Search Results

Search found 35094 results on 1404 pages for 'post build'.

Page 474/1404 | < Previous Page | 470 471 472 473 474 475 476 477 478 479 480 481  | Next Page >

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• Compiling Visual c++ programs from the command line and msvcr90.dll

  - by Stanley kelly

  Hi, When I compile my Visual c++ 2008 express program from inside the IDE and redistribute it on another computer, It starts up fine without any dll dependencies that I haven't accounted for. When I compile the same program from the visual c++ 2008 command line under the start menu and redistribute it to the other computer, it looks for msvcr90.dll at start-up. Here is how it is compiled from the command line cl /Fomain.obj /c main.cpp /nologo -O2 -DNDEBUG /MD /ID:(list of include directories) link /nologo /SUBSYSTEM:WINDOWS /ENTRY:mainCRTStartup /OUT:Build\myprogram.ex e /LIBPATH:D:\libs (list of libraries) and here is how the IDE builds it based on the relevant parts of the build log. /O2 /Oi /GL /I clude" /I (list of includes) /D "WIN32" /D "NDEBUG" /D "_CONSOLE" /D "_UNICODE" /D "UNICODE" /FD /EHsc /MD /Gy /Yu"stdafx.h" /Fp"Release\myprogram" /Fo"Release\\" /Fd"Release\vc90.pdb" /W3 /c /Zi /TP /wd4250 /vd2 Creating command line "cl.exe @d:\myprogram\Release\RSP00000118003188.rsp /nologo /errorReport:prompt" /OUT:"D:\myprgram\Release\myprgram.exe" /INCREMENTAL:NO /LIBPATH:"d:\gtkmm\lib" /MANIFEST /MANIFESTFILE:"Release\myprogam.exe.intermediate.manifest" /MANIFESTUAC:"level='asInvoker' uiAccess='false'" /DEBUG /PDB:"d:\myprogram\Release\myprogram.pdb" /SUBSYSTEM:WINDOWS /OPT:REF /OPT:ICF /LTCG /ENTRY:"mainCRTStartup" /DYNAMICBASE /NXCOMPAT /MACHINE:X86 (list of libraries) Creating command line "link.exe @d:\myprogram\Release\RSP00000218003188.rsp /NOLOGO /ERRORREPORT:PROMPT" /outputresource:"..\Release\myprogram.exe;#1" /manifest .\Release\myprogram.exe.intermediate.manifest Creating command line "mt.exe @d:\myprogram\Release\RSP00000318003188.rsp /nologo" I would like to be able to compile it from the command line and not have it look for such a late version of the runtime dll, like the version compiled from the IDE seems not to do. Both versions pass /MD to the compiler, so i am not sure what to do.

  Read the article

• Globally disabling FxCop errors in TeamCity

  - by Dave

  Ok, another FxCop question for today. I've read the arguments regarding the IdentifiersShouldBeCasedCorrectly rule, and whether or not it should be "XML" or "Xml". Well, I'm an "XML" guy and I want to stay that way. Therefore, I do not want FxCop to correct me all of the time. I have been using the SuppressMessage attribute only for specific cases. I have also used FxCop to mark a ton of errors and copied them as "module" level SuppressMessage statements into assemblyinfo.cs. That works pretty well. However, now I really want to globally disable this annoying IdentifiersShouldBeCasedCorrectly rule. I'm using TeamCity 5.0.3, and am not using an FxCop project file (however, I could do this). I was hoping that I could pass a parameter to FxCopCmd to tell it to ignore this error, but it doesn't look that way from the documentation. So... is there anything I can do short of creating an FxCop project file on the TeamCity build server and using it for the FxCop build runner?

  Read the article

• Ideal Multi-Developer Lamp Stack?

  - by devians

  I would like to build an 'ideal' lamp development stack. Dual Server (Virtualised, ESX) Apache / PHP on one, Databases (MySQL, PgSQL, etc) on the other. User (Developer) Manageable mini environments, or instance. Each developer instance shares the top level config (available modules and default config etc) A developer should have control over their apache and php version for each project. A developer might be able to change minor settings, ie magicquotes on for legacy code. Each project would determine its database provider in its code The idea is that it is one administrate-able server that I can control, and provide globally configured things like APC, Memcached, XDebug etc. Then by moving into subsets for each project, i can allow my users to quickly control their environments for various projects. Essentially I'm proposing the typical system of a developer running their own stack on their own machine, but centralised. In this way I'd hope to avoid problems like Cross OS code problems, database inconsistencies, slightly different installs producing bugs etc. I'm happy to manage this in custom builds from source, but if at all possible it would be great to have a large portion of it managed with some sort of package management. We typically use CentOS, so yum? Has anyone ever built anything like this before? Is there something turnkey that is similar to what I have described? Are there any useful guides I should be reading in order to build something like this?

