Search Results

Search found 19480 results on 780 pages for 'do your own homework'.

Page 45/780 | < Previous Page | 41 42 43 44 45 46 47 48 49 50 51 52  | Next Page >

  • How can I prevent segmentation faults in my program?

    - by worlds-apart89
    I have a C assignment. It is a lot longer than the code shown below, and we are given the function prototypes and instructions only. I have done my best at writing code, but I am stuck with segmentation faults. When I compile and run the program below on Linux, at "735 NaN" it will terminate, indicating a segfault occurred. Why? What am I doing wrong? Basically, the program does not let me access table-list_array[735]-value and table-list_array[735]-key. This is of course the first segfault. There might be more following index 735. #include <stdio.h> #include <stdlib.h> typedef struct list_node list_node_t; struct list_node { char *key; int value; list_node_t *next; }; typedef struct count_table count_table_t; struct count_table { int size; list_node_t **list_array; }; count_table_t* table_allocate(int size) { count_table_t *ptr = malloc(sizeof(count_table_t)); ptr->size = size; list_node_t *nodes[size]; int k; for(k=0; k<size; k++){ nodes[k] = NULL; } ptr->list_array = nodes; return ptr; } void table_addvalue(count_table_t *table) { int i; for(i=0; i<table->size; i++) { table->list_array[i] = malloc(sizeof(list_node_t)); table->list_array[i]->value = i; table->list_array[i]->key = "NaN"; table->list_array[i]->next = NULL; } } int main() { count_table_t *table = table_allocate(1000); table_addvalue(table); int i; for(i=0; i<table->size; i++) printf("%d %s\n", table->list_array[i]->value, table->list_array[i]->key); return 0; }

    Read the article

  • Read from cin or a file

    - by m42a
    When I try to compile the code istream in; if (argc==1) in=cin; else { ifstream ifn(argv[1]); in=ifn; } gcc fails, complaining that operator= is private. Is there any way to set an istream to different values based on a condition?

    Read the article

  • How could I evaluate this in code?

    - by WM
    There is a medieval puzzle about an old woman and a basket of eggs. On her way to market, a horseman knocks down the old woman and all the eggs are broken. The horseman will pay for the eggs, but the woman does not remember the exact number she had, only that when she took the eggs in pair, there was one left over; similarly, there was one left over when she took them three or five at a time. When she took them seven at a time, however, none were left. Write an application that can determine the smallest number of eggs the woman could have had. It might be a multiple of seven because there are no eggs left when it's seven at a time. But I have a problem. 49 eggs -1=2*24 49 eggs -1=3*16 49 eggs-4=5*9 49 eggs-0=7*7

    Read the article

  • Find if there is an element repeating itself n/k times

    - by gleb-pendler
    You have an array size n and a constant k (whatever) You can assume the the array is of int type (although it could be of any type) Describe an algorithm that finds if there is an element(s) that repeats itself at least n/k times... if there is return one. Do so in linear time (O(n)) The catch: do this algorithm (or even pseudo-code) using constant memory and running over the array only twice

    Read the article

  • Java - How to declare table[i][j] elements as instance variables?

    - by JDelage
    All, I am trying to code a Connect4 game. For this, I have created a P4Game class and a P4Board class which represents the i X j dimensions of the Connect4 board. In P4Game, I have the following: public class P4Game{ //INSTANCE VARIABLES private int nbLines; private int nbColumns; private P4Board [][] position; //CONSTRUCTOR public P4Game(int nbLines, int nbColumns){ this.nbColumns = nbColumns; this.nbLines = nbLines; P4Board [][] position = new P4Board [nbLines][nbColumns]; //Creates the table to receive the instances of the P4Board object.*/ for (int i=0; i<nbLines; i++){ for (int j=0; j<nbColumns; j++){ this.position[i][j] = new P4Board(i,j); //Meant to create each object at (line=i, column=j) } } } This causes a NullPointerException in the nested loops where I mention this.position[i][j]. I reference those objects in other methods of this class so I need them to be instance variables. I suppose the exception is due to the fact that I have not listed the table element position[i][j] as an instance variable at the beginning of the class. my question to people here is (1) is my assumption correct, and if so (2) what would be the syntax to declare instance variables of this form? Thank you all for your help with what I realize is a very basic question. Hopefully it will also benefit other newbies. Cheers, JDelage

