]; PsyInfo psyInfo[MAX_CHANNELS]; GlobalPsyInfo gpsyInfo; faacEncConfiguration config; psymodel_t *psymodel; /* quantizer specific config */ AACQuantCfg aacquantCfg; /* FFT Tables */ FFT_Tables fft_tables; int bitDiff; } faacEncStruct, *faacEncHandle; So within that struct we see a lot of other types... hmm. Essentially, I'm trying to figure out how to deal with these types in my managed wrapper? Do I need to create versions of these types/structs, in C#? Something like this: [StructLayout(LayoutKind.Sequential)] struct faacEncConfiguration { uint useTns; ulong bitRate; ... } If so then can the runtime automatically "map" these objects onto eachother? And, would I have to create these "mapped" types for all the types in these return types/parameter type hierarchies, all the way down until I get to all primitives? I know this is a broad topic, any advice on getting up-to-speed quickly on what I need to learn to make this happen would be very much appreciated! Thanks!

    Read the article

  • Select latest group by in nhibernate

    - by Kendrick
    I have Canine and CanineHandler objects in my application. The CanineHandler object has a PersonID (which references a completely different database), an EffectiveDate (which specifies when a handler started with the canine), and a FK reference to the Canine (CanineID). Given a specific PersonID, I want to find all canines they're currently responsible for. The (simplified) query I'd use in SQL would be: Select Canine.* from Canine inner join CanineHandler on(CanineHandler.CanineID=Canine.CanineID) inner join (select CanineID,Max(EffectiveDate) MaxEffectiveDate from caninehandler group by CanineID) as CurrentHandler on(CurrentHandler.CanineID=CanineHandler.CanineID and CurrentHandler.MaxEffectiveDate=CanineHandler.EffectiveDate) where CanineHandler.HandlerPersonID=@PersonID Edit: Added mapping files below: <class name="CanineHandler" table="CanineHandler" schema="dbo"> <id name="CanineHandlerID" type="Int32"> <generator class="identity" /> </id> <property name="EffectiveDate" type="DateTime" precision="16" not-null="true" /> <property name="HandlerPersonID" type="Int64" precision="19" not-null="true" /> <many-to-one name="Canine" class="Canine" column="CanineID" not-null="true" access="field.camelcase-underscore" /> </class> <class name="Canine" table="Canine"> <id name="CanineID" type="Int32"> <generator class="identity" /> </id> <property name="Name" type="String" length="64" not-null="true" /> ... <set name="CanineHandlers" table="CanineHandler" inverse="true" order-by="EffectiveDate desc" cascade="save-update" access="field.camelcase-underscore"> <key column="CanineID" /> <one-to-many class="CanineHandler" /> </set> <property name="IsDeleted" type="Boolean" not-null="true" /> </class> I haven't tried yet, but I'm guessing I could do this in HQL. I haven't had to write anything in HQL yet, so I'll have to tackle that eventually anyway, but my question is whether/how I can do this sub-query with the criterion/subqueries objects. I got as far as creating the following detached criteria: DetachedCriteria effectiveHandlers = DetachedCriteria.For<Canine>() .SetProjection(Projections.ProjectionList() .Add(Projections.Max("EffectiveDate"),"MaxEffectiveDate") .Add(Projections.GroupProperty("CanineID"),"handledCanineID") ); but I can't figure out how to do the inner join. If I do this: Session.CreateCriteria<Canine>() .CreateCriteria("CanineHandler", "handler", NHibernate.SqlCommand.JoinType.InnerJoin) .List<Canine>(); I get an error "could not resolve property: CanineHandler of: OPS.CanineApp.Model.Canine". Obviously I'm missing something(s) but from the documentation I got the impression that should return a list of Canines that have handlers (possibly with duplicates). Until I can make this work, adding the subquery isn't going to work... I've found similar questions, such as http://stackoverflow.com/questions/747382/only-get-latest-results-using-nhibernate but none of the answers really seem to apply with the kind of direct result I'm looking for. Any help or suggestion is greatly appreciated.

    Read the article

  • How to implement a caching model without violating MVC pattern?

