Search Results

Search found 14506 results on 581 pages for 'document scanner'.

Page 493/581 | < Previous Page | 489 490 491 492 493 494 495 496 497 498 499 500  | Next Page >

  • Embedding XSL Stylesheet into XML

    - by user700996
    I have the following XML: <?xml version="1.0" encoding="ISO-8859-1"?> <?xml-stylesheet type="text/xsl" href="http://www.fakedomain.com/sally.xsl"?> And the following content in sally.xsl: <?xml version="1.0" encoding="ISO-8859-1"?> <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:template match="/"> <html> <body> <xsl:for-each select="documentcollection/document"> <p> <xsl:for-each select="rss/channel/item"> <xsl:value-of select="title"/><br /> <xsl:value-of select="description"/><br /> <xsl:value-of select="link"/><br /> </xsl:for-each> </p> </xsl:for-each> </body> </html> </xsl:template> </xsl:stylesheet> However, the browser displays the XML as though the XSL line is not present. Do you know why the browser is ignoring the XSL stylesheet? Is the style sheet wrong? Thanks

    Read the article

  • Anchor as a Submit button

    - by griegs
    I have an MVC 2 application that has the following on it; <% using( Html.BeginForm("Results","Quote", FormMethod.Post, new { name="Results" })){ %> <% Html.RenderPartial("Needs", Model.needs); %> <div class="But green" style=""> <a href="." onclick="javascript:document.Results.submit();">Go</a> </div> <input type="submit" /> <%} %> Pressing the Submit button or the anchor both post back to the right ActionResult. However, when in the controller I return View(stuff..) only the Submit button will come back to the page. When the call finishes from pressing the anchor, I go to an error page informing me that the resource cannot be found. I suspect it has something to do with href="." but am unsure what to set it to.

    Read the article

  • Event type property lost in IE-8

    - by Channel72
    I've noticed a strange Javascript error which only seems to happen on Internet Explorer 8. Basically, on IE-8 if you have an event handler function which captures the event object in a closure, the event "type" property seems to become invalidated from within the closure. Here's a simple code snippet which reproduces the error: <html> <head> <script type = "text/javascript"> function handleClickEvent(ev) { ev = (ev || window.event); alert(ev.type); window.setTimeout(function() { alert(ev.type); // Causes error on IE-8 }, 20); } function foo() { var query = document.getElementById("query"); query.onclick = handleClickEvent; } </script> </head> <body> <input id = "query" type = "submit"> <script type = "text/javascript"> foo(); </script> </body> </html> So basically, what happens here is that within the handleClickEvent function, we have the event object ev. We call alert(ev.type) and we see the event type is "click". So far, so good. But then when we capture the event object in a closure, and then call alert(ev.type) again from within the closure, now all of a sudden Internet Explorer 8 errors, saying "Member not found" because of the expression ev.type. It seems as though the type property of the event object is mysteriously gone after we capture the event object in a closure. I tested this code snippet on Firefox, Safari and Chrome, and none of them report an error condition. But in IE-8, the event object seems to become somehow invalidated after it's captured in the closure. Question: Why is this happening in IE-8, and is there any workaround?