  Read the article

• Optimized Publish/Subcribe JMS Broker Cluster and Conflicting Posts on StackOverFlow for the Answer

  - by Gene

  Hi, I am looking to build a publish/subscribe distributed messaging framework that can manage huge volumes of message traffic with some intelligence at the broker level. I don't know if there's a topology that describes this, but this is the model I'm going after: EXAMPLE MODEL A A) There are two running message brokers (ideally all on localhost if possible, for easier demo-ing) : Broker-A Broker-B B) Each broker will have 2 listeners and 1 publisher. Example Figure [subscriber A1, subscriber A2, publisher A1] <-- BrokerA <-- BrokerB <-- [publisher B1, subscriber B1, subscriber B2] IF a message-X is published to broker A and there no subscribers for it among the listeners on Broker-B (via criteria in Message Selectors or Broker routing rules), then that message-X will never be published to Broker-B. ELSE, broker A will publish the message to broker B, where one of the broker B listeners/subscribers/services is expecting that message based on the subscription criteria. Is Clustering the Correct Approach? At first, I concluded that the "Broker Clustering" concept is what I needed to support this. However, as I have come to understand it, the typical use of clustering entails either: message redundancy across all brokers ... or Competing Consumers pattern ... and neither of these satisfy the requirement in the EXAMPLE MODEL A. What is the Correct Approach? My question is, does anyone know of a JMS implementation that supports the model I described? I scanned through all the stackoverflow post titles for the search: JMS and Cluster. I found these two informative, but seemingly conflicting posts: Says the EXAMPLE MODEL A is/should-be implicitly supported: http://stackoverflow.com/questions/2255816/jms-consumer-with-activemq-network-of-brokers " this means you pick a broker, connect to it, and let the broker network sort it out amongst themselves. In theory." Says the EXAMPLE MODEL A IS NOT suported: http://stackoverflow.com/questions/2017520/how-does-a-jms-topic-subscriber-in-a-clustered-application-server-recieve-message "All the instances of PropertiesSubscriber running on different app servers WILL get that message." Any suggestions would be greatly appreciated. Thanks very much for reading my post, Gene

  Read the article

• How to register assemblies using Windsor in ASP.NET MVC

  - by oz

  This is how my project looks: TestMvc (my web project) has a reference to the DomainModel.Core assembly where my interfaces and business objects reside. The class that implements the interfaces in DomainModel.Core is in a different assembly called DomainModel.SqlRepository; the reason behind it is that if I just want to create a repository for Oracle I just have to deploy the new dll, change the web.config and be done with it. When I build the solution, if I look at the \bin folder of my TestMvc project, there is no reference to the DomainModel.SqlRepository, which makes sense because it's not being reference anywhere. Problem arises when my windsor controller factory tries to resolve that assembly, since it's not on the \bin directory. So is there a way to point windsor to a specific location, without adding a reference to that assembly? My web.config looks like this: <component id="UserService" service="TestMvc.DomainModel.Core.Interface, TestMvc.DomainModel.Core" type="TestMvc.DomainModel.SqlRepository.Class, TestMvc.DomainModel.SqlRepository" lifestyle="PerWebRequest" /> There's many ways around this, like copying the dll as part of the build, add the reference to the project so it will get copied to the \bin folder or install it on the GAC and add an assembly reference in the web.config. I guess my question is specific to Windsor, to see if I can give the location of my assembly and it will resolve it.