    - by RPM1984
    Hi Guys, I have an ASP.NET MVC 3 (Razor) Web Application, with a particular page which is highly database intensive, and user experience is of the upmost priority. Thus, i am introducing caching on this particular page. I'm trying to figure out a way to implement this caching pattern whilst keeping my controller thin, like it currently is without caching: public PartialViewResult GetLocationStuff(SearchPreferences searchPreferences) { var results = _locationService.FindStuffByCriteria(searchPreferences); return PartialView("SearchResults", results); } As you can see, the controller is very thin, as it should be. It doesn't care about how/where it is getting it's info from - that is the job of the service. A couple of notes on the flow of control: Controllers get DI'ed a particular Service, depending on it's area. In this example, this controller get's a LocationService Services call through to an IQueryable<T> Repository and materialize results into T or ICollection<T>. How i want to implement caching: I can't use Output Caching - for a few reasons. First of all, this action method is invoked from the client-side (jQuery/AJAX), via [HttpPost], which according to HTTP standards should not be cached as a request. Secondly, i don't want to cache purely based on the HTTP request arguments - the cache logic is a lot more complicated than that - there is actually two-level caching going on. As i hint to above, i need to use regular data-caching, e.g Cache["somekey"] = someObj;. I don't want to implement a generic caching mechanism where all calls via the service go through the cache first - i only want caching on this particular action method. First thought's would tell me to create another service (which inherits LocationService), and provide the caching workflow there (check cache first, if not there call db, add to cache, return result). That has two problems: The services are basic Class Libraries - no references to anything extra. I would need to add a reference to System.Web here. I would have to access the HTTP Context outside of the web application, which is considered bad practice, not only for testability, but in general - right? I also thought about using the Models folder in the Web Application (which i currently use only for ViewModels), but having a cache service in a models folder just doesn't sound right. So - any ideas? Is there a MVC-specific thing (like Action Filter's, for example) i can use here? General advice/tips would be greatly appreciated.

    Read the article

  • NSNotifications vs delegate for multiple instances of same protocol

    - by Brent Traut
    I could use some architectural advice. I've run into the following problem a few times now and I've never found a truly elegant way to solve it. The issue, described at the highest level possible:I have a parent class that would like to act as the delegate for multiple children (all using the same protocol), but when the children call methods on the parent, the parent no longer knows which child is making the call. I would like to use loose coupling (delegates/protocols or notifications) rather than direct calls. I don't need multiple handlers, so notifications seem like they might be overkill. To illustrate the problem, let me try a super-simplified example: I start with a parent view controller (and corresponding view). I create three child views and insert each of them into the parent view. I would like the parent view controller to be notified whenever the user touches one of the children. There are a few options to notify the parent: Define a protocol. The parent implements the protocol and sets itself as the delegate to each of the children. When the user touches a child view, its view controller calls its delegate (the parent). In this case, the parent is notified that a view is touched, but it doesn't know which one. Not good enough. Same as #1, but define the methods in the protocol to also pass some sort of identifier. When the child tells its delegate that it was touched, it also passes a pointer to itself. This way, the parent know exactly which view was touched. It just seems really strange for an object to pass a reference to itself. Use NSNotifications. The parent defines a separate method for each of the three children and then subscribes to the "viewWasTouched" notification for each of the three children as the notification sender. The children don't need to attach themselves to the user dictionary, but they do need to send the notification with a pointer to themselves as the scope. Same as #4, but rather than using separate methods, the parent could just use one with a switch case or other branching along with the notification's sender to determine which path to take. Create multiple man-in-the-middle classes that act as the delegates to the child views and then call methods on the parent either with a pointer to the child or with some other differentiating factor. This approach doesn't seem scalable. Are any of these approaches considered best practice? I can't say for sure, but it feels like I'm missing something more obvious/elegant.