    Read the article

  • Loading an FLV in Facebox with jQuery for IE7 and IE8

    - by Trip
    It goes almost without saying, this works perfectly in Chrome, Firefox, and Safari. IE (any version) being the problem. Objective: I am trying to load JWplayer which loads an FLV from S3 in a Facebox popup. jQuery(document).ready(function($) { $('a[rel*=facebox]').facebox() }) HTML (haml): %li#videoGirl = link_to 'What is HQchannel?', '#player', :rel => 'facebox' .grid_8.omega.alpha#player{:style => 'display: none;'} :javascript var so = new SWFObject('/flash/playerTrans.swf','mpl','640px','360px','0'); so.addParam('allowscriptaccess','always'); so.addParam('allowfullscreen','true'); so.addParam('wmode','transparent'); so.addVariable('file', 'http://hometownquarterlyvideos.s3.amazonaws.com/whatishqchannel.flv&autostart=true&controlbar=none&repeat=always&image=/flash/video_girl/whatishqchannel.jpg&icons=false&screencolor=none&backcolor=FFFFFF&screenalpha=0&overstretch'); so.addVariable('overstretch', 'true') so.write('player'); Problem: Despite the video being set to display: none;. It begins playing anyway. When clicking on the activation div, IE7 pops up a wrong sized blank div with a nav (params are set to not show nav and scrubber), and no buttons on the nav and srubber work. IE8 shows the right size but same behavior with nav and scrubber not working, and blank screen. My guess: I'm thinking that the problem is with the javascript not being called at the right times. It seems it's loading the facebox without the jwplayer. At least I assume. Hence the reason why the nav is there. I thinking that it did not read the javascript for that.

    Read the article

  • Trying to fadein divs in a sequence, over time, using JQuery

    - by user346602
    Hi, I'm trying to figure out how to make 4 images fade in sequentially when the page loads. The following is my (amateurish) code: Here is the HTML: <div id="outercorners"> <img id="corner1" src="images/corner1.gif" width="6" height="6" alt=""/> <img id="corner2" src="images/corner2.gif" width="6" height="6" alt=""/> <img id="corner3" src="images/corner3.gif" width="6" height="6" alt=""/> <img id="corner4" src="images/corner4.gif" width="6" height="6" alt=""/> </div><!-- end #outercorners--> Here is the JQuery: $(document).ready(function() { $("#corner1").fadeIn("2000", function(){ $("#corner3").fadeIn("4000", function(){ $("#corner2").fadeIn("6000", function(){ $("#corner4").fadeIn("8000", function(){ }); }); }); }); Here is the css: #outercorners { position: fixed; top:186px; left:186px; width:558px; height:372px; } #corner1 { position: fixed; top:186px; left:186px; display: none; } #corner2 { position: fixed; top:186px; left:744px; display: none; } #corner3 { position: fixed; top:558px; left:744px; display: none; } #corner4 { position: fixed; top:558px; left:186px; display: none; } They seem to just wink at me, rather than fade in in the order I've ascribed to them. Should I be using the queue() function? And, if so, how would I implement it in this case? Thank you for any assistance.

    Read the article

  • cycle through spans on jquery click, removing the first-child

    - by jacob
    Basically, this advances to the next hidden span when clicked. The markup: <div id="facts"> <span>click to cycle</span> <span>fact 1</span> <span>fact 2</span> <span>fact 3</span> <span>fact 4</span> </div> The js: $(document).ready(function() { var current = 1; $('#facts span').click(function() { // Hide all of them $('#facts span').hide(); // Unhide the current one: $('#facts span:eq(' + (current % $('#facts span').length) + ')').show(); // Increment the variable console.log(current % 4); current++; }); // Unhide the first one on load $('#facts span:first-child').show(); });? What I'm trying to do now is remove the first span after it's been clicked, because it is not necessary for the user to see the 'click to cycle' instruction again.

    Read the article

  • Convert XML to TCL Object

    - by pws5068
    Greetings, I'm new to TCL scripting, and I have a very very basic xml file which I need to import information from into tcl. Example of XML Document Structure: <object> <type>Hardware</type> <name>System Name</name> <description>Basic Description of System.</description> <attributes> <vendor>Dell</vendor> <contract>MM/DD/YY</contract> <supportExpiration>MM/DD/YY</supportExpiration> <location>Building 123</location> <serial>xxx-xxx-xxxx</serial> <mac>some-mac-address</mac> </attributes> </object> Etc... I've seen something called TCLXML but I'm not sure if this is the best route or even how to create the package to use it.. Any help will be greatly appreciated.