    Read the article

  • Quickest way to write to file in java

    - by user1097772
    I'm writing an application which compares directory structure. First I wrote an application which writes gets info about files - one line about each file or directory. My soulution is: calling method toFile Static PrintWriter pw = new PrintWriter(new BufferedWriter( new FileWriter("DirStructure.dlis")), true); String line; // info about file or directory public void toFile(String line) { pw.println(line); } and of course pw.close(), at the end. My question is, can I do it quicker? What is the quickest way? Edit: quickest way = quickest writing in the file

    Read the article

  • File processing-Haskell

    - by Martinas Maria
    How can I implement in haskell the following: I receive an input file from the command line. This input file contains words separated with tabs,new lines and spaces.I have two replace this elements(tabs,new lines and spaces) with comma(,) .Observation:more newlines,tabs,spaces will be replaced with a single comma.The result has to be write in a new file(output.txt). Please help me with this.My haskell skills are very scarse. This is what I have so far: processFile::String->String processFile [] =[] processFile input =input process :: String -> IO String process fileName = do text <- readFile fileName return (processFile text) main :: IO () main = do n <- process "input.txt" print n In processFile function I should process the text from the input file. I'm stuck..Please help.

    Read the article

  • Optimal sorting algorithm with modified cost... [closed]

    - by David
    The numbers are in a list that is not sorted and supports only one type of operation. The operation is defined as follows: Given a position i and a position j the operation moves the number at position i to position j without altering the relative order of the other numbers. If i j, the positions of the numbers between positions j and i - 1 increment by 1, otherwise if i < j the positions of the numbers between positions i+1 and j decreases by 1. This operation requires i steps to find a number to move and j steps to locate the position to which you want to move it. Then the number of steps required to move a number of position i to position j is i+j. Design an algorithm that given a list of numbers, determine the optimal(in terms of cost) sequence of moves to rearrange the sequence.

    Read the article

  • Issue while saving image using savefiledialog

    - by user1097772
    I'm using savefiledialog to save an image. Canvas is picturebox and the loaded image is bitmap. When I try to save it the file is created but somehow corrupted. Cause when I try againt load the image or show in different viewer it doesn't work - I mean the saved file is corrupted. There is an method for saving image. private void saveFileDialog1_FileOk(object sender, CancelEventArgs e) { System.IO.FileStream fs = (System.IO.FileStream)saveFileDialog1.OpenFile(); try { switch (saveFileDialog1.FilterIndex) { case 1: canvas.Image.Save(saveFileDialog1.FileName, System.Drawing.Imaging.ImageFormat.Bmp); break; case 2: canvas.Image.Save(saveFileDialog1.FileName, System.Drawing.Imaging.ImageFormat.Jpeg); break; case 3: canvas.Image.Save(saveFileDialog1.FileName, System.Drawing.Imaging.ImageFormat.Png); break; case 4: canvas.Image.Save(saveFileDialog1.FileName, System.Drawing.Imaging.ImageFormat.Tiff); break; } } catch (Exception ex) { System.Console.WriteLine("Exception " + ex); } I should also mention the property Filter. saveFileDialog1.Filter has value: bmp (*.bmp)|*.bmp|jpeg (*.jpeg)|*.jpeg|png (*.png)|*.png|tiff (*.tiff)|*.tiff

    Read the article

  • Find the highest number of occurences in a column in SQL

    - by Ronnie
    Given this table: Order custName description to_char(price) A desa $14 B desb $14 C desc $21 D desd $65 E dese $21 F desf $78 G desg $14 H desh $21 I am trying to display the whole row where prices have the highest occurances, in this case $14 and $21 I believe there needs to be a subquery. So i started out with this: select max(count(price)) from orders group by price which gives me 3. after some time i didn't think that was helpful. i believe i needed the value 14 and 21 rather the the count so i can put that in the where clause. but I'm stuck how to display that. any help?

    Read the article

  • Finding the largest subtree in a BST

    - by rakeshr
    Given a binary tree, I want to find out the largest subtree which is a BST in it. Naive approach: I have a naive approach in mind where I visit every node of the tree and pass this node to a isBST function. I will also keep track of the number of nodes in a sub-tree if it is a BST. Is there a better approach than this ?

    Read the article

  • Still failing a function, not sure why...ideas on test cases to run?

