Search Results

Search found 19480 results on 780 pages for 'do your own homework'.

Page 45/780 | < Previous Page | 41 42 43 44 45 46 47 48 49 50 51 52  | Next Page >

• Implement dictionary using java

  - by ahmad

  Task Dictionary ADT The dictionary ADT models a searchable collection of key-element entries Multiple items with the same key are allowed Applications: word-definition pairs Dictionary ADT methods: find(k): if the dictionary has an entry with key k, returns it, else, returns null findAll(k): returns an iterator of all entries with key k insert(k, o): inserts and returns the entry (k, o) remove(e): remove the entry e from the dictionary size(), isEmpty() Operation Output Dictionary insert(5,A) (5,A) (5,A) insert(7,B) (7,B) (5,A),(7,B) insert(2,C) (2,C) (5,A),(7,B),(2,C) insert(8,D) (8,D) (5,A),(7,B),(2,C),(8,D) insert(2,E) (2,E) (5,A),(7,B),(2,C),(8,D),(2,E) find(7) (7,B) (5,A),(7,B),(2,C),(8,D),(2,E) find(4) null (5,A),(7,B),(2,C),(8,D),(2,E) find(2) (2,C) (5,A),(7,B),(2,C),(8,D),(2,E) findAll(2) (2,C),(2,E) (5,A),(7,B),(2,C),(8,D),(2,E) size() 5 (5,A),(7,B),(2,C),(8,D),(2,E) remove(find(5)) (5,A) (7,B),(2,C),(8,D),(2,E) find(5) null (7,B),(2,C),(8,D),(2,E) Detailed explanation: NO Specific requirements: please Get it done i need HELP !!!

  Read the article

• Recursive function for a binary search in C++

  - by boomsnack

  Create a recursive function for the binary search. This function accepts a sorted array and a give item being search for and returns the index of the item if this give item in the array or returns -1 if this give item is not in the array. Moreover, write a test program to test your function. Sorry for the bad english but my teacher can not write it or speak it very well. This is for a final project and determines whether I graduate or not I went to the tutor and he did not know how to do it either. Any help is greatly appreicated.

  Read the article

• How can I prevent segmentation faults in my program?

  - by worlds-apart89

  I have a C assignment. It is a lot longer than the code shown below, and we are given the function prototypes and instructions only. I have done my best at writing code, but I am stuck with segmentation faults. When I compile and run the program below on Linux, at "735 NaN" it will terminate, indicating a segfault occurred. Why? What am I doing wrong? Basically, the program does not let me access table-list_array[735]-value and table-list_array[735]-key. This is of course the first segfault. There might be more following index 735. #include <stdio.h> #include <stdlib.h> typedef struct list_node list_node_t; struct list_node { char *key; int value; list_node_t *next; }; typedef struct count_table count_table_t; struct count_table { int size; list_node_t **list_array; }; count_table_t* table_allocate(int size) { count_table_t *ptr = malloc(sizeof(count_table_t)); ptr->size = size; list_node_t *nodes[size]; int k; for(k=0; k<size; k++){ nodes[k] = NULL; } ptr->list_array = nodes; return ptr; } void table_addvalue(count_table_t *table) { int i; for(i=0; i<table->size; i++) { table->list_array[i] = malloc(sizeof(list_node_t)); table->list_array[i]->value = i; table->list_array[i]->key = "NaN"; table->list_array[i]->next = NULL; } } int main() { count_table_t *table = table_allocate(1000); table_addvalue(table); int i; for(i=0; i<table->size; i++) printf("%d %s\n", table->list_array[i]->value, table->list_array[i]->key); return 0; }

  Read the article

• how to fix my error saying expected expression before 'else'