  Read the article

• JsonParseException on Valid JSON

  - by user2909602

  I am having an issue calling a RESTful service from my client code. I have written the RESTful service using CXF/Jackson, deployed to localhost, and tested using RESTClient successfully. Below is a snippet of the service code: @POST @Produces("application/json") @Consumes("application/json") @Path("/set/mood") public Response setMood(MoodMeter mm) { this.getMmDAO().insert(mm); return Response.ok().entity(mm).build(); } The model class and dao work successfully and the service itself works fine using RESTClient. However, when I attempt to call this service from Java Script, I get the error below on the server side: Caused by: org.codehaus.jackson.JsonParseException: Unexpected character ('m' (code 109)): expected a valid value (number, String, array, object, 'true', 'false' or 'null') I have copied the client side code below. To make sure it has nothing to do with the JSON data itself, I used a valid JSON string (which works using RESTClient, JSON.parse() method, and JSONLint) in the vars 'json' (string) and 'jsonData' (JSON). Below is the Java Script code: var json = '{"mood_value":8,"mood_comments":"new comments","user_id":5,"point":{"latitude":37.292929,"longitude":38.0323323},"created_dtm":1381546869260}'; var jsonData = JSON.parse(json); $.ajax({ url: 'http://localhost:8080/moodmeter/app/service/set/mood', dataType: 'json', data: jsonData, type: "POST", contentType: "application/json" }); I've seen the JsonParseException a number of times on other threads, but in this case the JSON itself appears to be valid (and tested). Any thoughts are appreciated.

  Read the article

• Using embedded standard HTML forms with ASP.NET

  - by RM

  I have a standard aspx page with which I need to add another standard HTML form into and have it submit to another location (external site), however whenever I press the submit button the page seems to do a post back rather than using the sub-forms action url. A mock up of what the form relationships is below. Note in the real deployment the form will be part of a content area of a master page layout, so the form needs to submit independantly from the master page form. <html xmlns="http://www.w3.org/1999/xhtml" > <head runat="server"> <title>Untitled Page</title> </head> <body> <form id="form1" runat="server"> <div> <form id="subscribe_form" method="post" action="https://someothersite.com" name="em_subscribe_form" > <input type="text" id="field1" name="field1" /> <input id="submitsubform" type="submit" value="Submit" /> </form> </div> </form> </body> </html>

  Read the article

• Django QuerySet API: How do I join iexact and icontains?

  - by Zeynel

  Hello, I have this join: lawyers = Lawyer.objects.filter(last__iexact=last_name).filter(first__icontains=first_name) This is the site If you try Last Name: Abbas and First Name: Amr it tells you that amr abbas has 1 schoolmates. But if you try First name only it says that there are no lawyers in the database called amr (obviously there is). If I change (last__iexact=last_name) to (last__icontains=last_name) then leaving Last Name blank works fine and amr is found. But with last__icontains=last_name if you search for "collin" you also get "collins" and "collingwood" which is not what I want. Do you know how I can use iexact and also have it ignored if it is blank? Thanks This is the view function: def search_form(request): if request.method == 'POST': search_form = SearchForm(request.POST) if search_form.is_valid(): last_name = search_form.cleaned_data['last_name'] first_name = search_form.cleaned_data['first_name'] lawyers = Lawyer.objects.filter(last__iexact=last_name).filter(first__icontains=first_name) if len(lawyers)==0: form = SearchForm() return render_to_response('not_in_database.html', {'last': last_name, 'first': first_name, 'form': form}) if len(lawyers)>1: form = SearchForm(initial={'last_name': last_name}) return render_to_response('more_than_1_match.html', {'lawyers': lawyers, 'last': last_name, 'first': first_name, 'form': form}) q_school = Lawyer.objects.filter(last__icontains=last_name).filter(first__icontains=first_name).values_list('school', flat=True) q_year = Lawyer.objects.filter(last__icontains=last_name).filter(first__icontains=first_name).values_list('year_graduated', flat=True) lawyers1 = Lawyer.objects.filter(school__iexact=q_school[0]).filter(year_graduated__icontains=q_year[0]).exclude(last__icontains=last_name) form = SearchForm() return render_to_response('search_results.html', {'lawyers': lawyers1, 'last': last_name, 'first': first_name, 'form': form}) else: form = SearchForm() return render_to_response('search_form.html', {'form': form, })

  Read the article

• Non RBAC User Roles and Permissions System: checking the user's City

  - by micha12

  We are currently designing a User Roles and Permissions System in our web application (ASP.NET), and it seems that we have several cases that do no fit within the classical Role-Based Access Control (RBAC). I will post several questions, each devoted to a particular case, this being the first post. We have the following case: not to allow a user view a certain page if the user lives in a particular city. This is a simple case that is coded in the following way: if (User.City == “Moscow”) // Allow the user to view the page. else // Do not allow the user to view this page. Though this case is very simple and straightforward, it has nothing to do with the RBAC. On StackOverflow, someone called this an Attribute-based Access Control. Under the classical RBAC, it seems that this case should be designed like this: introduce a permission “City where the person lives”, this permission will have a property City. Then create a role, add a permission of type “City = Moscow” to it and the assign the role to the user. Looks extremely cumbersome. The question is whether it is acceptable to introduce such non-RBAC approaches to our permissions system – does that break the design or not? This might seem a primitive question, but we found that most applications use pure RBAC, and we started to think that we might be doing something wrong. Thank you.

