Search Results

Search found 1294 results on 52 pages for 'hs err'.

Page 47/52 | < Previous Page | 43 44 45 46 47 48 49 50 51 52  | Next Page >

  • Running a Java program with a .dll from Adobe AIR's native process

    - by Donny
    I would like to be able to operate a scanner from my AIR application. Since there's no support for this natively, I'm trying to use the NativeProcess class to start a jar file that can run the scanner. The Java code is using the JTwain library to operate the scanner. The Java application runs fine by itself, and the AIR application can start and communicate with the Java application. The problem seems to be that any time I attempt to use a function from JTwain (which relies on the JTwain.dll), the application dies IF AIR STARTED IT. I'm not sure if there's some limit about referencing dll files from the native process or what. I've included my code below Java code- while(true) { try { System.out.println("Start"); text = in.readLine(); Source source = SourceManager.instance().getCurrentSource(); System.out.println("Java says: "+ text); } catch (IOException e) { System.err.println("Exception while reading the input. " + e); } catch (Exception e) { System.out.println("Other exception occured: " + e.toString()); } finally { } } } Air application- import mx.events.FlexEvent; private var nativeProcess:NativeProcess; private var npInfo:NativeProcessStartupInfo; private var processBuffer:ByteArray; private var bLength:int = 0; protected function windowedapplication1_applicationCompleteHandler(event:FlexEvent):void { var arg:Vector.<String> = new Vector.<String>; arg.push("-jar"); arg.push(File.applicationDirectory.resolvePath("Hello2.jar").nativePath); processBuffer = new ByteArray; npInfo = new NativeProcessStartupInfo; npInfo.executable = new File("C:/Program Files/Java/jre6/bin/javaw.exe"); npInfo.arguments = arg; nativeProcess = new NativeProcess; nativeProcess.addEventListener(ProgressEvent.STANDARD_OUTPUT_DATA, onStandardOutputData); nativeProcess.start(npInfo); } private function onStandardOutputData(e:ProgressEvent):void { tArea.text += nativeProcess.standardOutput.readUTFBytes(nativeProcess.standardOutput.bytesAvailable); } protected function button1_clickHandler(event:MouseEvent):void { tArea.text += 'AIR app: '+tInput.text + '\n'; nativeProcess.standardInput.writeMultiByte(tInput.text + "\n", 'utf-8'); tInput.text = ''; } protected function windowedapplication1_closeHandler(event:Event):void { nativeProcess.closeInput(); } ]]> </fx:Script> <s:Button label="Send" x="221" y="11" click="button1_clickHandler(event)"/> <s:TextInput id="tInput" x="10" y="10" width="203"/> <s:TextArea id="tArea" x="10" width="282" height="88" top="40"/> I would love some explanation about why this is dying. I've done enough testing that I know absolutely that the line that kills it is the SourceManager.instance().getCurrentSource(). I would love any suggestions. Thanks.

    Read the article

  • How to compile jsoup through Ant?

    - by JackWM
    I tried to use Ant to compile the jsoup source. I can compile successfully, but cannot pass the test. Here is the process: jsoup version: 1.6.3 ; Ant version: 1.8.2 the source of jsoup is in the directory src/ I made a build file src/build.xml This file contains <project name="jsoup"> <target name="compile"> <mkdir dir="build/classes"/> <javac srcdir="src" destdir="build/classes" includeantruntime="false"/> </target> <target name="jar"> <mkdir dir="build/jar"/> <jar destfile="build/jar/jsoup.jar" basedir="build/classes"> <manifest> <attribute name="Main-Class" value="StateTrace"/> </manifest> </jar> </target> <target name="run"> <!--<java jar="build/jar/jsoup.jar" input="htmls/index.html" fork="true"/>--> <exec executable="java"> <arg value="-jar"/> <arg value="build/jar/jsoup.jar"/> <arg value="htmls/index.html"/> </exec> </target> </project> Note: 1. StateTrace.java is my own test program; 2. htmls/index.html is the input to StateTrace.java. Then I compile and run it with Ant: > ant compile > ant jar > ant run After this, I got err like: run: [exec] Exception in thread "main" java.lang.ExceptionInInitializerError [exec] at org.jsoup.nodes.Entities$EscapeMode.<clinit>(Unknown Source) [exec] at org.jsoup.nodes.Document$OutputSettings.<init>(Unknown Source) [exec] at org.jsoup.nodes.Document.<init>(Unknown Source) [exec] at org.jsoup.parser.TreeBuilder.initialiseParse(Unknown Source) [exec] at org.jsoup.parser.TreeBuilder.parse(Unknown Source) [exec] at org.jsoup.parser.HtmlTreeBuilder.parse(Unknown Source) [exec] at org.jsoup.parser.Parser.parse(Unknown Source) [exec] at org.jsoup.Jsoup.parse(Unknown Source) [exec] at StateTrace.main(Unknown Source) [exec] Caused by: java.lang.NullPointerException [exec] at java.util.Properties$LineReader.readLine(Properties.java:418) [exec] at java.util.Properties.load0(Properties.java:337) [exec] at java.util.Properties.load(Properties.java:325) [exec] at org.jsoup.nodes.Entities.loadEntities(Unknown Source) [exec] at org.jsoup.nodes.Entities.<clinit>(Unknown Source) [exec] ... 9 more [exec] Result: 1 BUILD SUCCESSFUL Total time: 0 seconds However, if I manually compiled all the java source, like javac src/org/jsoup/*.java src/org/jsoup/parser/*.java src/org/jsoup/examples/*.java src/org/jsoup/nodes/*.java src/org/jsoup/safety/*.java src/org/jsoup/select/*.java src/org/jsoup/helper/*.java I could compile successfully and pass my test. Any clue? Thanks!

    Read the article

  • Android: manifest targetSdkVersion change resulted in: icon not visible, widget no longer works, and

    - by Casey
    I recently upgraded my Android app to support multiple resolutions. Previously, my Android.manifest file had a line: To support multiple density and resolution devices, I changed this to: <supports-screens android:smallScreens="false" android:normalScreens="true" android:largeScreens="true" android:anyDensity="true" /> <uses-sdk android:minSdkVersion="3" android:targetSdkVersion="4" /> I then added a couple of new directories, like drawable-hdpi-v4 and drawable-long-hdpi-v4 that includes the high-res versions of the graphics. That's about it. Ever since releasing this update, there have been a decent number of users complaining about various problems: - the app icon doesn't appear (I did not create a high res version of the icon) - the home screen widget no longer works, even if they delete and re-add it (this code did not change with the update). I've had a user send me their error log, which shows: 03-19 20:59:41.617 W/ActivityManager( 1854): Unable to launch app com.alt12.babybump/10078 for broadcast Intent { action=android.appwidget.action.APPWIDGET_UPDATE flags=0x4 comp={com.alt12.babybump/com.alt12.babybump.WidgetGirl} (has extras) }: process is bad There is one questionable section in my existing widget code that may be relevant: @Override public void onReceive(Context context, Intent intent) { // v1.5 fix that doesn't call onDelete Action final String action = intent.getAction(); if (AppWidgetManager.ACTION_APPWIDGET_DELETED.equals(action)) { final int appWidgetId = intent.getExtras().getInt( AppWidgetManager.EXTRA_APPWIDGET_ID, AppWidgetManager.INVALID_APPWIDGET_ID); if (appWidgetId != AppWidgetManager.INVALID_APPWIDGET_ID) { this.onDeleted(context, new int[] { appWidgetId }); } } else { super.onReceive(context, intent); } } And perhaps most troublesome: the sqlite database is no longer accessible/writeable for some users so their data is no longer available. I did add the WRITE_EXTERNAL_STORAGE permission to the manifest. This is only happening to certain users and it tends to be HTC Eris users. In that error log I see things such as: 03-19 16:00:56.173 E/FlurryAgent( 4791): java.io.FileNotFoundException: /data/data/com.alt12.babybump/files/.flurryagent.-2333f5cb 03-19 16:00:56.173 E/FlurryAgent( 4791): at org.apache.harmony.luni.platform.OSFileSystem.open(OSFileSystem.java:231) 03-19 16:01:09.393 E/Database( 4791): sqlite3_open_v2("/data/data/com.alt12.babybump/databases/uitematmamad.db", &handle, 6, NULL) failed 03-19 16:01:09.393 W/System.err( 4791): android.database.sqlite.SQLiteException: unable to open database file It's as if the update has caused a new process and it can't access the old process's data, or something. Any help appreciated!