    - by igor
    I've been trying to get this Sudoku game working, and I am still failing some of the individual functions. All together the game works, but when I run it through an "autograder", some test cases fail.. Currently I am stuck on the following function, placeValue, failing. I do have the output that I get vs. what the correct one should be, but am confused..what is something going on? EDIT: I do not know what input/calls they make to the function. What happens is that "invalid row" is outputted after every placeValue call, and I can't trace why.. Here is the output (mine + correct one) if it's at all helpful: http://pastebin.com/Wd3P3nDA Here is placeValue, and following is getCoords that placeValue calls.. void placeValue(Square board[BOARD_SIZE][BOARD_SIZE]) { int x,y,value; if(getCoords(x,y)) { cin>>value; if(board[x][y].permanent) { cout<< endl << "That location cannot be changed"; } else if(!(value>=1 && value<=9)) { cout << "Invalid number"<< endl; clearInput(); } else if(validMove(board, x, y, value)) { board[x][y].number=value; } } } bool getCoords(int & x, int & y) { char row; y=0; cin>>row>>y; x = static_cast<int>(toupper(row)); if (isalpha(row) && (x >= 'A' && x <= 'I') && y >= 1 && y <= 9) { x = x - 'A'; // converts x from a letter to corresponding index in matrix y = y - 1; // converts y to corresponding index in matrix return (true); } else if (!(x >= 'A' && x <= 'I')) { cout<<"Invalid row"<<endl; clearInput(); return false; } else { cout<<"Invalid column"<<endl; clearInput(); return false; } }

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • c program for this quesion

    - by sashi
    suppose that a disk drive has 5000 cylinders, numbered 0 to 4999. the drive is currently serving a request at cylinder 143 and the previous request was at cylinder 125. the ueue of pending requests in the given order is 86,1470,913,17774,948,1509,1022,1750,130. write a 'c' program for finding the total distance in cylinders that the disk arm moves to satisfy all the pending reuests from the current heads position, using SSTF scheduling algorith. seek time is the time for the disk arm to move the head to the cylider containing the desired sector. sstf algorithm selects the minimum seek time from the current head position.

    Read the article

  • Finding if a path between 2 sides of a game board exists

    - by Meny
    Hi, i'm currently working on a game as an assignment for school in java. the game cuurently is designed for Console. the game is for 2 players, one attacking from north to south, and the other from west to east. the purpose of the game is to build a "bridge"/"path" between the 2 of your sides before your opponent does. for example: A B C D E F 1 _ _ X _ _ _ 1 2 O X X _ _ _ 2 3 O X O O O O 3 4 O X O _ _ _ 4 5 X X _ _ _ _ 5 6 X O _ _ _ _ 6 A B C D E F player that attacks from north to south won (path/bridge from C to A) my problem is, what algorithm would be good to check if the user have managed to create a path (will be checked at the end of each turn). you're help would be very appreciated.

    Read the article

  • File IO, Handling CRLF

    - by aCuria
    Hi, i am writing a program that takes a file and splits it up into multiple small files of a user specified size, then join the multiple small files back again. 1) the code must work for c, c++ 2) i am compiling with multiple compilers. I am reading and writing to the files by using the stl functions fread() and fwrite() The problem I am having pertains to CRLF. If the file I am reading from contains CRLF, then I want to retain it when i split and join the files back together. If the file contains LF, then i want to retain LF. Unfortunately, fread() seems to store CRLF as \n (I think), and whatever is written by fwrite() is compiler-dependent. How do i approach this problem? Thanks.

    Read the article

  • SQL to display an event on start date, end date and any days in between.

    - by Tim
    Hello, This should be fairly simple, but I can't get my head around it. I have an event in my database with a startDate and an endDate. I need to display this event (based on the current date) on every day the event occurs. So if the event starts on the 3rd of May and finishes on the 7th of May, the SQL query must find it on every single day. How can I achieve this? SELECT * FROM events WHERE startDate ??? Thanks, Tim

    Read the article

  • Pseudo Transparant images

    - by Samuel
    Hello World! For an assignment at university we program in a pretty unknown language Modula 2, which lacks major graphic support. I was wondering how to achieve a 'transparency' effect on images, i figured it would work like this: Create a 2D array for the background area of the image filled with the colours of the different pixels in that area, create another 2D array of the image with again the colours of every picture and than merge the pixel colours and draw the different "new colours" on their appropriate place. What i was wondering about: how do i merge the colours (hexadecimals) just: ( colour1 + colour2 ) / 2 ? Thanks for your help!!

    Read the article

  • Ad distribution problem: an optimal solution?