  Read the article

• ASP.net AppendHeader not working in ASP MVC

  - by Chao

  I'm having problems getting AppendHeader to work properly if I am also using an authorize filter. I'm using an actionfilter for my AJAX actions that applies Expires, Last-Modified, Cache-Control and Pragma (though while testing I have tried including it in the action method itself with no change in results). If I don't have an authorize filter the headers work fine. Once I add the filter the headers I tried to add get stripped. The headers I want to add Response.AppendHeader("Expires", "Sun, 19 Nov 1978 05:00:00 GMT"); Response.AppendHeader("Last-Modified", String.Format("{0:r}", DateTime.Now)); Response.AppendHeader("Cache-Control", "no-store, no-cache, must-revalidate"); Response.AppendHeader("Cache-Control", "post-check=0, pre-check=0"); Response.AppendHeader("Pragma", "no-cache"); An example of the headers from a correct page: Server ASP.NET Development Server/9.0.0.0 Date Mon, 14 Jun 2010 17:22:24 GMT X-AspNet-Version 2.0.50727 X-AspNetMvc-Version 2.0 Pragma no-cache Expires Sun, 19 Nov 1978 05:00:00 GMT Last-Modified Mon, 14 Jun 2010 18:22:24 GMT Cache-Control no-store, no-cache, must-revalidate, post-check=0, pre-check=0 Content-Type text/html; charset=utf-8 Content-Length 352 Connection Close And from an incorrect page: Server ASP.NET Development Server/9.0.0.0 Date Mon, 14 Jun 2010 17:27:34 GMT X-AspNet-Version 2.0.50727 X-AspNetMvc-Version 2.0 Pragma no-cache, no-cache Cache-Control private, s-maxage=0 Content-Type text/html; charset=utf-8 Content-Length 4937 Connection Close

  Read the article

• MySQLdb within python2.5 virtualenv

  - by wizard

  I have a Fedora 11 box with MySQL server. Fedora 11 uses python 2.6 internally and python 2.6 is automatically installed on the box. I have created a python virtual-env for version 2.5.5, so that I can run turbogears 1.x application. I have MySQLdb rpm installed on the box (and it works fine with python 2.6). When I import MySQLdb from within python version 2.6 it imports is successfully. When I import MySQLdb from within the python 2.5.5 virtual-env the import fails (because I have installed virtual-env with --no-site-packages). So, I have to install MySQLdb python as a local package (local to virtual-env). 'easy_install MySQL-python' within the virtual env fails. It downloads the MySQL-python-1.2.3.c1.tar.gz/download, but the 'python setup.py build' fails with error. The same problem occurs when building the MySQL outside of virtual-env. Is the 'python setup.py build' for MySQL-python trying to link to a library (and am I missing some library)? Or is the downloaded code missing some header files (unlikely)? Thanks.