    Read the article

  • Save gcc compile status to a text file for Java

    - by JohnBore
    I'm making a C Assessment Program through Java, which has a bunch of programming questions for C, and it lets the user input an answer in the form of C code, and then press a "Compile" button, which is linked to a bat file that runs the user input code through gcc. I've got the input and compiling working, but I need to get the output from the compiler and get that to print textarea within the program. I can get a simple "Hello, world" compiling, but I'm having trouble getting programs that require a user input with scanf, for example, to be printed. else if(e.getSource().equals(compile)){ if(questionNumber<1){ JOptionPane.showMessageDialog(programFrame, "Please start the assessment", "Compile Error", JOptionPane.ERROR_MESSAGE); } else{ FileOutputStream fileWrite; try { fileWrite = new FileOutputStream("demo/demo.c"); new PrintStream(fileWrite).println(input.getText());//saves what the user has entered in to a C source file fileWrite.close(); @SuppressWarnings("unused") Process process = Runtime.getRuntime().exec("cmd /c compile.bat");//runs the batch file to compile the source file compileCode(); try{ fileStream = new FileInputStream("demo/output.txt"); inputStream = new DataInputStream(fileStream); bufferRead = new BufferedReader(new InputStreamReader(inputStream)); while((stringLine = bufferRead.readLine())!=null){ compiled.append(stringLine); compiled.append("\n"); } inputStream.close(); } catch(IOException exc){ System.err.println("Unable to read file"); System.exit(-1); } } catch (IOException exc) { JOptionPane.showMessageDialog(programFrame, "Demo file not found", "File Error", JOptionPane.ERROR_MESSAGE); } } This is the actionPerformed method for the "Compile" button, the compileCode() is the JFrame that displays the output and "compiled" is the textArea for the output. My batch file is: C: cd dev-cpp\bin gcc.exe H:\workspace\QuestionProgram\demo\demo.c -o demo > H:\workspace\QuestionProgram\demo\compilestatus.txt demo > H:\workspace\QuestionProgram\demo\output.txt I'm not sure how I can do it, so the frame is created for the output of the code if the code requires a user input as the command prompt doesn't open without adding "START" to .exec(), but then the frame appears before the program has finished running. Also, how would I get the output of the compiler if the compile fails because of an error? The way I've got it in my batch file at the moment doesn't put anything in a text file if it fails.

    Read the article

  • Which credentials should I put in for Google App Engine BulkLoader at development server?

    - by Hoang Pham
    Hello everyone, I would like to ask which kind of credentials do I need to put on for importing data using the Google App Engine BulkLoader class appcfg.py upload_data --config_file=models.py --filename=listcountries.csv --kind=CMSCountry --url=http://localhost:8178/remote_api vit/ And then it asks me for credentials: Please enter login credentials for localhost Here is an extraction of the content of the models.py, I use this listcountries.csv file class CMSCountry(db.Model): sortorder = db.StringProperty() name = db.StringProperty(required=True) formalname = db.StringProperty() type = db.StringProperty() subtype = db.StringProperty() sovereignt = db.StringProperty() capital = db.StringProperty() currencycode = db.StringProperty() currencyname = db.StringProperty() telephonecode = db.StringProperty() lettercode = db.StringProperty() lettercode2 = db.StringProperty() number = db.StringProperty() countrycode = db.StringProperty() class CMSCountryLoader(bulkloader.Loader): def __init__(self): bulkloader.Loader.__init__(self, 'CMSCountry', [('sortorder', str), ('name', str), ('formalname', str), ('type', str), ('subtype', str), ('sovereignt', str), ('capital', str), ('currencycode', str), ('currencyname', str), ('telephonecode', str), ('lettercode', str), ('lettercode2', str), ('number', str), ('countrycode', str) ]) loaders = [CMSCountryLoader] Every tries to enter the email and password result in "Authentication Failed", so I could not import the data to the development server. I don't think that I have any problem with my files neither my models because I have successfully uploaded the data to the appspot.com application. So what should I put in for localhost credentials? I also tried to use Eclipse with Pydev but I still got the same message :( Here is the output: Uploading data records. [INFO ] Logging to bulkloader-log-20090820.121659 [INFO ] Opening database: bulkloader-progress-20090820.121659.sql3 [INFO ] [Thread-1] WorkerThread: started [INFO ] [Thread-2] WorkerThread: started [INFO ] [Thread-3] WorkerThread: started [INFO ] [Thread-4] WorkerThread: started [INFO ] [Thread-5] WorkerThread: started [INFO ] [Thread-6] WorkerThread: started [INFO ] [Thread-7] WorkerThread: started [INFO ] [Thread-8] WorkerThread: started [INFO ] [Thread-9] WorkerThread: started [INFO ] [Thread-10] WorkerThread: started Password for [email protected]: [DEBUG ] Configuring remote_api. url_path = /remote_api, servername = localhost:8178 [DEBUG ] Bulkloader using app_id: abc [INFO ] Connecting to /remote_api [ERROR ] Exception during authentication Traceback (most recent call last): File "D:\Projects\GoogleAppEngine\google_appengine\google\appengine\tools\bulkloader.py", line 2802, in Run request_manager.Authenticate() File "D:\Projects\GoogleAppEngine\google_appengine\google\appengine\tools\bulkloader.py", line 1126, in Authenticate remote_api_stub.MaybeInvokeAuthentication() File "D:\Projects\GoogleAppEngine\google_appengine\google\appengine\ext\remote_api\remote_api_stub.py", line 488, in MaybeInvokeAuthentication datastore_stub._server.Send(datastore_stub._path, payload=None) File "D:\Projects\GoogleAppEngine\google_appengine\google\appengine\tools\appengine_rpc.py", line 344, in Send f = self.opener.open(req) File "C:\Python25\lib\urllib2.py", line 381, in open response = self._open(req, data) File "C:\Python25\lib\urllib2.py", line 399, in _open '_open', req) File "C:\Python25\lib\urllib2.py", line 360, in _call_chain result = func(*args) File "C:\Python25\lib\urllib2.py", line 1107, in http_open return self.do_open(httplib.HTTPConnection, req) File "C:\Python25\lib\urllib2.py", line 1082, in do_open raise URLError(err) URLError: <urlopen error (10061, 'Connection refused')> [INFO ] Authentication Failed Thank you!

    Read the article

  • Java: error handling with try-catch, empty-try-catch, dummy-return

    - by HH
    A searh uses recursively defined function that easily throws exceptions. I have tried 3 ways to handle exeptions: to ignore with an empty-try-catch() add-dummy-return stop err-propagation due to exeption throw a specific except. (this part I don't really understand. If I throw except, can I force it to continue elsewhere, not continuing the old except-thrown-path?) Some exceptions I do not realy care like during execution removed files -exception (NullPointer) but some I really do like unknown things. Possible exceptions: // 1. if a temp-file or some other file removed during execution -> except. // 2. if no permiss. -> except. // 3. ? --> except. The code is Very import for the whole program. I earlier added clittered-checks, try-catches, avoided-empty-try-catches but it really blurred the logic. Some stoned result here would make the code later much easier to maintain. It was annoying to track random exeptions due to some random temp-file removal! How would you handle exceptions for the critical part? Code public class Find { private Stack<File> fs=new Stack<File>(); private Stack<File> ds=new Stack<File>(); public Stack<File> getD(){ return ds;} public Stack<File> getF(){ return fs;} public Find(String path) { // setting this type of special checks due to errs // propagation makes the code clittered if(path==null) { System.out.println("NULL in Find(path)"); System.exit(9); } this.walk(path); } private void walk( String path ) { File root = new File( path ); File[] list = root.listFiles(); //TODO: dangerous with empty try-catch?! try{ for ( File f : list ) { if ( f.isDirectory() ) { walk( f.getAbsolutePath() ); ds.push(f); } else { fs.push(f); } } }catch(Exception e){e.printStackTrace();} } } Code refactored from here.