    Read the article

  • juqery image fading with tabs

    - by StealthRT
    Hey all, i am trying my best to figure out how to go about doing this: I have 2 tabs. When the page loads tab1 is selected automatically. This shows the tab as 1.0 transparency while tab2 stays at 0.7. Once the user clicks on tab2, tab1 goes to 0.7 transparency and tab2 goes to 1.0. However, i can not seem to get it to do that! Here is my code: function checkTab(theTab) { $('#tab1').fadeTo(250, 0.70); $('#tab2').fadeTo(250, 0.70); if ($("#tabActive").val() == theTab) { $(theTab).fadeTo(250, 1); } } $(document).ready(function() { $('#tab1').hover(function() {$(this).fadeTo(250, 1)}, function() {checkTab('#tab1')}); $('#tab2').hover(function() {$(this).fadeTo(250, 1)}, function() {checkTab('#tab2')}); $('#tab2').fadeTo(250, 0.70); $('#tabActive').val('tab1'); }); </script> <li class="stats"><img src="images/Stats.png" name="nav1" width="70" height="52" id="tab1" onclick="$('#tabActive').val('tab1');" /></li> <li class="cal"><img src="images/cal.png" name="nav1" width="70" height="52" id="tab2" onclick="$('#tabActive').val('tab2');" /></li> <input name="tabActive" id="tabActive" type="text" /> Any help would be great! :) David

    Read the article

  • Servlet receiving data both in ISO-8859-1 and UTF-8. How to URL-decode?

    - by AJPerez
    I've a web application (well, in fact is just a servlet) which receives data from 3 different sources: Source A is a HTML document written in UTF-8, and sends the data via <form method="get">. Source B is written in ISO-8859-1, and sends the data via <form method="get">, too. Source C is written in ISO-8859-1, and sends the data via <a href="http://my-servlet-url?param=value&param2=value2&etc">. The servlet receives the request params and URL-decodes them using UTF-8. As you can expect, A works without problems, while B and C fail (you can't URL-decode in UTF-8 something that's encoded in ISO-8859-1...). I can make slight modifications to B and C, but I am not allowed to change them from ISO-8859-1 to UTF-8, which would solve all the problems. In B, I've been able to solve the problem by adding accept-charset="UTF-8" to the <form>. So the <form> sends the data in UTF-8 even with the page being ISO. What can I do to fix C? Alternatively, is there any way to determine the charset on the servlet, so I can call URL-decode with the right encoding in each case?

    Read the article

  • How to make HTML layout whitespace-agnostic?

    - by ssg
    If you have consecutive inline-blocks white-space becomes significant. It adds some level of space between elements. What's the "correct" way of avoiding whitespace effect to HTML layout if you want those blocks to look stuck to each other? Example: <span>a</span> <span>b</span> This renders differently than: <span>a</span><span>b</span> because of the space inbetween. I want whitespace-effect to go away without compromising HTML source code layout. I want my HTML templates to stay clean and well-indented. I think these options are ugly: 1) Tweaking text-indent, margin, padding etc. (Because it would be dependent on font-size, default white-space width etc) 2) Putting everything on a single line, next to each other. 3) Zero font-size. That would require overriding font-size in blocks, which would otherwise be inherited. 4) Possible document-wide solutions. I want the solution to stay local for a certain block of HTML. Any ideas, any obvious points which I'm missing?

    Read the article

  • add dynamic field near his parent field?

    - by Kaps Hasija
    hi in my web page i am using Add Dynamic Field Functionality by using jquery. I am adding new div bu clicking on Existing div Like <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> by clicking on parent div i am creating new daynamic div <div class="divA">DivA2 </div> its coming end of the all div's like that <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> <div class="divA">DivA2 </div> But i need along with his parent div Like that <div class="divA">divA1 </div> <div class="divA">DivA2 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> any idea Thanks. This is My Jquery Code newTextBoxDiv = $(document.createElement('div')) .attr("id", text).attr("class", 'test0 ' + text); newTextBoxDiv.html('<div style=" width:150px; class="DivA" float: left"> </div>'); } newTextBoxDiv.appendTo("#contents"); contents is id of main div