  - by user292489

  this program intended to read a .txt, a set of numbers, file and wwrite to another two .txt files called even amd odd as follows: #include <stdio.h> #include <stdlib.h> int main(int argc, char *argv[]) { int i=0,even,odd; int number[i]; // check to make sure that all the file names are entered if (argc != 3) { printf("Usage: executable in_file output_file\n"); exit(0); } FILE *dog = fopen(argv[1], "r"); FILE *feven= fopen(argv[2], "w"); FILE *fodd= fopen (argv[3], "w"); // check whether the file has been opened successfully if (dog == NULL) { printf("File %s cannot open!\n", argv[1]); exit(0); } //odd = fopen(argv[2], "w"); { if (i%2!=1) i++;} fprintf(feven, "%d", even); fscanf(dog, "%d", &number[i]); else { i%2==1; i++;} fprintf(fodd, "%d", odd); fscanf(dog, "%d", &number[i]); fclose(feven); fclose(fodd);

  Read the article

• Optimal sorting algorithm with modified cost... [closed]

  - by David

  The numbers are in a list that is not sorted and supports only one type of operation. The operation is defined as follows: Given a position i and a position j the operation moves the number at position i to position j without altering the relative order of the other numbers. If i j, the positions of the numbers between positions j and i - 1 increment by 1, otherwise if i < j the positions of the numbers between positions i+1 and j decreases by 1. This operation requires i steps to find a number to move and j steps to locate the position to which you want to move it. Then the number of steps required to move a number of position i to position j is i+j. Design an algorithm that given a list of numbers, determine the optimal(in terms of cost) sequence of moves to rearrange the sequence.

  Read the article

• How does Java pick which method to call?

  - by Gaurav

  Given the following code: public class Test { public void method(Object o){ System.out.println("object"); } public void method(String s) { System.out.println("String"); } public void method() { System.out.println("blank"); } /** * @param args */ public static void main(String[] args) { // TODO Auto-generated method stub Test test=new Test(); test.method(null); } } Java prints "String". Why is this the case?

  Read the article

• How to reverse a number as an integer and not as a string?

  - by Pritam

  I came across a question "How can one reverse a number as an integer and not as a string?" Could anyone please help me to find out the answer.

  Read the article

• Help me find some good 'Reflection' reading materials??

  - by IbrarMumtaz

  If it wasn't you guys I would've never discovered Albahari.com's free threading ebook. My apologies if I come off as being extremely lazy but I need to make efficient use of my time and make sure am not just swallowing any garbage of the web. Therefore I am looking for the best and most informative and with a fair bit of detail for the Reflection chapter in .Net. Reflection is something that comes up time and time again and I want to extend my reading from what I know already from the official 70-536 book. I'm not a big fan of MSDN but at the moment that's al I'm using. Anyone got any other good published reading material off the inter web that can help revision for the entrance exam??? Would be greatly appreciated !!! Thanks in Advance, Ibrar

  Read the article

• Interview question: How do I detect a loop in this linked list?

  - by jjujuma

  Say you have a linked list structure in Java. It's made up of Nodes: class Node { Node next; // some user data } and each Node points to the next node, except for the last Node, which has null for next. Say there is a possibility that the list can contain a loop - i.e. the final Node, instead of having a null, has a reference to one of the nodes in the list which came before it. What's the best way of writing boolean hasLoop(Node first) which would return true if the given Node is the first of a list with a loop, and false otherwise? How could you write so that it takes a constant amount of space and a reasonable amount of time? Here's a picture of what a list with a loop looks like: Node->Node->Node->Node->Node->Node--\ \ | ----------------

  Read the article

• parsing the output of the 'w' command?

  - by Blackbinary

  I'm writing a program which requires knowledge of the current load on the system, and the activity of any users (it's a load balancer). This is a university assignment, and I am required to use the w command. I'm having a hard time parsing this command because it is very verbose. Any suggestions on what I can do would be appreciated. This is a small part of the program, and I am free to use whatever method i like. The most condensed version of w which still has the information I require is `w -u -s -f' which produces this: 10:13:43 up 9:57, 2 users, load average: 0.00, 0.00, 0.00 USER TTY IDLE WHAT fsm tty7 22:44m x-session-manager fsm pts/0 0.00s w -u -s -f So out of that, I am interested in the first number after load average and the smallest idle time (so i will need to parse them all). My background process will call w, so the fact that w is the lowest idle time will not matter (all i will see is the tty time). Do you have any ideas? Thanks (I am allowed to use alternative unix commands, like grep, if that helps).