  Read the article

• forward/strong enum in VS2010

  - by Noah Roberts

  At http://blogs.msdn.com/vcblog/archive/2010/04/06/c-0x-core-language-features-in-vc10-the-table.aspx there is a table showing C++0x features that are implemented in 2010 RC. Among them are listed forwarding enums and strongly typed enums but they are listed as "partial". The main text of the article says that this means they are either incomplete or implemented in some non-standard way. So I've got VS2010RC and am playing around with the C++0x features. I can't figure these ones out and can't find any documentation on these two features. Not even the simplest attempts compile. enum class E { test }; int main() {} fails with: 1e:\dev_workspace\experimental\2010_feature_assessment\2010_feature_assessment\main.cpp(518): error C2332: 'enum' : missing tag name 1e:\dev_workspace\experimental\2010_feature_assessment\2010_feature_assessment\main.cpp(518): error C2236: unexpected 'class' 'E'. Did you forget a ';'? 1e:\dev_workspace\experimental\2010_feature_assessment\2010_feature_assessment\main.cpp(518): error C3381: 'E' : assembly access specifiers are only available in code compiled with a /clr option 1e:\dev_workspace\experimental\2010_feature_assessment\2010_feature_assessment\main.cpp(518): error C2143: syntax error : missing ';' before '}' 1e:\dev_workspace\experimental\2010_feature_assessment\2010_feature_assessment\main.cpp(518): error C4430: missing type specifier - int assumed. Note: C++ does not support default-int ========== Build: 0 succeeded, 1 failed, 0 up-to-date, 0 skipped ========== int main() { enum E : short; } Fails with: 1e:\dev_workspace\experimental\2010_feature_assessment\2010_feature_assessment\main.cpp(513): warning C4480: nonstandard extension used: specifying underlying type for enum 'main::E' 1e:\dev_workspace\experimental\2010_feature_assessment\2010_feature_assessment\main.cpp(513): error C2059: syntax error : ';' ========== Build: 0 succeeded, 1 failed, 0 up-to-date, 0 skipped ========== So it seems it must be some totally non-standard implementation that has allowed them to justify calling this feature "partially" done. How would I rewrite that code to access the forwarding and strong type feature?

  Read the article

• How does overlayViewTouched notification work in the MoviePlayer sample code

  - by Jonathan

  Hi, I have a question regarding the MoviePlayer sample code provided by apple. I don't understand how the overlayViewTouch notification works. The NSlog message I added to it does not get sent when I touch the view (not button). // post the "overlayViewTouch" notification and will send // the overlayViewTouches: message - (void)overlayViewTouches:(NSNotification *)notification { NSLog(@"overlay view touched"); // Handle touches to the overlay view (MyOverlayView) here... } I can, however, get the NSlog notification if I place it in -(void)touchesBegan in "MyOverlayView.m". Which makes me think it is recognizing touches but not sending a notification. // Handle any touches to the overlay view - (void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event { UITouch* touch = [touches anyObject]; if (touch.phase == UITouchPhaseBegan) { NSLog(@"overlay touched(from touchesBegan") // IMPORTANT: // Touches to the overlay view are being handled using // two different techniques as described here: // // 1. Touches to the overlay view (not in the button) // // On touches to the view we will post a notification // "overlayViewTouch". MyMovieViewController is registered // as an observer for this notification, and the // overlayViewTouches: method in MyMovieViewController // will be called. // // 2. Touches to the button // // Touches to the button in this same view will // trigger the MyMovieViewController overlayViewButtonPress: // action method instead. NSNotificationCenter *nc = [NSNotificationCenter defaultCenter]; [nc postNotificationName:OverlayViewTouchNotification object:nil]; } } Can anyone shed light on what I am missing or doing wrong? Thank you.

  Read the article

• How do I read the manifest file for a webapp running in apache tomcat?

  - by Nik Reiman

  I have a webapp which contains a manifest file, in which I write the current version of my application during an ant build task. The manifest file is created correctly, but when I try to read it in during runtime, I get some strange side-effects. My code for reading in the manifest is something like this: InputStream manifestStream = Thread.currentThread() .getContextClassLoader() .getResourceAsStream("META-INFFFF/MANIFEST.MF"); try { Manifest manifest = new Manifest(manifestStream); Attributes attributes = manifest.getMainAttributes(); String impVersion = attributes.getValue("Implementation-Version"); mVersionString = impVersion; } catch(IOException ex) { logger.warn("Error while reading version: " + ex.getMessage()); } When I attach eclipse to tomcat, I see that the above code works, but it seems to get a different manifest file than the one I expected, which I can tell because the ant version and build timestamp are both different. Then, I put "META-INFFFF" in there, and the above code still works! This means that I'm reading some other manifest, not mine. I also tried this.getClass().getClassLoader().getResourceAsStream(...) But the result was the same. What's the proper way to read the manifest file from inside of a webapp running in tomcat? Edit: Thanks for the suggestions so far. Also, I should note that I am running tomcat standalone; I launch it from the command line, and then attach to the running instance in Eclipse's debugger. That shouldn't make a difference, should it?