    Read the article

  • Installing Oracle 11gR2 on RHEL 6.2

    - by Chris
    Hello all I'm having some difficulty installing Oracle 11gR2 on RHEL 6.2 I have compiled a giant list of every single step I have taken so far I installed RHEL 6.2 on VMWARE it did it's easy install automatically I Selected 4gb of memory Selected max size of 80Gb Selected 2 processors Sorry for the bad styling copy paste isn't working correctly The version of oracle i downloaded is Linux x86-64 11.2.0.1 I am installing this on a local machine NOT a remote machine I followed the following documentation http://docs.oracle.com/cd/E11882_01/install.112/e24326/toc.htm I bolded the steps which I was least sure about from my research Easy installed with RHEL 6.2 for VMWARE Registered with red hat so I can get updates Reinstalled vmware-tools by pressing enter at every choice Sudo yum update at the end something about GPG key selected y then y Checked Memory Requirements grep MemTotal /proc/meminfo MemTotal: 3921368 kb uname -m x86_64 grep SwapTotal /proc/meminfo SwapTotal: 6160376 kb free total used free shared buffers cached Mem: 3921368 2032012 1889356 0 76216 1533268 -/+ buffers/cache: 422528 3498840 Swap: 6160376 0 6160376 df -h /dev/shm Filesystem Size Used Avail Use% Mounted on tmpfs 1.9G 276K 1.9G 1% /dev/shm df -h /tmp Filesystem Size Used Avail Use% Mounted on /dev/sda2 73G 2.7G 67G 4% / df -h Filesystem Size Used Avail Use% Mounted on /dev/sda2 73G 2.7G 67G 4% / tmpfs 1.9G 276K 1.9G 1% /dev/shm /dev/sda1 291M 58M 219M 21% /boot All looked fine to me except maybe for swap? Software Requirements cat /proc/version Linux version 2.6.32-220.el6.x86_64 ([email protected]) (gcc version 4.4.5 20110214 (Red Hat 4.4.5-6) (GCC) ) #1 SMP Wed Nov 9 08:03:13 EST 2011 uname -r 2.6.32-220.el6.x86_64 (same as above but whatever) According to the tutorial should be On Red Hat Enterprise Linux 6 2.6.32-71.el6.x86_64 or later These are the versions of software I have installed binutils-2.20.51.0.2-5.28.el6.x86_64 compat-libcap1-1.10-1.x86_64 compat-libstdc++-33-3.2.3-69.el6.x86_64 compat-libstdc++-33.i686 0:3.2.3-69.el6 gcc-4.4.6-3.el6.x86_64 gcc-c++.x86_64 0:4.4.6-3.el6 glibc-2.12-1.47.el6_2.12.x86_64 glibc-2.12-1.47.el6_2.12.i686 glibc-devel-2.12-1.47.el6_2.12.x86_64 glibc-devel.i686 0:2.12-1.47.el6_2.12 ksh.x86_64 0:20100621-12.el6_2.1 libgcc-4.4.6-3.el6.x86_64 libgcc-4.4.6-3.el6.i686 libstdc++-4.4.6-3.el6.x86_64 libstdc++.i686 0:4.4.6-3.el6 libstdc++-devel.i686 0:4.4.6-3.el6 libstdc++-devel-4.4.6-3.el6.x86_64 libaio-0.3.107-10.el6.x86_64 libaio-0.3.107-10.el6.i686 libaio-devel-0.3.107-10.el6.x86_64 libaio-devel-0.3.107-10.el6.i686 make-3.81-19.el6.x86_64 sysstat-9.0.4-18.el6.x86_64 unixODBC-2.2.14-11.el6.x86_64 unixODBC-devel-2.2.14-11.el6.x86_64 unixODBC-devel-2.2.14-11.el6.i686 unixODBC-2.2.14-11.el6.i686 8. Probably screwed up here or step 9 /usr/sbin/groupadd oinstall /usr/sbin/groupadd dba(not sure why this isn't in the tutorial) /usr/sbin/useradd -g oinstall -G dba oracle passwd oracle /sbin/sysctl -a | grep sem Xkernel.sem = 250 32000 32 128 /sbin/sysctl -a | grep shm kernel.shmmax = 68719476736 kernel.shmall = 4294967296 kernel.shmmni = 4096 vm.hugetlb_shm_group = 0 /sbin/sysctl -a | grep file-max Xfs.file-max = 384629 /sbin/sysctl -a | grep ip_local_port_range Xnet.ipv4.ip_local_port_range = 32768 61000 /sbin/sysctl -a | grep rmem_default Xnet.core.rmem_default = 124928 /sbin/sysctl -a | grep rmem_max Xnet.core.rmem_max = 131071 /sbin/sysctl -a | grep wmem_max Xnet.core.wmem_max = 131071 /sbin/sysctl -a | grep wmem_default Xnet.core.wmem_default = 124928 Here is my sysctl.conf file I only added the items that were bigger: Kernel sysctl configuration file for Red Hat Linux # For binary values, 0 is disabled, 1 is enabled. See sysctl(8) and sysctl.conf(5) for more details. Controls IP packet forwarding net.ipv4.ip_forward = 0 Controls source route verification net.ipv4.conf.default.rp_filter = 1 Do not accept source routing net.ipv4.conf.default.accept_source_route = 0 Controls the System Request debugging functionality of the kernel kernel.sysrq = 0 Controls whether core dumps will append the PID to the core filename. Useful for debugging multi-threaded applications. kernel.core_uses_pid = 1 Controls the use of TCP syncookies net.ipv4.tcp_syncookies = 1 Disable netfilter on bridges. net.bridge.bridge-nf-call-ip6tables = 0 net.bridge.bridge-nf-call-iptables = 0 net.bridge.bridge-nf-call-arptables = 0 Controls the maximum size of a message, in bytes kernel.msgmnb = 65536 Controls the default maxmimum size of a mesage queue kernel.msgmax = 65536 Controls the maximum shared segment size, in bytes kernel.shmmax = 68719476736 Controls the maximum number of shared memory segments, in pages kernel.shmall = 4294967296 fs.aio-max-nr = 1048576 fs.file-max = 6815744 kernel.sem = 250 32000 100 128 net.ipv4.ip_local_port_range = 9000 65500 net.core.rmem_default = 262144 net.core.rmem_max = 4194304 net.core.wmem_default = 262144 net.core.wmem_max = 1048576 /sbin/sysctl -p net.ipv4.ip_forward = 0 net.ipv4.conf.default.rp_filter = 1 net.ipv4.conf.default.accept_source_route = 0 kernel.sysrq = 0 kernel.core_uses_pid = 1 net.ipv4.tcp_syncookies = 1 error: "net.bridge.bridge-nf-call-ip6tables" is an unknown key error: "net.bridge.bridge-nf-call-iptables" is an unknown key error: "net.bridge.bridge-nf-call-arptables" is an unknown key kernel.msgmnb = 65536 kernel.msgmax = 65536 kernel.shmmax = 68719476736 kernel.shmall = 4294967296 fs.aio-max-nr = 1048576 fs.file-max = 6815744 kernel.sem = 250 32000 100 128 net.ipv4.ip_local_port_range = 9000 65500 net.core.rmem_default = 262144 net.core.rmem_max = 4194304 net.core.wmem_default = 262144 net.core.wmem_max = 1048576 su - oracle ulimit -Sn 1024 ulimit -Hn 1024 ulimit -Su 1024 ulimit -Hu 30482 ulimit -Su 1024 ulimit -Ss 10240 ulimit -Hs unlimited su - nano /etc/security/limits.conf *added to the end of the file * oracle soft nproc 2047 oracle hard nproc 16384 oracle soft nofile 1024 oracle hard nofile 65536 oracle soft stack 10240 exit exit su - mkdir -p /app/ chown -R oracle:oinstall /app/ chmod -R 775 /app/ 9. THIS IS PROBABLY WHERE I MESSED UP I then exited out of the root account so now I'm back in my account chris then I su - oracle echo $SHELL /bin/bash umask 0022 (so it should be set already to what is neccesary) Also from what I have read I do not need to set the DISPLAY variable because I'm installing this on the localhost I then opened the .bash_profile of the oracle and changed it to the following .bash_profile Get the aliases and functions if [ -f ~/.bashrc ]; then . ~/.bashrc fi User specific environment and startup programs PATH=$PATH:$HOME/bin; export PATH ORACLE_BASE=/app/oracle ORACLE_SID=orcl export ORACLE_BASE ORACLE_SID I then shutdown the virtual machine shared my desktop folder from my windows 7 then turned back on the virtual machine logged in as chris opened up a terminal then: su - for some reason the shared folder didn't appear so I reinstalled vmware tools again and restarted then same as before su - cp -R linux_oracle/database /db; chown -R oracle:oinstall /db; chmod -R 775 /db; ll /db drwxrwxr-x. 8 oracle oinstall 4096 Jun 5 06:20 database exit su - oracle cd /db/database ./runInstaller AND FINALLY THE INFAMOUS JAVA:132 ERROR MESSAGE Starting Oracle Universal Installer... Checking Temp space: must be greater than 80 MB. Actual 65646 MB Passed Checking swap space: must be greater than 150 MB. Actual 6015 MB Passed Checking monitor: must be configured to display at least 256 colors. Actual 16777216 Passed Preparing to launch Oracle Universal Installer from /tmp/OraInstall2012-06-05_06-47-12AM. Please wait ...[oracle@localhost database]$ Exception in thread "main" java.lang.UnsatisfiedLinkError: /tmp/OraInstall2012-06-05_06-47-12AM/jdk/jre/lib/i386/xawt/libmawt.so: libXext.so.6: cannot open shared object file: No such file or directory at java.lang.ClassLoader$NativeLibrary.load(Native Method) at java.lang.ClassLoader.loadLibrary0(ClassLoader.java:1751) at java.lang.ClassLoader.loadLibrary(ClassLoader.java:1647) at java.lang.Runtime.load0(Runtime.java:769) at java.lang.System.load(System.java:968) at java.lang.ClassLoader$NativeLibrary.load(Native Method) at java.lang.ClassLoader.loadLibrary0(ClassLoader.java:1751) at java.lang.ClassLoader.loadLibrary(ClassLoader.java:1668) at java.lang.Runtime.loadLibrary0(Runtime.java:822) at java.lang.System.loadLibrary(System.java:993) at sun.security.action.LoadLibraryAction.run(LoadLibraryAction.java:50) at java.security.AccessController.doPrivileged(Native Method) at java.awt.Toolkit.loadLibraries(Toolkit.java:1509) at java.awt.Toolkit.(Toolkit.java:1530) at com.jgoodies.looks.LookUtils.isLowResolution(Unknown Source) at com.jgoodies.looks.LookUtils.(Unknown Source) at com.jgoodies.looks.plastic.PlasticLookAndFeel.(PlasticLookAndFeel.java:122) at java.lang.Class.forName0(Native Method) at java.lang.Class.forName(Class.java:242) at javax.swing.SwingUtilities.loadSystemClass(SwingUtilities.java:1783) at javax.swing.UIManager.setLookAndFeel(UIManager.java:480) at oracle.install.commons.util.Application.startup(Application.java:758) at oracle.install.commons.flow.FlowApplication.startup(FlowApplication.java:164) at oracle.install.commons.flow.FlowApplication.startup(FlowApplication.java:181) at oracle.install.commons.base.driver.common.Installer.startup(Installer.java:265) at oracle.install.ivw.db.driver.DBInstaller.startup(DBInstaller.java:114) at oracle.install.ivw.db.driver.DBInstaller.main(DBInstaller.java:132)