    Read the article

  • php not redirecting

    - by NSchulze
    I'm trying to write the logout of a website. When I do this I want the page to redirect to the login page. I think I'm doing it the correct way, but can't get the right result. Could you guys point me in the right direction? Relevant Code: <button onclick="logout()">Logout</button> function logout() { var xmlhttp; if (window.XMLHttpRequest) {// code for IE7+, Firefox, Chrome, Opera, Safari xmlhttp=new XMLHttpRequest(); } else {// code for IE6, IE5 xmlhttp=new ActiveXObject("Microsoft.XMLHTTP"); } xmlhttp.onreadystatechange=function() { if (xmlhttp.readyState==4 && xmlhttp.status==200) { document.location=xmlhttp.responseText; } } xmlhttp.open("GET","logout.php",true); xmlhttp.send(); } <?php session_destroy(); header("Location:http://localhost:8888/loginns.html"); mysql_close($con); ?> Thanks!

    Read the article

  • calling java script function then C# function after clicking ASP.NET button

    - by Eyla
    I have this serious: I have ASP.NET page, This page contents Update panel with ASP.NET control. I have Java script function to do validation so when I click the button I will use onclientclick to call the java function to do the validation and after this one done should call then event click button function from code behind. I tried vew methods but they did not work for me. here is sample of my code that after I click the button onclientclick will call the java script function for validation and if the validation is OK should call onclick event. .................... java script function ........................ <script type="text/javascript" > function add(){ if (tag == trye) { document.getElementById('<%=btnInfor.ClientID%>').click(); alert("DataAdded") } else { alert("Requiered Field Missing.") return false; } } </script> ..................... ASP.NET button ................... <asp:Button ID="btnInfor" runat="server" Text="Add Information" Style="position: absolute; top: 1659px; left: 433px;" onclientclick="JavaScript: return myAdd()" /> .................... code behind in C# ...................... protected void btnInfor_Click(object sender, EventArgs e) { \\mycode }

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Sharepoint user details not visible to other users

    - by richardoz
    I am managing a SharePoint site that uses Form Based Authentication. We have several generic lists, document libraries and active task lists that users can create update and delete. Users can use the people pickers to select/search for everyone. But the users cannot see other users names, email addresses etc. in display lists or the people pickers. If I log in as the site collection administrator, I can see everyones details. So I know the data is available. Updated details on this problem (non-administrators) SharePoint users cannot see other users information. Example: User A assigns a task to user B. User A creates a new task and uses the people picker to find user B. User B is only visible by the login name “bname” and any information about user B is not visible or searchable within the people picker. Once user B is assigned the task, user A no longer sees the name in the task list – even though user A created it. No modified by, created by, assigned to or owner field data is visible to non-administrator users. Facts: Extranet site is configured to use Forms Based Authentication. Intranet uses windows based authentication Users of both the intranet and extranet have the same problem All databases are local The site uses SSRS integration SharePoint WSS on Windows 2003 Std -- After activating the verbose logging it looks like SharePoint is definately asking SQL server for only the user info for the currently logged in user: SELECT TOP 6 /lots-of-columns/ FROM UserData INNER MERGE JOIN Docs AS t1 ON ( 1 = 1 AND UserData.[tp_RowOrdinal] = 0 AND t1.SiteId = UserData.tp_SiteId AND t1.SiteId = @L2 AND t1.DirName = UserData.tp_DirName AND t1.LeafName = UserData.tp_LeafName AND t1.Level = UserData.tp_Level AND t1.IsCurrentVersion = 1 AND (1 = 1) ) LEFT OUTER JOIN AllUserData AS t2 ON ( UserData.[tp_Author]=t2.[tp_ID] AND UserData.[tp_RowOrdinal] = 0 AND t2.[tp_RowOrdinal] = 0 AND ( (t2.tp_IsCurrent = 1) ) AND t2.[tp_CalculatedVersion] = 0 AND t2.[tp_DeleteTransactionId] = 0x AND t2.tp_ListId = @L3 AND UserData.tp_ListId = @L4 AND t2.[tp_Author]=162 /* this is the currently logged in user */ ) WHERE (UserData.tp_IsCurrent = 1) AND UserData.tp_SiteId=@L2 AND (UserData.tp_DirName=@DN) AND UserData.tp_RowOrdinal=0 AND ( ( (UserData.[datetime1] IS NULL ) OR (UserData.[datetime1] = @L5DTP) ) AND t1.SiteId=@L2 AND (t1.DirName=@DN) ) ORDER BY UserData.[tp_Modified] Desc, UserData.[tp_ID] Asc Again, any ideas would be appreciated.