    - by Mokuchan
    I'm asked to find a 2 approximate solution to this problem: You’re consulting for an e-commerce site that receives a large number of visitors each day. For each visitor i, where i € {1, 2 ..... n}, the site has assigned a value v[i], representing the expected revenue that can be obtained from this customer. Each visitor i is shown one of m possible ads A1, A2 ..... An as they enter the site. The site wants a selection of one ad for each customer so that each ad is seen, overall, by a set of customers of reasonably large total weight. Thus, given a selection of one ad for each customer, we will define the spread of this selection to be the minimum, over j = 1, 2 ..... m, of the total weight of all customers who were shown ad Aj. Example Suppose there are six customers with values 3, 4, 12, 2, 4, 6, and there are m = 3 ads. Then, in this instance, one could achieve a spread of 9 by showing ad A1 to customers 1, 2, 4, ad A2 to customer 3, and ad A3 to customers 5 and 6. The ultimate goal is to find a selection of an ad for each customer that maximizes the spread. Unfortunately, this optimization problem is NP-hard (you don’t have to prove this). So instead give a polynomial-time algorithm that approximates the maximum spread within a factor of 2. The solution I found is the following: Order visitors values in descending order Add the next visitor value (i.e. assign the visitor) to the Ad with the current lowest total value Repeat This solution actually seems to always find the optimal solution, or I simply can't find a counterexample. Can you find it? Is this a non-polinomial solution and I just can't see it?

    Read the article

  • calling a function from another function in python

    - by user1040503
    I have written this function that takes to strings in order to see if they are anagrams: def anagram_check(str_x, str_y): x = string1.replace(" ","") y = string2.replace(" ","") lower1 = x.lower() lower2 = y.lower() sorted1 = sorted(lower1) sorted2 = sorted(lower2) if sorted1 == sorted2: return True else: return False this function works fine, the problem is that now I need to use this function in another function in order to find anagrams in a text file. I want to print a list of tuples with all the anagrams in it. this is what i have done so far def anagrams_finder(words_num): anagrams = [] f = open("words.txt") a = list(f) list1 = ([s.replace('\n', '') for s in a]) list2 = ([i.lower() for i in list1]) list3 = list2[0:words_num] #number of words from text that need to be checked. for i in list3: .... I tried using for loops, while loops, appand.... but nothing seems to work. how can I use the first function in order to help me with the second? Please help...

    Read the article

  • Interview question: How do I detect a loop in this linked list?

    - by jjujuma
    Say you have a linked list structure in Java. It's made up of Nodes: class Node { Node next; // some user data } and each Node points to the next node, except for the last Node, which has null for next. Say there is a possibility that the list can contain a loop - i.e. the final Node, instead of having a null, has a reference to one of the nodes in the list which came before it. What's the best way of writing boolean hasLoop(Node first) which would return true if the given Node is the first of a list with a loop, and false otherwise? How could you write so that it takes a constant amount of space and a reasonable amount of time? Here's a picture of what a list with a loop looks like: Node->Node->Node->Node->Node->Node--\ \ | ----------------

    Read the article

  • Recursive QuickSort suffering a StackOverflowException -- Need fresh eyes

    - by jon
    I am working on a Recursive QuickSort method implementation in a GenericList Class. I will have a second method that accepts a compareDelegate to compare different types, but for development purposes I'm sorting a GenericList<int I am recieving stackoverflow areas in different places depending on the list size. I've been staring at and tracing through this code for hours and probably just need a fresh pair of (more experienced)eyes. Definitely wanting to learn why it is broken, not just how to fix it. public void QuickSort() { int i, j, lowPos, highPos, pivot; GenericList<T> leftList = new GenericList<T>(); GenericList<T> rightList = new GenericList<T>(); GenericList<T> tempList = new GenericList<T>(); lowPos = 1; highPos = this.Count; if (lowPos < highPos) { pivot = (lowPos + highPos) / 2; for (i = 1; i <= highPos; i++) { if (this[i].CompareTo(this[pivot]) <= 0) leftList.Add(this[i]); else rightList.Add(this[i]); } leftList.QuickSort(); rightList.QuickSort(); for(i=1;i<=leftList.Count;i++) tempList.Add(leftList[i]); for(i=1;i<=rightList.Count;i++) tempList.Add(rightList[i]); this.items = tempList.items; this.count = tempList.count; } }

    Read the article

< Previous Page | 41 42 43 44 45 46 47 48 49 50 51 52  | Next Page >