    Read the article

  • Good design of mapping Java Domain objects to Tables (using Hibernate)

    - by M. McKenzie
    Hey guys, I have a question that is more in the realm of design, than implementation. I'm also happy for anyone to point out resources for the answer and I'll gladly, research for myself. Highly simplified Java and SQL: Say I have a business domain POJO called 'Picture' with three attributes. class Picture int idPicture String fileName long size Say I have another business domain POJO called "Item" with 3 attributes Class Item int idItem String itemName ArrayList itemPictures These would be a normal simple relationship. You could say that 'Picture' object, will never exist outside an 'Item' object. Assume a picture belongs only to a specific item, but that an item can have multiple pictures Now - using good database design (3rd Normal Form), we know that we should put items and pictures in their own tables. Here is what I assume would be correct. table Item int idItem (primary key) String itemName table Picture int idPicture (primary key) varchar(45) fileName long size int idItem (foreign key) Here is my question: If you are making Hibernate mapping files for these objects. In the data design, your Picture table needs a column to refer to the Item, so that a foreign key relation can be maintained. However,in your business domain objects - your Picture does not hold a reference/attribute to the idItem - and does not need to know it. A java Picture instance is always instantiated inside an Item instance. If you want to know the Item that the Picture belongs to you are already in the correct scope. Call myItem.getIdItem() and myItem.getItemPictures(),and you have the two pieces of information you need. I know that Hibernate tools have a generator that can auto make your POJO's from looking at your database. My problem stems from the fact that I planned out the data design for this experiment/project first. Then when I went to make the domain java objects, I realized that good design dictated that the objects hold other objects in a nested way. This is obviously different from the way that a database schema is - where all objects(tables) are flat and hold no other complex types within them. What is a good way to reconcile this? Would you: (A) Make the hibernate mapping files so that Picture.hbm.xml has a mapping to the POJO parent's idItem Field (if it's even possible) (B) Add an int attribute in the Picture class to refer to the idItem and set it at instantiation, thus simplifying the hbm.xml mapping file by having all table fields as local attributes in the class (C) Fix the database design because it is wrong, dork. I'd truly appreciate any feedback

    Read the article

  • initializing a vector of custom class in c++

    - by Flamewires
    Hey basically Im trying to store a "solution" and create a vector of these. The problem I'm having is with initialization. Heres my class for reference class Solution { private: // boost::thread m_Thread; int itt_found; int dim; pfn_fitness f; double value; std::vector<double> x; public: Solution(size_t size, int funcNo) : itt_found(0), x(size, 0.0), value(0.0), dim(30), f(Eval_Functions[funcNo]) { for (int i = 1; i < (int) size; i++) { x[i] = ((double)rand()/((double)RAND_MAX))*maxs[funcNo]; } } Solution() : itt_found(0), x(31, 0.0), value(0.0), dim(30), f(Eval_Functions[1]) { for (int i = 1; i < 31; i++) { x[i] = ((double)rand()/((double)RAND_MAX))*maxs[1]; } } Solution operator= (Solution S) { x = S.GetX(); itt_found = S.GetIttFound(); dim = S.GetDim(); f = S.GetFunc(); value = S.GetValue(); return *this; } void start() { value = f (dim, x); } /* plus additional getter/setter methods*/ } Solution S(30, 1) or Solution(2, 5) work and initalizes everything, but I need X of these solution objects. std::vector<Solution> Parents(X) will create X solutions with the default constructor and i want to construct using the (int, int) constructor. Is there any easy(one liner?) way to do this? Or would i have to do something like: size_t numparents = 10; vector<Solution> Parents; Parents.reserve(numparents); for (int i = 0; i<(int)numparents; i++) { Solution S(31, 0); Parents.push_back(S); }