  Read the article

• Recursion problem; completely lost

  - by timeNomad

  So I've been trying to solve this assignment whole day, just can't get it. The following function accepts 2 strings, the 2nd (not 1st) possibly containing *'s (asterisks). An * is a replacement for a string (empty, 1 char or more), it can appear appear (only in s2) once, twice, more or not at all, it cannot be adjacent to another * (ab**c), no need to check that. public static boolean samePattern(String s1, String s2) It returns true if strings are of the same pattern. It must be recursive, not use any loops, static & global variables. Can use local variables & method overloading. Can use only these methods: charAt(i), substring(i), substring(i, j), length(). Examples: 1: TheExamIsEasy; 2: "The*xamIs*y" --- true 1: TheExamIsEasy; 2: "Th*mIsEasy*" --- true 1: TheExamIsEasy; 2: "*" --- true 1: TheExamIsEasy; 2: "TheExamIsEasy" --- true 1: TheExamIsEasy; 2: "The*IsHard" --- FALSE I tried comparing the the chars one by one using charAt until an asterisk is encountered, then check if the asterisk is an empty one by comparing is successive char (i+1) with the char of s1 at position i, if true -- continue recursion with i+1 as counter for s2 & i as counter for s1; if false -- continue recursion with i+1 as counters for both. Continue this until another asterisk is found or end of string. I dunno, my brain loses track of things, can't concentrate, any pointers / hints? Am I in the right direction? Also, it's been told that a backtracking technique is to be used to solve this. My code so far (doesn't do the job, even theoretically): public static boolean samePattern(String s1, String s2) { if (s1.equals(s2) || s2 == "*") { return true; } return samePattern(s1, s2, 1); } public static boolean samePattern(String s1, String s2, int i) { if (s1.equals(s2)) return true; if (i == s2.length() - 1) // No *'s found -- not same pattern. return false; if (s1.substring(0, i).equals(s2.substring(0, i))) samePattern(s1, s2, i+1); else if (s2.charAt(i-1) == '*') samePattern(s1.substring(0, i-1), s2.substring(0, i), 1); // new smaller strings. else samePattern(s1.substring(1), s2, i); }

  Read the article

• Finding the largest subtree in a BST

  - by rakeshr

  Given a binary tree, I want to find out the largest subtree which is a BST in it. Naive approach: I have a naive approach in mind where I visit every node of the tree and pass this node to a isBST function. I will also keep track of the number of nodes in a sub-tree if it is a BST. Is there a better approach than this ?

  Read the article

• How could I evaluate this in code?

  - by WM

  There is a medieval puzzle about an old woman and a basket of eggs. On her way to market, a horseman knocks down the old woman and all the eggs are broken. The horseman will pay for the eggs, but the woman does not remember the exact number she had, only that when she took the eggs in pair, there was one left over; similarly, there was one left over when she took them three or five at a time. When she took them seven at a time, however, none were left. Write an application that can determine the smallest number of eggs the woman could have had. It might be a multiple of seven because there are no eggs left when it's seven at a time. But I have a problem. 49 eggs -1=2*24 49 eggs -1=3*16 49 eggs-4=5*9 49 eggs-0=7*7

  Read the article

• Perl : how to interrupt/resume loop by user hitting a key?

  - by Michael Mao

  Hi all: This is for debugging purpose. I've got a for loop that generates some output to Cygwin bash's CLI. I know that I can redirect outputs to text files and use Perl or even just a normal text editor to inspect the values printed out for a particular iteration, just feel that a bit painful. What I am now thinking is, to place a special subroutine inside the for loop, so that it would be "interrupted" at the beginning of each iteration, and Perl script should only resume to run after user/programmer hits a key(the Enter Key from keyboard?) In this way I can directly inspect the values printed out during each iteration. Is there a simple way to do this, without using additional libraries/CPAN ? Many thanks to the hints/suggestions in advance.