  Read the article

• RedirectToAction and validate MVC 2

  - by Dan

  Hi, my problem is the View where the user typed, the validation. I have to take RedirectToAction on the site because on the site upload a file. Thats my code. My model class public class Person { [Required(ErrorMessage= "Please enter name")] public string name { get; set; } } My View <%@ Page Title="" Language="C#" MasterPageFile="~/Views/Shared/Site.Master" Inherits="System.Web.Mvc.ViewPage<MvcWebRole1.Models.Person>" %> Name <h2>Information Data</h2> <%= Html.ValidationSummary() %> <%using (Html.BeginForm ("upload","Home", FormMethod.Post, new{ enctype ="multipart/form-data" })) {%> <fieldset> <legend>Fields</legend> <p> <label for="name">name:</label> <%= Html.TextBox("name") %> <%= Html.ValidationMessage("name", "*") %> </p> </fieldset> <% } %> and the Controller [AcceptVerbs(HttpVerbs.Post)] public ActionResult upload(FormCollection form) { Person lastname = new Person(); lastname.name = form["name"]; return RedirectToAction("Index"); } Thx for answer my question In advance

  Read the article

• Cannot get a session with Facebook app? (using its Graph API)

  - by Jian Lin

  I have really simple few lines of Facebook app, using the new Facebook API: <pre> <?php require 'facebook.php'; // Create our Application instance. $facebook = new Facebook(array( 'appId' => '117676584930569', 'secret' => '**********', // hidden here on the post... 'cookie' => true, )); var_dump($facebook); ?> but it is giving me the following output: http://apps.facebook.com/woolaladev/i2.php would give out object(Facebook)#1 (6) { ["appId:protected"]=> string(15) "117676584930569" ["apiSecret:protected"]=> string(32) "**********" <--- just hidden on this post ["session:protected"]=> NULL <--- Session is NULL for some reason ["sessionLoaded:protected"]=> bool(false) ["cookieSupport:protected"]=> bool(true) ["baseDomain:protected"]=> string(0) "" } Session is NULL for some reason, but I am logged in and can access my home and profile and run other apps on Facebook (to see that I am logged on). I am following the sample on: http://github.com/facebook/php-sdk/blob/master/examples/example.php http://github.com/facebook/php-sdk/blob/master/src/facebook.php (download using raw URL: wget http://github.com/facebook/php-sdk/raw/master/src/facebook.php ) Trying on both hosting companies at dreamhost.com and netfirms.com, and the results are the same.

  Read the article

• How to deal with recursive dependencies between static libraries using the binutils linker?

  - by Jack Lloyd

  I'm porting an existing system from Windows to Linux. The build is structured with multiple static libraries. I ran into a linking error where a symbol (defined in libA) could not be found in an object from libB. The linker line looked like g++ test_obj.o -lA -lB -o test The problem of course being that by the time the linker finds it needs the symbol from libA, it has already passed it by, and does not rescan, so it simply errors out even though the symbol is there for the taking. My initial idea was of course to simply swap the link (to -lB -lA) so that libA is scanned afterwards, and any symbols missing from libB that are in libA are picked up. But then I find there is actually a recursive dependency between libA and libB! I'm assuming the Visual C++ linker handles this in some way (does it rescan by default?). Ways of dealing with this I've considered: Use shared objects. Unfortunately this is undesirable from the perspective of requiring PIC compliation (this is performance sensitive code and losing %ebx to hold the GOT would really hurt), and shared objects aren't needed. Build one mega ar of all of the objects, avoiding the problem. Restructure the code to avoid the recursive dependency (which is obviously the Right Thing to do, but I'm trying to do this port with minimal changes). Do you have other ideas to deal with this? Is there some way I can convince the binutils linker to perform rescans of libraries it has already looked at when it is missing a symbol?

  Read the article

• Qmake does not specify a valid qt

  - by Comptrol

  After installing Qt SDK for Open Source C++ development on Mac OS by following the respective steps Note for the binary package: If you have the binary package, simply double-click on the Qt.mpkg and follow the instructions to install Qt. . Yes, that is all I have done to install Qt on MacOsX. Everything was going fine, until I run a sample application, of which compile output resulted in: No valid Qt version set. Set one in Preferences Error while building project qtilk When executing build step 'QMake' Canceled build. Then I tried to change the respective Qt version in Preferences and I hovered over the Path, I realized my mkspec isn't set: Then I tried querying qmake by qmake -query : QT_INSTALL_PREFIX:/ QT_INSTALL_DATA:/usr/local/Qt4.6 QT_INSTALL_DOCS:/Developer/Documentation/Qt QT_INSTALL_HEADERS:/usr/include QT_INSTALL_LIBS:/Library/Frameworks QT_INSTALL_BINS:/Developer/Tools/Qt QT_INSTALL_PLUGINS:/Developer/Applications/Qt/plugins QT_INSTALL_TRANSLATIONS:/Developer/Applications/Qt/translations QT_INSTALL_CONFIGURATION:/Library/Preferences/Qt QT_INSTALL_EXAMPLES:/Developer/Examples/Qt/ QT_INSTALL_DEMOS:/Developer/Examples/Qt/Demos QMAKE_MKSPECS:/usr/local/Qt4.6/mkspecs QMAKE_VERSION:2.01a QT_VERSION:4.6.2 QMAKE_MKSPECS seems to be set here?? Will setting my mkspec solve my building problem? I tried setting by typing export mkspec=macx-g++. Still, mkspec seems not to be set to anything. I am all ears waiting for your answers. Thanks in advance.