    Read the article

  • problem with filtering the dropdownlist in scroll window

    - by Rahul
    Hi all, Problem with filtering Dropdown list. The scenario is : in scroll window there are two fields Document types and type id: Document type is Dropdown list: As per document type selection type id look should display the values. For ex. If I select quote type from document type and if I open type id look up it should display only quotation in the look window. It should work for all the values of document type drop down list values. Its working fine. The item in the document types are: Quote, Order, Invoice, Return, BackOrder. The problem is after saving the data when I am displaying the same record in scroll window, suppose after displaying document type is QUOTE and document id is QTOARD, and in this position I am changing the document type from dropdown QUOTE to ORDER at this time warning message should c ome this range entered is in valid. Because in database table there is no document QTOARD for ORDER type. The same should work for all the condition. The table name is SOP_ID_Setp and key is SOP Type and DocumentID. For that I have written the Stored procedure : create procedure DocTypeFilter @DocumentType as int, @DocumentID as varchar(30) as --declare --@documentype int, --@documentID varchar(30), select * from sop40200 where soptype=@DocumentType and docid=@DocumentID and I have called this SP in Dropdownlist change event. local long retcode; range clear table SOP_ID_SETP; clear field 'SOP Type' of table SOP_ID_SETP; clear field 'Document ID' of table SOP_ID_SETP; range start table SOP_ID_SETP; fill field 'SOP Type' of table SOP_ID_SETP; fill field 'Document ID' of table SOP_ID_SETP; range end table SOP_ID_SETP; if err()=OKAY then call DocTypeFilter,retcode,'Document Type' of window 'Is_Document Type Site_Scroll','Document ID' of window 'Is_Document Type Site_Scroll'; else warning "The range entered is invalid"; clear window 'Is_Document Type Site_Scroll'; fill window 'Is_Document Type Site_Scroll' table is_sop_site_line_temp; end if; Above code not giving the expected output any help pls.

    Read the article

  • Java: why is declaration not sufficient in interface?

    - by HH
    Big class contains Format-interfcase and Format-class. The Format-class contains the methods and the interface has the values of the fields. I could have the fields in the class Format but the goal is with Interface. So do I just create dummy-vars to get the errors away, design issue or something ELSE? KEY: Declaration VS Initialisation Explain by the terms, why you have to init in interface. What is the logic behind it? To which kind of problems it leads the use of interface? Sample Code having the init-interface-problem import java.util.*; import java.io.*; public class FormatBig { private static class Format implements Format { private static long getSize(File f){return f.length();} private static long getTime(File f){return f.lastModified();} private static boolean isFile(File f){if(f.isFile()){return true;}} private static boolean isBinary(File f){return Match.isBinary(f);} private static char getType(File f){return Match.getTypes(f);} private static String getPath(File f){return getNoErrPath(f);} //Java API: isHidden, --- SYSTEM DEPENDED: toURI, toURL Format(File f) { // PUZZLE 0: would Stack<Object> be easier? size=getSize(f); time=getTime(f); isfile=isFile(f); isBinary=isBinary(f); type=getType(f); path=getPath(f); //PUZZLE 1: how can simplify the assignment? values.push(size); values.push(time); values.push(isfile); values.push(isBinary); values.push(type); values.push(path); } } public static String getNoErrPath(File f) { try{return f.getCanonicalPath(); }catch(Exception e){e.printStackTrace();} } public static final interface Format { //ERR: IT REQUIRES "=" public long size; public long time; public boolean isFile=true; //ERROR goes away if I initialise wit DUMMY public boolean isBinary; public char type; public String path; Stack<Object> values=new Stack<Object>(); } public static void main(String[] args) { Format fm=new Format(new File(".")); for(Object o:values){System.out.println(o);} } }

    Read the article

  • Linux Device Driver: Symbol "memcpy" not found

    - by Hinton
    Hello, I'm trying to write a Linux device driver. I've got it to work really well, until I tried to use "memcpy". I don't even get a compiler error, when I "make" it just warns me: WARNING: "memcpy" [/root/homedir/sv/main.ko] undefined! OK and when I try to load via insmod, I get on the console: insmod: error inserting './main.ko': -1 Unknown symbol in module and on dmesg: main: Unknown symbol memcpy (err 0) I include the following: #include <linux/module.h> #include <linux/moduleparam.h> #include <linux/init.h> #include <linux/kernel.h> /* printk() */ #include <linux/slab.h> /* kmalloc() */ #include <linux/fs.h> /* everything... */ #include <linux/errno.h> /* error codes */ #include <linux/types.h> /* size_t */ #include <linux/fcntl.h> /* O_ACCMODE */ #include <linux/cdev.h> #include <asm/system.h> /* cli(), *_flags */ #include <asm/uaccess.h> /* copy_*_user */ The function using memcpy: static int dc_copy_to_user(char __user *buf, size_t count, loff_t *f_pos, struct sv_data_dev *dev) { char data[MAX_KEYLEN]; size_t i = 0; /* Copy the bulk as long as there are 10 more bytes to copy */ while (i < (count + MAX_KEYLEN)) { memcpy(data, &dev->data[*f_pos + i], MAX_KEYLEN); ec_block(dev->key, data, MAX_KEYLEN); if (copy_to_user(&buf[i], data, MAX_KEYLEN)) { return -EFAULT; } i += MAX_KEYLEN; } return 0; } Could someone help me? I thought the thing was in linux/string.h, but I get the error just the same. I'm using kernel 2.6.37-rc1 (I'm doing in in user-mode-linux, which works only since 2.6.37-rc1). Any help is greatly appreciated. # Context dependent makefile that can be called directly and will invoke itself # through the kernel module building system. KERNELDIR=/usr/src/linux ifneq ($(KERNELRELEASE),) EXTRA_CFLAGS+=-I $(PWD) -ARCH=um obj-m := main.o else KERNELDIR ?= /lib/modules/$(shell uname -r)/build PWD = $(shell pwd) all: $(MAKE) V=1 ARCH=um -C $(KERNELDIR) M=$(PWD) modules clean: rm -rf Module.symvers .*.cmd *.ko .*.o *.o *.mod.c .tmp_versions *.order endif