    Read the article

  • Javascript onclick() event bubbling - working or not?

    - by user1071914
    I have a table in which the table row tag is decorated with an onclick() handler. If the row is clicked anywhere, it will load another page. In one of the elements on the row, is an anchor tag which also leads to another page. The desired behavior is that if they click on the link, "delete.html" is loaded. If they click anywhere else in the row, "edit.html" is loaded. The problem is that sometimes (according to users) both the link and the onclick() are fired at once, leading to a problem in the back end code. They swear they are not double-clicking. I don't know enough about Javascript event bubbling, handling and whatever to even know where to start with this bizarre problem, so I'm asking for help. Here's a fragment of the rendered page, showing the row with the embedded link and associated script tag. Any suggestions are welcomed: <tr id="tableRow_3339_0" class="odd"> <td class="l"></td> <td>PENDING</td> <td>Yabba Dabba Doo</td> <td>Fred Flintstone</td> <td> <a href="/delete.html?requestId=3339"> <div class="deleteButtonIcon"></div> </a> </td> <td class="r"></td> </tr> <script type="text/javascript">document.getElementById("tableRow_3339_0").onclick = function(event) { window.location = '//edit.html?requestId=3339'; };</script>

    Read the article

  • updating multiple nodes in xml with xquery and xdmp:node-replace

    - by morja
    Hi all, I wnat to update an XML document in my xml database (Marklogic). I have xml as input and want to replace each node that exists in the target xml. If a node does not exist it would be great if it gets added, but thats maybe another task. My XML in the database: <user> <username>username</username> <firstname>firstname</firstname> <lastname>lastname</lastname> <email>[email protected]</email> <comment>comment</comment> </user> The value of $user_xml: <user> <firstname>new firstname</firstname> <lastname>new lastname</lastname> </user> My function so far: declare function update-user ( $username as xs:string, $user_xml as node()) as empty-sequence() { let $uri := user-uri($username) return for $node in $user_xml/user return xdmp:node-replace(fn:doc($uri)/user/fn:node-name($node), $node) }; First of all I cannot iterate over $user_xml/user. If I try to iterate over $user_xml I get "arg1 is not of type node()" exception. But maybe its the wrong approach anyway? Does anybody maybe have sample code how to do this?

    Read the article

  • PreparedStatement question in Java against Oracle.

    - by fardon57
    Hi everyone, I'm working on the modification of some code to use preparedStatement instead of normal Statement, for security and performance reason. Our application is currently storing information into an embedded derby database, but we are going to move soon to Oracle. I've found two things that I need your help guys about Oracle and Prepared Statement : 1- I've found this document saying that Oracle doesn't handle bind parameters into IN clauses, so we cannot supply a query like : Select pokemon from pokemonTable where capacity in (?,?,?,?) Is that true ? Is there any workaround ? ... Why ? 2- We have some fields which are of type TIMESTAMP. So with our actual Statement, the query looks like this : Select raichu from pokemonTable where evolution = TO_TIMESTAMP('2500-12-31 00:00:00.000', 'YYYY-MM-DD HH24:MI:SS.FF') What should be done for a prepared Statement ? Should I put into the array of parameters : 2500-12-31 or TO_TIMESTAMP('2500-12-31 00:00:00.000', 'YYYY-MM-DD HH24:MI:SS.FF') ? Thanks for your help, I hope my questions are clear ! Regards,

    Read the article

  • How do I use Core Data with the Cocoa Text Input system?