    Read the article

  • Emacs, C++ code completion for vectors

    - by Caglar Toklu
    Hi, I am new to Emacs, and I have the following code as a sample. I have installed GNU Emacs 23.1.1 (i386-mingw-nt6.1.7600), installed cedet-1.0pre7.tar.gz. , installed ELPA, and company. You can find my simple Emacs configuration at the bottom. The problem is, when I type q[0] in main() and press . (dot), I see the 37 members of the vector, not Person although first_name and last_name are expected. The completion works as expected in the function greet() but it has nothing to do with vector. My question is, how can I accomplish code completion for vector elements too? #include <iostream> #include <vector> using namespace std; class Person { public: string first_name; string last_name; }; void greet(Person a_person) { // a_person.first_name is completed as expected! cout << a_person.first_name << "|"; cout << a_person.last_name << endl; }; int main() { vector<Person> q(2); Person guy1; guy1.first_name = "foo"; guy1.last_name = "bar"; Person guy2; guy2.first_name = "stack"; guy2.last_name = "overflow"; q[0] = guy1; q[1] = guy2; greet(guy1); greet(guy2); // cout q[0]. I want to see first_name or last_name here! } My Emacs configuration: ;;; This was installed by package-install.el. ;;; This provides support for the package system and ;;; interfacing with ELPA, the package archive. ;;; Move this code earlier if you want to reference ;;; packages in your .emacs. (when (load (expand-file-name "~/.emacs.d/elpa/package.el")) (package-initialize)) (load-file "~/.emacs.d/cedet/common/cedet.el") (semantic-load-enable-excessive-code-helpers) (require 'semantic-ia) (global-srecode-minor-mode 1) (semantic-add-system-include "/gcc/include/c++/4.4.2" 'c++-mode) (semantic-add-system-include "/gcc/i386-pc-mingw32/include" 'c++-mode) (semantic-add-system-include "/gcc/include" 'c++-mode) (defun my-semantic-hook () (imenu-add-to-menubar "TAGS")) (add-hook 'semantic-init-hooks 'my-semantic-hook)

    Read the article

  • Maximum nametable char count exceeded

    - by doc
    I'm having issues with the maximum nametable char count quota, I followed a couple of answers here and it solved the problem for a while, but now I'm having the same issue. My Server side config is as follows: <system.serviceModel> <bindings> <netTcpBinding> <binding name="GenericBinding" maxBufferPoolSize="2147483647" maxBufferSize="2147483647" maxReceivedMessageSize="2147483647"> <readerQuotas maxDepth="2147483647" maxStringContentLength="2147483647" maxArrayLength="2147483647" maxBytesPerRead="2147483647" maxNameTableCharCount="2147483647" /> <security mode="None" /> </binding> </netTcpBinding> </bindings> <behaviors> <serviceBehaviors> <behavior> <serviceMetadata httpGetEnabled="false" /> <serviceDebug includeExceptionDetailInFaults="true" /> <dataContractSerializer maxItemsInObjectGraph="1000000" /> </behavior> </serviceBehaviors> </behaviors> <services> <service name="REMWCF.RemWCFSvc"> <endpoint address="" binding="netTcpBinding" contract="REMWCF.IRemWCFSvc" bindingConfiguration="GenericBinding" /> <endpoint address="mex" binding="mexTcpBinding" contract="IMetadataExchange" /> <host> <baseAddresses> <add baseAddress="net.tcp://localhost:9081/RemWCFSvc" /> </baseAddresses> </host> </service> </services> </system.serviceModel> I also have the same tcp binding on the devenv configuration. Have I reached the limit of contracts supported? Is there a way to turn off that quota? EDIT Error Message: Error: Cannot obtain Metadata from net.tcp://localhost:9081/RemWCFSvc/mex If this is a Windows (R) Communication Foundation service to which you have access, please check that you have enabled metadata publishing at the specified address. For help enabling metadata publishing, please refer to the MSDN documentation at http://go.microsoft.com/fwlink/?LinkId=65455.WS-Metadata Exchange Error URI: net.tcp://localhost:9081/RemWCFSvc/mex Metadata contains a reference that cannot be resolved: 'net.tcp://localhost:9081/RemWCFSvc/mex'. There is an error in the XML document. The maximum nametable character count quota (16384) has been exceeded while reading XML data. The nametable is a data structure used to store strings encountered during XML processing - long XML documents with non-repeating element names, attribute names and attribute values may trigger this quota. This quota may be increased by changing the MaxNameTableCharCount property on the XmlDictionaryReaderQuotas object used when creating the XML reader. I'm getting that error when trying to run the WCF (which is hosted in a windows service app).

    Read the article

  • using a Singleton to pass credentials in a multi-tenant application a code smell?