    Read the article

  • indentationLevelForRowAtIndexPath not indenting custom cell

    - by Xetius
    I have overridden the tableView:indentationLevelForRowAtIndexPath method in my UITableViewController derived class as follows: - (NSInteger)tableView:(UITableView *)tableView indentationLevelForRowAtIndexPath:(NSIndexPath *)indexPath { NSDictionary* item = [self.projects objectAtIndex:indexPath.row]; int indentationLevel = [[item objectForKey:@"indent"] intValue]; DLog (@"Indentation Level for Row %d : %d", indexPath.row, indentationLevel); return indentationLevel; } I initially thought that this was not being called but that was operator error (err, mine) and I hadn't defined the symbol DEBUG=1. However, it is being called (duh me!) and this is the log output: -[RootViewController tableView:indentationLevelForRowAtIndexPath:] [Line 129] Indentation Level for Row 0 : 1 -[RootViewController tableView:indentationLevelForRowAtIndexPath:] [Line 129] Indentation Level for Row 1 : 1 -[RootViewController tableView:indentationLevelForRowAtIndexPath:] [Line 129] Indentation Level for Row 2 : 2 -[RootViewController tableView:indentationLevelForRowAtIndexPath:] [Line 129] Indentation Level for Row 3 : 2 -[RootViewController tableView:indentationLevelForRowAtIndexPath:] [Line 129] Indentation Level for Row 4 : 2 -[RootViewController tableView:indentationLevelForRowAtIndexPath:] [Line 129] Indentation Level for Row 5 : 1 -[RootViewController tableView:indentationLevelForRowAtIndexPath:] [Line 129] Indentation Level for Row 6 : 2 -[RootViewController tableView:indentationLevelForRowAtIndexPath:] [Line 129] Indentation Level for Row 7 : 2 -[RootViewController tableView:indentationLevelForRowAtIndexPath:] [Line 129] Indentation Level for Row 8 : 1 But, this is not affecting the layout of the cells. No indentation. This is my itemCellForRowAtIndexPath implementation, if that makes any difference: -(UITableViewCell*)tableView:(UITableView *)tableView itemCellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString* cellIdentifier = @"projectItemCell"; ProjectItemTableViewCell* cell = (ProjectItemTableViewCell*)[tableView dequeueReusableCellWithIdentifier:cellIdentifier]; if (cell == nil) { NSArray* nib = [[NSBundle mainBundle] loadNibNamed:@"ProjectItemTableViewCell" owner:self options:nil]; for (id oneObject in nib) { if ([oneObject isKindOfClass:[ProjectItemTableViewCell class]]) { cell = (ProjectItemTableViewCell*)oneObject; } } } NSDictionary* item = [self.projects objectAtIndex:indexPath.row]; cell.projectDescLabel.text = [item objectForKey:@"name"]; cell.itemCountlabel.text = [NSString stringWithFormat:@"%d", [[item objectForKey:@"cache_count"] intValue]]; cell.itemCountlabel.backgroundColor = [UIColor colorForHex:[item objectForKey:@"color"]]; cell.indentationWidth = 20; return cell; } How do I indent a custom UITableViewCell which I have defined in Interface Builder? If I change the itemCellForRowAtIndexPath to use a default UITableViewCell with the code below, then it indents fine. static NSString* cellIdentifier = @"projectItemCell"; UITableViewCell* cell = [tableView dequeueReusableCellWithIdentifier:cellIdentifier]; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithStyle:UITableViewCellStyleDefault reuseIdentifier:cellIdentifier] autorelease]; } NSDictionary* item = [self.projects objectAtIndex:indexPath.row]; cell.textLabel.text = [item objectForKey:@"name"]; cell.indentationWidth = 40; return cell;

    Read the article

  • Job queue manager with RPC interface

    - by admr
    I need a job queue manager that I can control over the Internet. It should be able to execute and stop processes, check on their status (ideally notice and execute some code when a process exits), respond to commands and also be able to report back to a server. Background: I have a GWT application that allows to create jobs to execute on a cloud instance (currently EC2). I want to push a "job packet" (data for a process to operate on etc) to S3, start a Linux EC2 instance (or use one that's already running), and tell a job manager on the instance to execute that job (possibly parallel to other jobs). It should then pull the "job packet" from S3, run a process that operates on that data and report back to the server that is running the server part of my GWT application with some information (e.g. exit code, stdout, stderr). If I have to write e.g. stdour/err to a file from the process and read that file, that's OK too. I would really like the manager to be "close" to the processes it runs, meaning I want to avoid using something like Runtime.exec from the JDK. It seems like I would have to do that if I used Quartz for example. I'm fine with the calls in both directions being asynchronous. I'm fine with any reasonable technology for the calls as long as I can easily build an interface for that in my GWT server side (e.g. HTTP requests to a servlet over SSL would be nice and trivial). The job manager does not need to have a very sophisticated queueing system. Running several processes either sequentially or in parallel should be fine. Determining how much compute time a process received during its lifetime would be nice (AFAIK, this might be challenging). I did not yet find any existing software that does this, including http://java-source.net/open-source/job-schedulers. I suspect I might have to build an RPC interface (with authentication etc, of course) around a job manager; maybe use something like Apache Commons Exec. In that case, I would prefer Java or Python for the job manager part. I would be happy to hear suggestions for either the former or latter scenario!

    Read the article

  • I can't Open my excel file in c#

    - by Ruben Guico
    Hi, Below is my code, i tried to open my excel file in my c# application but the program give's me an error message "Cannot Access "my excel.xls". But when I specify the file path in my string path variable it works, the problem is I need to get the file path from an openFileDialog. using System; using System.IO; using System.Collections.Generic; using System.Text; using System.Data; using System.Windows.Forms; using System.Data.OleDb; using System.Reflection; using MOIE = Microsoft.Office.Interop.Excel; using OFFICE = Microsoft.Office.Core; namespace EmpUploader { public class ExcelCon { private OleDbDataReader reader = null; private OleDbCommand excelCommand = new OleDbCommand(); private OleDbDataAdapter adapter = new OleDbDataAdapter(); private DataTable excelData = new DataTable(); private MOIE.ApplicationClass objExcel = new MOIE.ApplicationClass(); private MOIE.Workbook wb = null; private string myConn = ""; private string strSQL = ""; private string err = ""; private string path2 = ""; private int sheetCount = 0; private OleDbConnection Con = new OleDbConnection(""); #region "excel interop prarameters" private static object xl_missing = Type.Missing; private static object xl_true = true; private static object xl_false = false; private object xl_update_links = xl_missing; private object xl_read_only = xl_missing; private object xl_format = xl_missing; private object xl_password = xl_missing; private object xl_write_res_password = xl_missing; private object xl_ignore_read_only = xl_missing; private object xl_origin = xl_missing; private object xl_delimiter = xl_missing; private object xl_editable = xl_missing; private object xl_notify = xl_missing; private object xl_converter = xl_missing; private object xl_add_to_mru = xl_missing; private object xl_local = xl_missing; private object xl_corrupt_load = xl_missing; #endregion } //MY CODE FOR OPENING THE EXCEL //note that my file path came from an openfiledialog public void InitializeConnection(string path) { //connection string for excel myConn = @"Provider=Microsoft.Jet.OLEDB.4.0; Data Source=" + path + "; Extended Properties =Excel 8.0"; Con.ConnectionString = myConn; Con.Open(); //this is the sample specified path that worked when i test my application //path = @"C:\shinetsu p5 emp list.xls"; objExcel.Visible = false; wb = objExcel.Workbooks.Open(path, xl_update_links, xl_read_only, xl_format, xl_password, xl_write_res_password, xl_ignore_read_only, xl_origin, xl_delimiter, xl_editable, xl_notify, xl_converter, xl_add_to_mru, xl_local, xl_corrupt_load); sheetCount = wb.Worksheets.Count; } }

    Read the article

  • Exception when indexing text documents with Lucene, using SnowballAnalyzer for cleaning up

    - by Julia
    Hello!!! I am indexing the documents with Lucene and am trying to apply the SnowballAnalyzer for punctuation and stopword removal from text .. I keep getting the following error :( IllegalAccessError: tried to access method org.apache.lucene.analysis.Tokenizer.(Ljava/io/Reader;)V from class org.apache.lucene.analysis.snowball.SnowballAnalyzer Here is the code, I would very much appreciate help!!!! I am new with this.. public class Indexer { private Indexer(){}; private String[] stopWords = {....}; private String indexName; private IndexWriter iWriter; private static String FILES_TO_INDEX = "/Users/ssi/forindexing"; public static void main(String[] args) throws Exception { Indexer m = new Indexer(); m.index("./newindex"); } public void index(String indexName) throws Exception { this.indexName = indexName; final File docDir = new File(FILES_TO_INDEX); if(!docDir.exists() || !docDir.canRead()){ System.err.println("Something wrong... " + docDir.getPath()); System.exit(1); } Date start = new Date(); PerFieldAnalyzerWrapper analyzers = new PerFieldAnalyzerWrapper(new SimpleAnalyzer()); analyzers.addAnalyzer("text", new SnowballAnalyzer("English", stopWords)); Directory directory = FSDirectory.open(new File(this.indexName)); IndexWriter.MaxFieldLength maxLength = IndexWriter.MaxFieldLength.UNLIMITED; iWriter = new IndexWriter(directory, analyzers, true, maxLength); System.out.println("Indexing to dir..........." + indexName); if(docDir.isDirectory()){ File[] files = docDir.listFiles(); if(files != null){ for (int i = 0; i < files.length; i++) { try { indexDocument(files[i]); }catch (FileNotFoundException fnfe){ fnfe.printStackTrace(); } } } } System.out.println("Optimizing...... "); iWriter.optimize(); iWriter.close(); Date end = new Date(); System.out.println("Time to index was" + (end.getTime()-start.getTime()) + "miliseconds"); } private void indexDocument(File someDoc) throws IOException { Document doc = new Document(); Field name = new Field("name", someDoc.getName(), Field.Store.YES, Field.Index.ANALYZED); Field text = new Field("text", new FileReader(someDoc), Field.TermVector.WITH_POSITIONS_OFFSETS); doc.add(name); doc.add(text); iWriter.addDocument(doc); } }

    Read the article

  • Internal class and access to external members.