  Read the article

• Issue while saving image using savefiledialog

  - by user1097772

  I'm using savefiledialog to save an image. Canvas is picturebox and the loaded image is bitmap. When I try to save it the file is created but somehow corrupted. Cause when I try againt load the image or show in different viewer it doesn't work - I mean the saved file is corrupted. There is an method for saving image. private void saveFileDialog1_FileOk(object sender, CancelEventArgs e) { System.IO.FileStream fs = (System.IO.FileStream)saveFileDialog1.OpenFile(); try { switch (saveFileDialog1.FilterIndex) { case 1: canvas.Image.Save(saveFileDialog1.FileName, System.Drawing.Imaging.ImageFormat.Bmp); break; case 2: canvas.Image.Save(saveFileDialog1.FileName, System.Drawing.Imaging.ImageFormat.Jpeg); break; case 3: canvas.Image.Save(saveFileDialog1.FileName, System.Drawing.Imaging.ImageFormat.Png); break; case 4: canvas.Image.Save(saveFileDialog1.FileName, System.Drawing.Imaging.ImageFormat.Tiff); break; } } catch (Exception ex) { System.Console.WriteLine("Exception " + ex); } I should also mention the property Filter. saveFileDialog1.Filter has value: bmp (*.bmp)|*.bmp|jpeg (*.jpeg)|*.jpeg|png (*.png)|*.png|tiff (*.tiff)|*.tiff

  Read the article

• calling a function from another function in python

  - by user1040503

  I have written this function that takes to strings in order to see if they are anagrams: def anagram_check(str_x, str_y): x = string1.replace(" ","") y = string2.replace(" ","") lower1 = x.lower() lower2 = y.lower() sorted1 = sorted(lower1) sorted2 = sorted(lower2) if sorted1 == sorted2: return True else: return False this function works fine, the problem is that now I need to use this function in another function in order to find anagrams in a text file. I want to print a list of tuples with all the anagrams in it. this is what i have done so far def anagrams_finder(words_num): anagrams = [] f = open("words.txt") a = list(f) list1 = ([s.replace('\n', '') for s in a]) list2 = ([i.lower() for i in list1]) list3 = list2[0:words_num] #number of words from text that need to be checked. for i in list3: .... I tried using for loops, while loops, appand.... but nothing seems to work. how can I use the first function in order to help me with the second? Please help...

  Read the article

• Accessing every child class of parent class in Java

  - by darkie15

  Hi All, I have to implement a logic whereby given a child class, I need to access its parent class and all other child class of that parent class, if any. I did not find any API in Java Reflection which allows us to access all child classes of a parent class. Is there any way to do it? Ex. class B extends class A class C extends class A Now using class B, I can find the superclass by calling getSuperClass(). But is there any way to find all the child classes once I have the parent class i.e. class B and class C?? Regards, darkie

  Read the article

• Check if there are any repeated elements in an array recursively

  - by devoured elysium

  I have to find recursively if there is any repeated element in an integer array v. The method must have the following signature: boolean hasRepeatedElements(int[] v) I can't see any way of doing that recursively without having to define another method or at least another overload to this method (one that takes for example the element to go after or something). At first I thought about checking for the current v if there is some element equal to the first element, then creating a new array with L-1 elements etc but that seems rather inefficient. Is it the only way? Am I missing here something?

  Read the article

• Initialize a Variable Again.

  - by SoulBeaver

  That may sound a little confusing. Basically, I have a function CCard newCard() { /* Used to store the string variables intermittantly */ std::stringstream ssPIN, ssBN; int picker1, picker2; int pin, bankNum; /* Choose 5 random variables, store them in stream */ for( int loop = 0; loop < 5; ++loop ) { picker1 = rand() % 8 + 1; picker2 = rand() % 8 + 1; ssPIN << picker1; ssBN << picker2; } /* Convert them */ ssPIN >> pin; ssBN >> bankNum; CCard card( pin, bankNum ); return card; } that creates a new CCard variable and returns it to the caller CCard card = newCard(); My teacher advised me that doing this is a violation of OOP principles and has to be put in the class. He told me to use this method as a constructor. Which I did: CCard::CCard() { m_Sperre = false; m_Guthaben = rand() % 1000; /* Work */ /* Convert them */ ssPIN >> m_Geheimzahl; ssBN >> m_Nummer; } All variables with m_ are member variables. However, the constructor works when I initialize the card normally CCard card(); at the start of the program. However, I also have a function, that is supposed to create a new card and return it to the user, this function is now broken. The original command: card = newCard(); isn't available anymore, and card = new CCard(); doesn't work. What other options do I have? I have a feeling using the constructor won't work, and that I probably should just create a class method newCard, but I want to see if it is somehow at all possible to do it the way the teacher wanted. This is creating a lot of headaches for me. I told the teacher that this is a stupid idea and not everything has to be classed in OOP. He has since told me that Java or C# don't allow code outside of classes, which sounds a little incredible. Not sure that you can do this in C++, especially when templated functions exist, or generic algorithms. Is it true that this would be bad code for OOP in C++ if I didn't force it into a class?