    - by Hans Gruber
    Currently working on a multi-tenant application that employs Shared DB/Shared Schema approach. IOW, we enforce tenant data segregation by defining a TenantID column on all tables. By convention, all SQL reads/writes must include a Where TenantID = '?' clause. Not an ideal solution, but hindsight is 20/20. Anyway, since virtually every page/workflow in our app must display tenant specific data, I made the (poor) decision at the project's outset to employ a Singleton to encapsulate the current user credentials (i.e. TenantID and UserID). My thinking at the time was that I didn't want to add a TenantID parameter to each and every method signature in my Data layer. Here's what the basic pseudo-code looks like: public class UserIdentity { public UserIdentity(int tenantID, int userID) { TenantID = tenantID; UserID = userID; } public int TenantID { get; private set; } public int UserID { get; private set; } } public class AuthenticationModule : IHttpModule { public void Init(HttpApplication context) { context.AuthenticateRequest += new EventHandler(context_AuthenticateRequest); } private void context_AuthenticateRequest(object sender, EventArgs e) { var userIdentity = _authenticationService.AuthenticateUser(sender); if (userIdentity == null) { //authentication failed, so redirect to login page, etc } else { //put the userIdentity into the HttpContext object so that //its only valid for the lifetime of a single request HttpContext.Current.Items["UserIdentity"] = userIdentity; } } } public static class CurrentUser { public static UserIdentity Instance { get { return HttpContext.Current.Items["UserIdentity"]; } } } public class WidgetRepository: IWidgetRepository{ public IEnumerable<Widget> ListWidgets(){ var tenantId = CurrentUser.Instance.TenantID; //call sproc with tenantId parameter } } As you can see, there are several code smells here. This is a singleton, so it's already not unit test friendly. On top of that you have a very tight-coupling between CurrentUser and the HttpContext object. By extension, this also means that I have a reference to System.Web in my Data layer (shudder). I want to pay down some technical debt this sprint by getting rid of this singleton for the reasons mentioned above. I have a few thoughts on what an better implementation might be, but if anyone has any guidance or lessons learned they could share, I would be much obliged.

    Read the article

  • manipulate content inserted by ajax, without using the callback

    - by Cody
    I am using ajax to insert a series of informational blocks via a loop. The blocks each have a title, and long description in them that is hidden by default. They function like an accordion, only showing one description at a time amongst all of the blocks. The problem is opening the description on the first block. I would REALLY like to do it with javascript right after the loop that is creating them is done. Is it possible to manipulate elements created ofter an ajax call without using the callback? <!-- example code--> <style> .placeholder, .long_description{ display:none;} </style> </head><body> <script> /* yes, this script is in the body, dont know if it matters */ $(document).ready(function() { $(".placeholder").each(function(){ // Use the divs to get the blocks var blockname = $(this).html(); // the contents if the div is the ID for the ajax POST $.post("/service_app/dyn_block",'form='+blockname, function(data){ var divname = '#div_' + blockname; $(divname).after(data); $(this).setupAccrdFnctly(); //not the actual code }); }); /* THIS LINE IS THE PROBLEM LINE, is it possible to reference the code ajax inserted */ /* Display the long description in the first dyn_block */ $(".dyn_block").first().find(".long_description").addClass('active').slideDown('fast'); }); </script> <!-- These lines are generated by PHP --> <!-- It is POSSIBLE to display the dyn_blocks --> <!-- here but I would really rather not --> <div id="div_servicetype" class="placeholder">servicetype</div> <div id="div_custtype" class="placeholder">custtype</div> <div id="div_custinfo" class="placeholder">custinfo</div> <div id="div_businfo" class="placeholder">businfo</div> </body>