    - by Knowing me knowing you
    I always thought that internal class has access to all data in its external class but having code: template<class T> class Vector { template<class T> friend std::ostream& operator<<(std::ostream& out, const Vector<T>& obj); private: T** myData_; std::size_t myIndex_; std::size_t mySize_; public: Vector():myData_(nullptr), myIndex_(0), mySize_(0) { } Vector(const Vector<T>& pattern); void insert(const T&); Vector<T> makeUnion(const Vector<T>&)const; Vector<T> makeIntersection(const Vector<T>&)const; class Iterator : public std::iterator<std::bidirectional_iterator_tag,T> { private: T** itData_; public: Iterator()//<<<<<<<<<<<<<------------COMMENT { /*HERE I'M TRYING TO USE ANY MEMBER FROM Vector<T> AND I'M GETTING ERR SAYING: ILLEGAL CALL OF NON-STATIC MEMBER FUNCTION*/} Iterator(T** ty) { itData_ = ty; } Iterator operator++() { return ++itData_; } T operator*() { return *itData_[0]; } bool operator==(const Iterator& obj) { return *itData_ == *obj.itData_; } bool operator!=(const Iterator& obj) { return *itData_ != *obj.itData_; } bool operator<(const Iterator& obj) { return *itData_ < *obj.itData_; } }; typedef Iterator iterator; iterator begin()const { assert(mySize_ > 0); return myData_; } iterator end()const { return myData_ + myIndex_; } }; See line marked as COMMENT. So can I or I can't use members from external class while in internal class? Don't bother about naming, it's not a Vector it's a Set. Thank you.

    Read the article

  • Java app makes screen display unresponsive after 10 minutes of user idle time

    - by Ross
    I've written a Java app that allows users to script mouse/keyboard input (JMacro, link not important, only for the curious). I personally use the application to automate character actions in an online game overnight while I sleep. Unfortunately, I keep coming back to the computer in the morning to find it unresponsive. Upon further testing, I'm finding that my application causes the computer to become unresponsive after about 10 minutes of user idle time (even if the application itself it simulating user activity). I can't seem to pin-point the issue, so I'm hoping somebody else might have a suggestion of where to look or what might be causing the issue. The relevant symptoms and characteristics: Unresponsiveness occurs after user is idle for 10 minutes User can still move the mouse pointer around the screen Everything but the mouse appears frozen... mouse clicks have no effect and no applications update their displays, including the Windows 7 desktop I left the task manager up along the with the app overnight so I could see the last task manager image before the screen freezes... the Java app is at normal CPU/Memory usage and total CPU usage is only ~1% After moving the mouse (in other words, the user comes back from being idle), the screen image starts updating again within 30 minutes (this is very hit and miss... sometimes 10 minutes, sometimes no results after two hours) User can CTRL-ALT-DEL to get to Windows 7's CTRL-ALT-DEL screen (after a 30 second pause). User is still able to move mouse pointer, but clicking any of the button options causes the screen to appear to freeze again On some very rare occasions, the system never freezes, and I come back to it in the morning with full responsiveness The Java app automatically stops input scripting in the middle of the night, so Windows 7 detects "real" idleness and turns the monitors into Standby mode... which they successfully come out of upon manually moving the mouse in the morning when I wake up, even though the desktop display still appears frozen Given the symptoms and characteristics of the issue, it's as if the Java app is causing the desktop display of the logged in user to stop updating, including any running applications. Programming concepts and Java packages used: Multi-threading Standard out and err are rerouted to a javax.swing.JTextArea The application uses a Swing GUI awt.Robot (very heavily used) awt.PointerInfo awt.MouseInfo System Specs: Windows 7 Professional Java 1.6.0 u17 In conclusion, I should stress that I'm not looking for any specific solutions, as I'm not asking a very specific question. I'm just wondering if anybody has run into a similar problem when using the Java libraries that I'm using. I would also gladly appreciate any suggestions for things to try to attempt to further pinpoint what is causing my problem. Thanks! Ross PS, I'll post an update/answer if I manage to stumble across anything else while I continue to debug this.

    Read the article

  • Error using paho-mqtt in App Engine Python App

    - by calumb
    I am trying to right a Google Cloud Platform app in python with Flask that makes an MQTT connection. I have included the paho python library by doing pip install paho-mqtt -t libs/. However, when I try to run the app, even if I don't try to connect to MQTT. I get a weird error about IP address checking: RuntimeError: error('illegal IP address string passed to inet_pton',) It seems something in the remote_socket lib is causing a problem. Is this a security issue? Is there someway to disable it? Relevant code: from flask import Flask import paho.mqtt.client as mqtt import logging as logger app = Flask(__name__) # Note: We don't need to call run() since our application is embedded within # the App Engine WSGI application server. #callback to print out connection status def on_connect(mosq, obj, rc): logger.info('on_connect') if rc == 0: logger.info("Connected") mqttc.subscribe('test', 0) else: logger.info(rc) def on_message(mqttc, obj, msg): logger.info(msg.topic+" "+str(msg.qos)+" "+str(msg.payload)) mqttc = mqtt.Client("mqttpy") mqttc.on_message = on_message mqttc.on_connect = on_connect As well as full stack trace: ERROR 2014-06-03 15:14:57,285 wsgi.py:262] Traceback (most recent call last): File "/Users/cbarnes/google-cloud-sdk/platform/google_appengine/google/appengine/runtime/wsgi.py", line 239, in Handle handler = _config_handle.add_wsgi_middleware(self._LoadHandler()) File "/Users/cbarnes/google-cloud-sdk/platform/google_appengine/google/appengine/runtime/wsgi.py", line 298, in _LoadHandler handler, path, err = LoadObject(self._handler) File "/Users/cbarnes/google-cloud-sdk/platform/google_appengine/google/appengine/runtime/wsgi.py", line 84, in LoadObject obj = __import__(path[0]) File "/Users/cbarnes/code/ignite/tank-demo/appengine-flask-demo/main.py", line 24, in <module> mqttc = mqtt.Client("mqtthtpp") File "/Users/cbarnes/code/ignite/tank-demo/appengine-flask-demo/lib/paho/mqtt/client.py", line 403, in __init__ self._sockpairR, self._sockpairW = _socketpair_compat() File "/Users/cbarnes/code/ignite/tank-demo/appengine-flask-demo/lib/paho/mqtt/client.py", line 255, in _socketpair_compat listensock.bind(("localhost", 0)) File "/Users/cbarnes/google-cloud-sdk/platform/google_appengine/google/appengine/dist27/socket.py", line 222, in meth return getattr(self._sock,name)(*args) File "/Users/cbarnes/google-cloud-sdk/platform/google_appengine/google/appengine/api/remote_socket/_remote_socket.py", line 668, in bind self._SetProtoFromAddr(request.mutable_proxy_external_ip(), address) File "/Users/cbarnes/google-cloud-sdk/platform/google_appengine/google/appengine/api/remote_socket/_remote_socket.py", line 632, in _SetProtoFromAddr proto.set_packed_address(self._GetPackedAddr(address)) File "/Users/cbarnes/google-cloud-sdk/platform/google_appengine/google/appengine/api/remote_socket/_remote_socket.py", line 627, in _GetPackedAddr AI_NUMERICSERV|AI_PASSIVE): File "/Users/cbarnes/google-cloud-sdk/platform/google_appengine/google/appengine/api/remote_socket/_remote_socket.py", line 338, in getaddrinfo canonical=(flags & AI_CANONNAME)) File "/Users/cbarnes/google-cloud-sdk/platform/google_appengine/google/appengine/api/remote_socket/_remote_socket.py", line 211, in _Resolve canon, aliases, addresses = _ResolveName(name, families) File "/Users/cbarnes/google-cloud-sdk/platform/google_appengine/google/appengine/api/remote_socket/_remote_socket.py", line 229, in _ResolveName apiproxy_stub_map.MakeSyncCall('remote_socket', 'Resolve', request, reply) File "/Users/cbarnes/google-cloud-sdk/platform/google_appengine/google/appengine/api/apiproxy_stub_map.py", line 94, in MakeSyncCall return stubmap.MakeSyncCall(service, call, request, response) File "/Users/cbarnes/google-cloud-sdk/platform/google_appengine/google/appengine/api/apiproxy_stub_map.py", line 328, in MakeSyncCall rpc.CheckSuccess() File "/Users/cbarnes/google-cloud-sdk/platform/google_appengine/google/appengine/api/apiproxy_rpc.py", line 156, in _WaitImpl self.request, self.response) File "/Users/cbarnes/google-cloud-sdk/platform/google_appengine/google/appengine/ext/remote_api/remote_api_stub.py", line 200, in MakeSyncCall self._MakeRealSyncCall(service, call, request, response) File "/Users/cbarnes/google-cloud-sdk/platform/google_appengine/google/appengine/ext/remote_api/remote_api_stub.py", line 234, in _MakeRealSyncCall raise pickle.loads(response_pb.exception()) RuntimeError: error('illegal IP address string passed to inet_pton',) INFO 2014-06-03 15:14:57,291 module.py:639] default: "GET / HTTP/1.1" 500 - Thanks!