    - by the Joel
    Hobbyist Cocoa programmer here. Have been looking around all the usual places, but this seems relatively under-explained: I am writing something a little out of the ordinary. It is much simpler than, but similar to, a desktop publishing app. I want editable text boxes on a canvas, arbitrarily placed. This is document-based and I’d really like to use Core Data. Now, The cocoa text-handling system seems to deal with a four-class structure: NSTextStorage, NSLayoutManager, NSTextContainer and finally NSTextView. I have looked into these and know how to use them, sort of. Have been making some prototypes and it works for simple apps. The problem arrives when I get into persistency. I don't know how to, by way of Cocoa Bindings or something else, store the contents of NSTextStorage (= the actual text) in my managed object context. I have considered overriding methods pairs like -words, -setWords: in these objects. This would let me link the words to a String, which I know how to store in Core Data. However, I’d have to override any method that affects the text - and that seems a little much. Thankful for any insights.

    Read the article

  • How can click on a java show link programatically?

    - by Jules
    I'm trying to develop a new feature for our vb.net order entry system. At the moment I provide an assisted paypal login which loops through transactions and copies the transactions. My program then looks at this data and copies it into text boxes. The operator then approves and saves the record. So my code uses IHTMLFormElement and loops round form elements and adds values. However I only really use this to log in to paypal. See my code... Dim theObject As Object = Nothing theObject = "https://www.paypal.com/cgi-bin/webscr?cmd=_login-run" WebBrowPayPal.AxWebBrowser1.Navigate2(theObject) While WebBrowPayPal.AxWebBrowser1.ReadyState <> tagREADYSTATE.READYSTATE_COMPLETE Application.DoEvents() End While Dim HtmlDoc As IHTMLDocument2 = CType(WebBrowPayPal.AxWebBrowser1.Document, IHTMLDocument2) Dim FormCol As IHTMLElementCollection = HtmlDoc.forms Dim iForms As Integer = FormCol.length Dim i As Integer Dim x As Integer For i = 0 To iForms - 1 Dim oForm As IHTMLFormElement = CType(FormCol.item(CType(i, Object), CType(i, Object)), IHTMLFormElement) For x = 0 To oForm.length - 1 If oForm.elements(x).tagname = "INPUT" Then If oForm.elements(x).name = "login_email" Then oForm.elements(x).value = "[email protected]" End If If oForm.elements(x).name = "login_password" Then oForm.elements(x).value = "mypassword" End If If oForm.elements(x).type = "submit" Or _ oForm.elements(x).type = "SUBMIT" Then oForm.elements(x).click() End If End If Next Next i I'm now trying this page https://www.paypal.com/uk/cgi-bin/webscr?cmd=_history&nav=0.3.0 Which is the history page, which allows you to search on the paypal transaction id. Unfortunately you need to click on 'find a transaction' which then uses some javascript to shows the post fields. So the problem is that the fields I need to use are hidden. How can I click on this java link in code ?

    Read the article

  • how to run click function after default behaviour of a element

    - by Somebody is in trouble
    My code <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=iso-8859-1" /> <title>Untitled Document</title> <script src="jquery.js"></script> <script> $(function(){ $("body").on("click",".mes_sel",function(){ if($(".mes_sel:checked").length==0){ alert("Checked"); } else alert("Not Checked"); }); }); </script></head> <body> <input type="checkbox" class="mes_sel"> </body> </html> It is alerting checked when the textbox is unchecked because onclick is running before the checking of checkbox.How can i make the click event to run after checking/unchecking of the input