    Read the article

  • Pass param to a silverlight application

    - by Lucas_Santos
    In my javascript I create my <OBJECT> tag var htmlEmbedSilverlight = "<div id='silverlightControlHost'> " + "<object data='data:application/x-silverlight-2,' type='application/x-silverlight-2' width='550px' height='250px'> " + "<param name='source' value='../../ClientBin/FotoEmprestimoChave.xap'/> " + "<param name='onError' value='onSilverlightError' /> " + "<param name='background' value='white' /> " + "<param name='minRuntimeVersion' value='4.0.60310.0' /> " + "<param name='autoUpgrade' value='true' /> " + "<param name='initparams' values='chave_id=" + data + "' /> " + "<a href='http://go.microsoft.com/fwlink/?LinkID=149156&v=4.0.60310.0' style='text-decoration:none'> " + "<img src='http://go.microsoft.com/fwlink/?LinkId=161376' alt='Get Microsoft Silverlight' style='border-style:none'/> " + "</a> " + "</object><iframe id='_sl_historyFrame' style='visibility:hidden;height:0px;width:0px;border:0px'></iframe></div>"; $("#tiraFotoSilverlight").html(htmlEmbedSilverlight); This is a reference to my Silverlight application where I call in my Web Application. The problem is my <param name='initparams' values='chave_id=" + data + "' /> " because in my App.xaml in Silverlight, I have the code below private void Application_Startup(object sender, StartupEventArgs e) { if (e.InitParams != null) { foreach (var item in e.InitParams) { this.Resources.Add(item.Key, item.Value); } } this.RootVisual = new MainPage(); } Where InitParams always has Count = 0 and I don't know why. Can someone help me ? I'm just trying to pass a value to my Silverlight application, without a PostBack. Rendered <object width="550px" height="250px" type="application/x-silverlight-2" data="data:application/x-silverlight-2,"> <param value="../../ClientBin/FotoEmprestimoChave.xap" name="source"> <param value="onSilverlightError" name="onError"> <param value="white" name="background"> <param value="4.0.60310.0" name="minRuntimeVersion"> <param value="true" name="autoUpgrade"> <param values="chave_id=1" name="initparams"> <a style="text-decoration:none" href="http://go.microsoft.com/fwlink/?LinkID=149156&v=4.0.60310.0"> </object>

    Read the article

  • Spring's JdbcDaoSupport (using MySQL Connector/J) fails after executing sql that adds FK

    - by John
    I am using Spring's JdbcDaoSupport class with a DriverManagerDataSource using the MySQL Connector/J 5.0 driver (driverClassName=com.mysql.jdbc.driver). allowMultiQueries is set to true in the url. My application is an in-house tool we recently developed that executes sql scripts in a directory one-by-one (allows us to re-create our schema and reference table data for a given date, etc, but I digress). The sql scripts sometime contain multiple statements (hence allowMultiQueries), so one script can create a table, add indexes for that table, etc. The problem happens when including a statement to add a foreign key constraint in one of these files. If I have a file that looks like... --(column/constraint names are examples) CREATE TABLE myTable ( fk1 BIGINT(19) NOT NULL, fk2 BIGINT(19) NOT NULL, PRIMARY KEY (fk1, fk2) ); ALTER TABLE myTable ADD CONSTRAINT myTable_fk1 FOREIGN KEY (fk1) REFERENCES myOtherTable (id) ; ALTER TABLE myTable ADD CONSTRAINT myTable_fk2 FOREIGN KEY (fk2) REFERENCES myOtherOtherTable (id) ; then JdbcTemplate.execute throws an UncategorizedSqlException with the following error message and stack trace: Exception in thread "main" org.springframework.jdbc.UncategorizedSQLException: StatementCallback; uncategorized SQLException for SQL [ THE SQL YOU SEE ABOVE LISTED HERE ]; SQL state [HY000]; error code [1005]; Can't create table 'myDatabase.myTable' (errno: 150); nested exception is java.sql.SQLException: Can't create table 'myDatabase.myTable' (errno: 150) at org.springframework.jdbc.support.AbstractFallbackSQLExceptionTranslator.translate(AbstractFallbackSQLExceptionTranslator.java:83) at org.springframework.jdbc.support.AbstractFallbackSQLExceptionTranslator.translate(AbstractFallbackSQLExceptionTranslator.java:80) at org.springframework.jdbc.support.AbstractFallbackSQLExceptionTranslator.translate(AbstractFallbackSQLExceptionTranslator.java:80) and the table and foreign keys are not inserted. Also, especially weird: if I take the foreign key statements out of the script I showed above and then place them in their own script that executes after (so I now have 1 script with just the create table statement, and 1 script with the add foreign key statements that executes after that) then what happens is: tool executes create table script, works fine, table is created tool executes add fk script, throws the same exception as seen above (except errno=121 this time), but the FKs actually get added (!!!) In other words, when the create table/FK statements are in the same script then the exception is thrown and nothing is created, but when they are different scripts a nearly identical exception is thrown but both things get created. Any help on this would be greatly appreciated. Please let me know if you'd like me to clarify anything more.

    Read the article

< Previous Page | 431 432 433 434 435 436 437 438 439 440 441 442  | Next Page >