  Read the article

• How to use Svn Version Task to set the Version of a vb project

  - by SchlaWiener

  I have a Visual Studio 2008 Solution where the main output exe is a VB.Net Winforms exe which has several VB.Net and C# dll's linked from the same solution. The whole solution is under version control with subversion. Now I want to automagically update by generated files with the current svn revision number. For this purpose I found this neat project: http://svnversiontasks.codeplex.com/ You also need the MSBuild.Communuity.Tasks for this to work. There was a msbuild example on how to update the rev number for every single project in your solution which I use: <Import Project="$(MSBuildExtensionsPath)\SvnTools.Targets\SvnTools.Tasks.VersionManagement.Tasks" /> <Target Name="build"> <CreateItem Include="../**/AssemblyInfo.vb;../**/AssemblyInfo.cs;../**/Properties/AssemblyInfo.cs"> <Output TaskParameter="Include" ItemName="AssemblyInfoFiles" /> </CreateItem> <CreateItem Include="../**/*.vdproj;*.vdproj"> <Output TaskParameter="Include" ItemName="DeploymentProjectFiles" /> </CreateItem> <UpdateVersion AssemblyInfoFiles="@(AssemblyInfoFiles)" DeploymentProjectFiles="@(DeploymentProjectFiles)" Format="yyyy.mm.dd.rev" /> <Exec Command="&quot;$(VS90COMNTOOLS)..\IDE\devenv&quot; ..\MyApp.sln /build" /> <RevertVersionChange AssemblyInfoFiles="@(AssemblyInfoFiles)" DeploymentProjectFiles="@(DeploymentProjectFiles)" /> </Target> I modified the original file to also include the AssemblyInfo.vb file and saved it as a msbuild.proj file. However if I execute msbuild from the console I see that the C# projects are updated (I can also confirm that from the properties of the output dll but my vb project remains unchanged: Reverting version number change: ../App1\AssemblyInfo.vb Updating version number (to rev 0) for file: ../App1\AssemblyInfo.vb D:\Source\MyApp\MyAppDeploy\MyAppDeploy.csproj : warning : Version attribute not found, file not updated. Reverting version number change: ../App2\Properties\AssemblyInfo.cs Updating version number (to rev 0) for file: ../App2\Properties\AssemblyInfo.cs Successfully updated file. Maybe the task does not support VB.Net. But maybe someone has a solution for this...

  Read the article

• What are best practices for managing related Cabal packages?

  - by Norman Ramsey

  I'm working on a dataflow-based optimization library written in Haskell. It now seems likely that the library is going to have to be split into two pieces: A core piece with minimal build dependencies; call it hoopl-core. A full piece, call it hoopl, which may have extra dependencies on packages like a prettyprinter, QuickCheck, and so on. The idea is that the Glasgow Haskell Compiler will depend only on hoopl-core, so that it won't be too difficult to bootstrap the compiler. Other compilers will get the extra goodies in hoopl. Package hoopl will depend on hoopl-core. The Debian package tools can build multiple packages from a single source tree. Unfortunately Cabal has not yet reached that level of sophistication. But there must be other library or application designers out there who have similar issues (e.g., one package for a core library, another for a command-line interface, another for a GUI interface). What are current best practices for building and managing multiple related Haskell packages using Cabal?

  Read the article

• How can I attach a file using Wordpress custom fields / meta boxes?