    Read the article

  • jquery animate from object center

    - by mtwallet
    Hi. I am trying to create a product viewer similar to the one at the bottom of this page http://www.logitech.com/en-gb/. As you can see the product animates from the center rather than top left which I think is Jquery's default. So what I am doing is trying animate the width and height and then also the offset to make it look like it animates from the center. My code looks like this: <style> body { background: black; } .box { background: #fff url('pic.jpg') no-repeat 0 0; width: 200px; height: 200px; margin: 10px 4%; float: left; } </style> <script type="text/javascript"> $(document).ready(function() { $(".box").hover(function() { $(".box").not(this).fadeTo(500, 0.5); $(this).animate({ width: 300, height: 300, left: -100, top: -100 }, 500); }, function() { $(this).animate({ width: 200, height: 200, left: 100, top: 100 }, 500); $(".box").fadeTo(500, 1); }); }); </script> I cannot seem to get this working as I want. Can anyone help with this or suggest a better technique? Many thanks

    Read the article

  • Testing approach for multi-threaded software

    - by Shane MacLaughlin
    I have a piece of mature geospatial software that has recently had areas rewritten to take better advantage of the multiple processors available in modern PCs. Specifically, display, GUI, spatial searching, and main processing have all been hived off to seperate threads. The software has a pretty sizeable GUI automation suite for functional regression, and another smaller one for performance regression. While all automated tests are passing, I'm not convinced that they provide nearly enough coverage in terms of finding bugs relating race conditions, deadlocks, and other nasties associated with multi-threading. What techniques would you use to see if such bugs exist? What techniques would you advocate for rooting them out, assuming there are some in there to root out? What I'm doing so far is running the GUI functional automation on the app running under a debugger, such that I can break out of deadlocks and catch crashes, and plan to make a bounds checker build and repeat the tests against that version. I've also carried out a static analysis of the source via PC-Lint with the hope of locating potential dead locks, but not had any worthwhile results. The application is C++, MFC, mulitple document/view, with a number of threads per doc. The locking mechanism I'm using is based on an object that includes a pointer to a CMutex, which is locked in the ctor and freed in the dtor. I use local variables of this object to lock various bits of code as required, and my mutex has a time out that fires my a warning if the timeout is reached. I avoid locking where possible, using resource copies where possible instead. What other tests would you carry out?

    Read the article

  • What makes good web form styling for business applications?

    - by ProfK
    Styling forms (form elements) is something that even Eric Meyer prefers to avoid. However, most business forms, and that is where styling is at issue; 'contact us' forms are easy to style, put window estate at a premium, with more 'document level' (e.g. invoice) fields, plus 'detail level' (e.g. invoice line) fields. Factors I often find at play are: At my minimum, at least two horizontally adjacent fieldsets are required. In applications vs. public web pages, fixed positioning vs fluid layout is often better. Quantity of content is important, vs. exaggerated readability. Users know the system, and cues etc. take a back seat. In light of factors like these, is there any available guidence for styling web form based applications? Are there any CSS or JavaScript frameworks that would make my quest to style these applications better than Visual Studios still pathetic 'Auto-format' (what drugs were those people on? I will never take them.)

    Read the article

  • Solr/Lucene Scorer

    - by TFor
    We are currently working on a proof-of-concept for a client using Solr and have been able to configure all the features they want except the scoring. Problem is that they want scores that make results fall in buckets: Bucket 1: exact match on category (score = 4) Bucket 2: exact match on name (score = 3) Bucket 3: partial match on category (score = 2) Bucket 4: partial match on name (score = 1) First thing we did was develop a custom similarity class that would return the correct score depending on the field and an exact or partial match. The only problem now is that when a document matches on both the category and name the scores are added together. Example: searching for "restaurant" returns documents in the category restaurant that also have the word restaurant in their name and thus get a score of 5 (4+1) but they should only get 4. I assume for this to work we would need to develop a custom Scorer class but we have no clue on how to incorporate this in Solr. Another option is to create a custom SortField implementation similar to the RandomSortField already present in Solr. Maybe there is even a simpler solution that we don't know about. All suggestions welcome!

    Read the article

< Previous Page | 489 490 491 492 493 494 495 496 497 498 499 500  | Next Page >