    Read the article

  • Advice/suggestions for my first project PHP Classes

    - by Philip
    Hi guys, Any advice is welcome! I have a very limited understanding of php classes but below is my starting point for the route I would like to take. The code is a reflection of what I see in my head and how I would like to go about business. Does my code even look ok, or am I way off base? What are your thoughts, how would you go about achieving such a task as form-validate-insertquery-sendmail-return messages and errors? Please try and keep your answers simple enough for me to digest as for me its about understanding whats going on and not just a copy/paste job. Kindest regards, Phil. Note: This is a base structure only, no complete code added. <?php //======================================= //class.logging.php //======================================== class logging { public $data = array(); public $errors = array(); function __construct() { array_pop($_POST); $this->data =($this->_logging)? is_isset(filterStr($_POST) : ''; foreach($this->data as $key=> $value) { $this->data[$key] = $value; } //print_r($this->data); de-bugging } public function is_isset($str) { if(isset($str)) ? true: false; } public function filterStr($str) { return preg_match(do somthing, $str); } public function validate_post() { try { if(!is_numeric($data['cardID'])) ? throw new Exception('CardID must be numeric!') : continue; } catch (Exception $e) { return $errors = $e->getCode(); } } public function showErrors() { foreach($errors as $error => $err) { print('<div class="notok"></div><br />'); } } public function insertQ() { $query = ""; } } //======================================= //Usercp.php //======================================== if(isset($_GET['mode'])) { $mode = $_GET['mode']; } else { $mode = 'usercp'; } switch($mode) { case 'usercp': echo 'Welcome to the User Control Panel'; break; case 'logging': require_once 'class.logging.php'; $logger = new logging(); if(isset($_POST['submit']) { if($logger->validate_post === true) { $logger->insertQ(); require_once '/scripts/PHPMailer/class.phpmailer.php'; $mailer = new PHPMailer(); $mailer->PHPMailer(); } else { echo ''.$logger->showErrors.''; } } else { echo ' <form action="'.$_SERVER['PHP_SELF'].'?mode=logging" method="post"> </form> '; } break; case 'user_logout': // do somthing break; case 'user_settings': // do somthing break; ?>

    Read the article

  • Calling a function that resides in the main page from a plugin?

    - by Justin Lee
    I want to call a function from within plugin, but the function is on the main page and not the plugin's .js file. EDIT I have jQuery parsing a very large XML file and building, subsequently, a large list (1.1 MB HTML file when dynamic content is copied, pasted, then saved) that has expand/collapse functionality through a plugin. The overall performance on IE is super slow and doggy, assuming since the page/DOM is so big. I am currently trying to save the collapsed content in the event.data when it is collapsed and remove it from the DOM, then bring it back when it is told to expand... the issue that I am having is that when I bring the content back, obviously the "click" and "hover" events are gone. I'm trying to re-assign them, currently doing so inside the plugin after the plugin expands the content. The issue then though is that is says the function that I declare within the .click() is not defined. Also the hover event doesn't seem to be re-assigning either.... if ($(event.data.trigger).attr('class').indexOf('collapsed') != -1 ) { // if expanding // console.log(event.data.targetContent); $(event.data.trigger).after(event.data.targetContent); $(event.data.target).hide(); /* This Line --->*/ $(event.data.target + 'a.addButton').click(addResourceToList); $(event.data.target + 'li.resource') .hover( function() { if (!($(this).attr("disabled"))) { $(this).addClass("over"); $(this).find("a").css({'display':'block'}); } }, function () { if (!($(this).attr("disabled"))) { $(this).removeClass("over"); $(this).children("a").css({'display':'none'}); } } ); $(event.data.target).css({ "height": "0px", "padding-top": "0px", "padding-bottom": "0px", "margin-top": "0px", "margin-bottom": "0px"}); $(event.data.target).show(); $(event.data.target).animate({ height: event.data.heightVal + "px", paddingTop: event.data.topPaddingVal + "px", paddingBottom: event.data.bottomPaddingVal + "px", marginTop: event.data.topMarginVal + "px", marginBottom: event.data.bottomMarginVal + "px"}, "normal");//, function(){$(this).hide();}); $(event.data.trigger).removeClass("collapsed"); $.cookies.set('jcollapserSub_' + event.data.target, 'expanded', {hoursToLive: 24 * 365}); } else if ($(event.data.trigger).attr('class').indexOf('collapsed') == -1 ) { // if collapsing $(event.data.target).animate({ height: "0px", paddingTop: "0px", paddingBottom: "0px", marginTop: "0px", marginBottom: "0px"}, "normal", function(){$(this).hide();$(this).remove();}); $(event.data.trigger).addClass("collapsed"); $.cookies.set('jcollapserSub_' + event.data.target, 'collapsed', {hoursToLive: 24 * 365}); } EDIT So, having new eyes truly makes a difference. As I was reviewing the code in this post this morning after being away over the weekend, I found where I had err'd. This: $(event.data.target + 'a.addButton').click(addResourceToList); Should be this (notice the space before a.addbutton): $(event.data.target + ' a.addButton').click(addResourceToList); Same issue with the "li.resource". So it was never pointing to the right elements... Thank you, Rene, for your help!!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • how to wait multiple function processing to finish

    - by user351412
    I have a problem about multiple function processing , listed as below code, the main function is btnEvalClick, I have try to use alter native 1and 2 to wait the function not move to next record before theprocessed function finish, but it does not work //private function btnEvalClick(event:Event):void { // var i:int; // for(i= 0; i < (dataArr1.length); i++) { // dispatchEvent( new FlexEvent('test') ); // callfunc1('cydatGMX'); //call function 1 // callfun2('cydatGMO'); //call function 1 // editSave(); //save record (HTTP) //## Alternative 1 //if (String(event) == 'SAVEOK') { // RecMov('next'); //move record if save = OK //} //## Alternative 2 //while (waitfc == '') // if waitfc not 'OK' continue looping //{ // z = z + 1; //} // RecMov('next'); //Move to next record to process //} //private function callfunc1(tasal:String):void { // var mySO :SharedObject; // var myDP: Array; // var i:int; // var prm:Array; // try // { // mySO = SharedObject.getLocal(tasal,'/'); // prm = mySO.data.txt.split('?'); // for(i=0; i < (prm.length - 1); i++) { // myDP = prm[i].toString().split('^'); // if ( myDP[0].toString() == String(dataArr1[dg].MatrixCDCol)){ // myDPX = myDP; // break; // } // } // } // catch (err:Error) { // Alert.show('Limit object creation fail (' + tasal + '), please retry ); // } //} //private function editSave():void //{ // var parameters:* = // { // 'CertID': CertIDCol.text, 'AssetID': AssetIDCol.text, 'CertDate': cdt, //'Ccatat': CcatatCol.text, 'CertBy': CertByCol.text, 'StatusID': StatusIDCol.text, //'UpdDate': lele, 'UpdUsr': ApplicationState.instance.luNm }; // doRequest('Update', parameters, saveItemHandler); //} //private function doRequest(method_name:String, parameters:Object, callback:Function):void // { // add the method to the parameters list // parameters['method'] = (method_name + 'ASC'); // gateway.request = parameters; // var call:AsyncToken = gateway.send(); // call.request_params = gateway.request; // call.handler = callback; // } //private function saveItemHandler(e:Object):void // { // if (e.isError) // { // Alert.show('Error: ' + e.data.error); // } // else // { // Alert.show('Record Saved..'); // waitfc = 'OK'; // dispatchEvent( new FlexEvent('SAVEOK') ); // } // }

    Read the article

  • Thread sleep and thread join.

    - by Dhruv Gairola
    hi guys, if i put a thread to sleep in a loop, netbeans gives me a caution saying Invoking Thread.sleep in loop can cause performance problems. However, if i were to replace the sleep with join, no such caution is given. Both versions compile and work fine tho. My code is below (check the last few lines for "Thread.sleep() vs t.join()"). public class Test{ //Display a message, preceded by the name of the current thread static void threadMessage(String message) { String threadName = Thread.currentThread().getName(); System.out.format("%s: %s%n", threadName, message); } private static class MessageLoop implements Runnable { public void run() { String importantInfo[] = { "Mares eat oats", "Does eat oats", "Little lambs eat ivy", "A kid will eat ivy too" }; try { for (int i = 0; i < importantInfo.length; i++) { //Pause for 4 seconds Thread.sleep(4000); //Print a message threadMessage(importantInfo[i]); } } catch (InterruptedException e) { threadMessage("I wasn't done!"); } } } public static void main(String args[]) throws InterruptedException { //Delay, in milliseconds before we interrupt MessageLoop //thread (default one hour). long patience = 1000 * 60 * 60; //If command line argument present, gives patience in seconds. if (args.length > 0) { try { patience = Long.parseLong(args[0]) * 1000; } catch (NumberFormatException e) { System.err.println("Argument must be an integer."); System.exit(1); } } threadMessage("Starting MessageLoop thread"); long startTime = System.currentTimeMillis(); Thread t = new Thread(new MessageLoop()); t.start(); threadMessage("Waiting for MessageLoop thread to finish"); //loop until MessageLoop thread exits while (t.isAlive()) { threadMessage("Still waiting..."); //Wait maximum of 1 second for MessageLoop thread to //finish. /*******LOOK HERE**********************/ Thread.sleep(1000);//issues caution unlike t.join(1000) /**************************************/ if (((System.currentTimeMillis() - startTime) > patience) && t.isAlive()) { threadMessage("Tired of waiting!"); t.interrupt(); //Shouldn't be long now -- wait indefinitely t.join(); } } threadMessage("Finally!"); } } As i understand it, join waits for the other thread to complete, but in this case, arent both sleep and join doing the same thing? Then why does netbeans throw the caution?