  Read the article

• C++ How do I properly use getline for ifstream members.

  - by John

  Ok so I have a problem with getline. I have a file that contains a couple strings. I created it by myself and I have each string on a seperate line. Ex. textfile.txt Line 1 Line 2 Line 3 Line 4 //Little snip of code ifstream inFile("textfile.txt"); getline(inFile, string1); When I debug the program and ask it to print out string1 it shows that "Line 1\r" is saved into string1. I understand that it's from me actually hitting enter when I created the file. This problem causes my program to have a segmentation fault. I know my code works because if I use ofstream to write the file first and then i read it in, it works. So for my quesiton, is their anyway to use the getline function without it picking up the escape sequence \r? If i am not clear just let me know.

  Read the article

• Read from cin or a file

  - by m42a

  When I try to compile the code istream in; if (argc==1) in=cin; else { ifstream ifn(argv[1]); in=ifn; } gcc fails, complaining that operator= is private. Is there any way to set an istream to different values based on a condition?

  Read the article

• Pseudo Transparant images

  - by Samuel

  Hello World! For an assignment at university we program in a pretty unknown language Modula 2, which lacks major graphic support. I was wondering how to achieve a 'transparency' effect on images, i figured it would work like this: Create a 2D array for the background area of the image filled with the colours of the different pixels in that area, create another 2D array of the image with again the colours of every picture and than merge the pixel colours and draw the different "new colours" on their appropriate place. What i was wondering about: how do i merge the colours (hexadecimals) just: ( colour1 + colour2 ) / 2 ? Thanks for your help!!

  Read the article

• How to guard against dividing by zero when doing symbolic regression? ECJ

  - by Charlie

  I'm writing a genetic program to perform symbolic regression on a formula. I'm using ECJ. See tutorial 4 for an example of what this is and the base that I started off of. The problem comes when implementing division as a function to your genetic program. How do you guard against dividing by zero?

  Read the article

• def constrainedMatchPair(firstMatch,secondMatch,length):

  - by smart

  matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

  Read the article

• Encapsulating user input of data for a class (C++)

  - by Dr. Monkey

  For an assignment I've made a simple C++ program that uses a superclass (Student) and two subclasses (CourseStudent and ResearchStudent) to store a list of students and print out their details, with different details shown for the two different types of students (using overriding of the display() method from Student). My question is about how the program collects input from the user of things like the student name, ID number, unit and fee information (for a course student) and research information (for research students): My implementation has the prompting for user input and the collecting of that input handled within the classes themselves. The reasoning behind this was that each class knows what kind of input it needs, so it makes sense to me to have it know how to ask for it (given an ostream through which to ask and an istream to collect the input from). My lecturer says that the prompting and input should all be handled in the main program, which seems to me somewhat messier, and would make it trickier to extend the program to handle different types of students. I am considering, as a compromise, to make a helper class that handles the prompting and collection of user input for each type of Student, which could then be called on by the main program. The advantage of this would be that the student classes don't have as much in them (so they're cleaner), but also they can be bundled with the helper classes if the input functionality is required. This also means more classes of Student could be added without having to make major changes to the main program, as long as helper classes are provided for these new classes. Also the helper class could be swapped for an alternative language version without having to make any changes to the class itself. What are the major advantages and disadvantages of the three different options for user input (fully encapsulated, helper class or in the main program)?

  Read the article

< Previous Page | 41 42 43 44 45 46 47 48 49 50 51 52  | Next Page >