  - by shipshape

  I am using Wordpress's add_meta_box() function to add customized meta fields to the Add New Post page, like this. I want one of these fields to allow the user to upload a file, so that a single image, pdf, audio file, or video can be associated with the post. The closest example I've seen is this one. Unfortunately it does not suit my needs, as I want my file to be processed by Wordpress's Media Uploader - so it should appear in the Media Library afterwards, and thumbnails should be generated according to the Media settings. I think ideally there would be a way to tap into Wordpress's existing Add Media dialog, and simply output the URL of the uploaded file into a text box, but I don't see how to do that. This question is similar, but the answers are a little clunky - I would like to keep this super simple for my end users. How can I accomplish this? Please do not recommend plugins such as Flutter or Magic Fields - I have tried these and they do not suit my purposes (I want the images to be processed by Wordpress's Media Uploader). I am using Wordpress 3.0-alpha. Thanks!

  Read the article

• Fork or copy a users browser session in IE

  - by jmoeller

  Is it possible to fork a users session (or do something similar) in a Internet Explorer plugin? I want to process the page the user is on when they click a button in the toolbar. To avoid interrupting the users browsing, I'd like to "copy" everything so I can parse and process the page in the background. The processing can involve things such as loading the content of the result links on a Google search, if that's where the button was clicked. So - what I basically want is to imitate "Ctrl+N" but hide the window from the user, so they won't be interrupted. As you can see, if you fill out and submit the form on http://www.snee.com/xml/crud/posttest.html and press "Ctrl+N", everything posted will still appear in the new window, but it won't post the data twice. I was thinking of somehow copying the IWebBrowser2, but: I'm not sure if that's possible (I haven't been able to find any information on MSDN) I don't know if it copies the sessions as well. Creating a new instance of the IWebBrowser2 and simply navigating to the current URL isn't a valid solution as POST-variables of course doesn't get carried over.

  Read the article

• Subclassing an NSTextField

  - by Hooligancat

  Given all the complex things I seem to cover every day, this appears to be a "what the heck am I doing wrong that seems to simple?" scenario! I would like to subclass an NSTextField to change the background color and text color. For simplicity sake (and to help anyone who hasn't ever subclassed anything before), here is the example of my (simplified) subclass MyNSTextFieldSubclass... Step 1: Create the subclass file: First the header file @interface MyTextFieldSubclass : NSTextField { } @end And the method file @implementation MyTextFieldSubclass -(NSColor *)backgroundColor { return [NSColor redColor]; } -(NSColor *)textColor { return [NSColor yellowColor]; } @end Step 2: Drag an NSTextField to a window in Interface Builder, select the Identity tab in the inspector and select the class MyTextFieldSubclass Step 3: Save the IB file, build and run the application Problem When I run the build, the text field does not reflect the color subclassing. However, I know the subclass is being called because if I add the following method, it gets called on text changes. -(void)textDidChange:(NSNotification *)notification { NSLog(@"My text changed"); } So why does the color change not occur on the text fields? I know that I can set the color in IB, but for anyone who has dealt with a lot of UI elements that all need the same styling, subclassing makes life way, way easier. Ironically, I have never had to subclass an NSTextField before and this one has me stumped. As usual, any and all help very much appreciated. I'm sure it will turn out to be a "Doh!" moment - just cant see the wood for the trees right now (plus I'm exhausted from watching too much World Cup Football early in the morning which never helps).

  Read the article

• axis2 maven example

  - by larrycai

  I try to use axis2 (1.5.1) version to generate java codes from wsdl files, but I can't figure out what is the correct pom.xml <build> <plugins> <plugin> <groupId>org.apache.axis2</groupId> <artifactId>axis2-wsdl2code-maven-plugin</artifactId> <version>1.5.1</version> <executions> <execution> <goals> <goal>wsdl2code</goal> </goals> <configuration> <wsdlFile>src/main/resources/wsdl/stockquote.wsdl</wsdlFile> <databindingName>xmlbeans</databindingName> <packageName>a.bc</packageName> </configuration> </execution> </executions> </plugin> </plugins> </build> <dependencies> <dependency> <groupId>org.apache.axis2</groupId> <artifactId>axis2</artifactId> <version>1.5.1</version> </dependency> </dependencies> when I type mvn compile, it complains the Retrieving document at 'src/main/resources/wsdl/stockquote.wsdl'. java.lang.ClassNotFoundException: org.apache.xml.serializer.TreeWalker And if i try to find the TreeWalker, it is a mess to find a suitable jar files. can u someone give me a hints ? or give me correct pom.xml

  Read the article

< Previous Page | 470 471 472 473 474 475 476 477 478 479 480 481  | Next Page >