    Read the article

  • JAXB doesn't unmarshal list of interfaces

    - by Joker_vD
    It seems JAXB can't read what it writes. Consider the following code: interface IFoo { void jump(); } @XmlRootElement class Bar implements IFoo { @XmlElement public String y; public Bar() { y = ""; } public Bar(String y) { this.y = y; } @Override public void jump() { System.out.println(y); } } @XmlRootElement class Baz implements IFoo { @XmlElement public int x; public Baz() { x = 0; } public Baz(int x) { this.x = x; } @Override public void jump() { System.out.println(x); } } @XmlRootElement public class Holder { private List<IFoo> things; public Holder() { things = new ArrayList<>(); } @XmlElementWrapper @XmlAnyElement public List<IFoo> getThings() { return things; } public void addThing(IFoo thing) { things.add(thing); } } // ... try { JAXBContext context = JAXBContext.newInstance(Holder.class, Bar.class, Baz.class); Holder holder = new Holder(); holder.addThing(new Bar("1")); holder.addThing(new Baz(2)); holder.addThing(new Baz(3)); for (IFoo thing : holder.getThings()) { thing.jump(); } StringWriter s = new StringWriter(); context.createMarshaller().marshal(holder, s); String data = s.toString(); System.out.println(data); StringReader t = new StringReader(data); Holder holder2 = (Holder)context.createUnmarshaller().unmarshal(t); for (IFoo thing : holder2.getThings()) { thing.jump(); } } catch (Exception e) { System.err.println(e.getMessage()); } It's a simplified example, of course. The point is that I have to store two very differently implemented classes, Bar and Baz, in one collection. Well, I observed that they have pretty similar public interface, so I created an interface IFoo and made them two to implement it. Now, I want to have tools to save and load this collection to/from XML. Unfortunately, this code doesn't quite work: the collection is saved, but then it cannot be loaded! The intended output is 1 2 3 some xml 1 2 3 But unfortunately, the actual output is 1 2 3 some xml com.sun.org.apache.xerces.internal.dom.ElementNSImpl cannot be cast to testapplication1.IFoo Apparently, I need to use the annotations in a different way? Or to give up on JAXB and look for something else? I, well, can write "XMLNode toXML()" method for all classes I wan't to (de)marshal, but...

    Read the article

  • nodejs async.waterfall method

    - by user1513388
    Update 2 Complete code listing var request = require('request'); var cache = require('memory-cache'); var async = require('async'); var server = '172.16.221.190' var user = 'admin' var password ='Passw0rd' var dn ='\\VE\\Policy\\Objects' var jsonpayload = {"Username": user, "Password": password} async.waterfall([ //Get the API Key function(callback){ request.post({uri: 'http://' + server +'/sdk/authorize/', json: jsonpayload, headers: {'content_type': 'application/json'} }, function (e, r, body) { callback(null, body.APIKey); }) }, //List the credential objects function(apikey, callback){ var jsonpayload2 = {"ObjectDN": dn, "Recursive": true} request.post({uri: 'http://' + server +'/sdk/Config/enumerate?apikey=' + apikey, json: jsonpayload2, headers: {'content_type': 'application/json'} }, function (e, r, body) { var dns = []; for (var i = 0; i < body.Objects.length; i++) { dns.push({'name': body.Objects[i].Name, 'dn': body.Objects[i].DN}) } callback(null, dns, apikey); }) }, function(dns, apikey, callback){ // console.log(dns) var cb = []; for (var i = 0; i < dns.length; i++) { //Retrieve the credential var jsonpayload3 = {"CredentialPath": dns[i].dn, "Pattern": null, "Recursive": false} console.log(dns[i].dn) request.post({uri: 'http://' + server +'/sdk/credentials/retrieve?apikey=' + apikey, json: jsonpayload3, headers: {'content_type': 'application/json'} }, function (e, r, body) { // console.log(body) cb.push({'cl': body.Classname}) callback(null, cb, apikey); console.log(cb) }); } } ], function (err, result) { // console.log(result) // result now equals 'done' }); Update: I'm building a small application that needs to make multiple HTTP calls to a an external API and amalgamates the results into a single object or array. e.g. Connect to endpoint and get auth key - pass auth key to step 2 Connect to endpoint using auth key and get JSON results - create an object containing summary results and pass to step 3. Iterate over passed object summary results and call API for each item in the object to get detailed information for each summary line Create a single JSON data structure that contains the summary and detail information. The original question below outlines what I've tried so far! Original Question: Will the async.waterfall method support multiple callbacks? i.e. Iterate over an array thats passed from a previous item in the chain, then invoke multiple http requests each of which would have their own callbacks. e.g, sync.waterfall([ function(dns, key, callback){ var cb = []; for (var i = 0; i < dns.length; i++) { //Retrieve the credential var jsonpayload3 = {"Cred": dns[i].DN, "Pattern": null, "Recursive": false} console.log(dns[i].DN) request.post({uri: 'http://' + vedserver +'/api/cred/retrieve?apikey=' + key, json: jsonpayload3, headers: {'content_type': 'application/json'} }, function (e, r, body) { console.log(body) cb.push({'cl': body.Classname}) callback(null, cb, key); }); } }

    Read the article

  • Capistrano Error

    - by Casey van den Bergh
    I'm Running CentOS 5 32 bit version. This is my deploy.rb file on my local computer: #======================== #CONFIG #======================== set :application, "aeripets" set :scm, :git set :git_enable_submodules, 1 set :repository, "[email protected]:aeripets.git" set :branch, "master" set :ssh_options, { :forward_agent => true } set :stage, :production set :user, "root" set :use_sudo, false set :runner, "root" set :deploy_to, "/var/www/#{application}" set :app_server, :passenger set :domain, "aeripets.co.za" #======================== #ROLES #======================== role :app, domain role :web, domain role :db, domain, :primary => true #======================== #CUSTOM #======================== namespace :deploy do task :start, :roles => :app do run "touch #{current_release}/tmp/restart.txt" end task :stop, :roles => :app do # Do nothing. end desc "Restart Application" task :restart, :roles => :app do run "touch #{current_release}/tmp/restart.txt" end end And this the error I get on my local computer when I try to cap deploy. executing deploy' * executingdeploy:update' ** transaction: start * executing deploy:update_code' executing locally: "git ls-remote [email protected]:aeripets.git master" command finished in 1297ms * executing "git clone -q [email protected]:aeripets.git /var/www/seripets/releases/20111126013705 && cd /var/www/seripets/releases/20111126013705 && git checkout -q -b deploy 32ac552f57511b3ae9be1d58aec54d81f78f8376 && git submodule -q init && git submodule -q sync && export GIT_RECURSIVE=$([ ! \"git --version\" \\< \"git version 1.6.5\" ] && echo --recursive) && git submodule -q update --init $GIT_RECURSIVE && (echo 32ac552f57511b3ae9be1d58aec54d81f78f8376 > /var/www/seripets/releases/20111126013705/REVISION)" servers: ["aeripets.co.za"] Password: [aeripets.co.za] executing command ** [aeripets.co.za :: err] sh: git: command not found command finished in 224ms *** [deploy:update_code] rolling back * executing "rm -rf /var/www/seripets/releases/20111126013705; true" servers: ["aeripets.co.za"] [aeripets.co.za] executing command command finished in 238ms failed: "sh -c 'git clone -q [email protected]:aeripets.git /var/www/seripets/releases/20111126013705 && cd /var/www/seripets/releases/20111126013705 && git checkout -q -b deploy 32ac552f57511b3ae9be1d58aec54d81f78f8376 && git submodule -q init && git submodule -q sync && export GIT_RECURSIVE=$([ ! \"git --version`\" \< \"git version 1.6.5\" ] && echo --recursive) && git submodule -q update --init $GIT_RECURSIVE && (echo 32ac552f57511b3ae9be1d58aec54d81f78f8376 /var/www/seripets/releases/20111126013705/REVISION)'" on aeripets.co.za

    Read the article

< Previous Page | 43 44 45 46 47 48 49 50 51 52  | Next Page >