Search Results

Search found 14506 results on 581 pages for 'document scanner'.

Page 493/581 | < Previous Page | 489 490 491 492 493 494 495 496 497 498 499 500  | Next Page >

  • Lights off effect and jquery placement on wordpress

    - by Alexander Santiago
    I'm trying to implement a lights on/off on single posts of my wordpress theme. I know that I have to put this code on my css, which I did already: #the_lights{ background-color:#000; height:1px; width:1px; position:absolute; top:0; left:0; display:none; } #standout{ padding:5px; background-color:white; position:relative; z-index:1000; } Now this is the code that I'm having trouble with: function getHeight() { if ($.browser.msie) { var $temp = $("").css("position", "absolute") .css("left", "-10000px") .append($("body").html()); $("body").append($temp); var h = $temp.height(); $temp.remove(); return h; } return $("body").height(); } $(document).ready(function () { $("#the_lights").fadeTo(1, 0); $("#turnoff").click(function () { $("#the_lights").css("width", "100%"); $("#the_lights").css("height", getHeight() + "px"); $("#the_lights").css({‘display’: ‘block’ }); $("#the_lights").fadeTo("slow", 1); }); $("#soft").click(function () { $("#the_lights").css("width", "100%"); $("#the_lights").css("height", getHeight() + "px"); $("#the_lights").css("display", "block"); $("#the_lights").fadeTo("slow", 0.8); }); $("#turnon").click(function () { $("#the_lights").css("width", "1px"); $("#the_lights").css("height", "1px"); $("#the_lights").css("display", "block"); $("#the_lights").fadeTo("slow", 0); }); }); I think it's a jquery. Where do I place it and how do I call it's function? Been stuck on this thing for 6 hours now and any help would be greatly appreciated...

    Read the article

  • Any solution to IE8 bug rendering error when hiding elements?

    - by Magnar
    Bug: when hiding an element with JavaScript in IE8, the margin of still-visible other elements on the side is ignored. This bug has been introduced with IE8, since it works as expected in IE6+7 (and other browsers). <html> <head> <style> #a, #b, #c, #d {background: #ccf; padding: 4px; margin-bottom: 8px;} </style> </head> <body> <div id="a">a</div> <div id="b">b</div> <div id="c">c</div> <div id="d">d</div> <script> setTimeout(function () { document.getElementById("b").style.display = "none"; }, 1000); </script> </body> </html> When running this code, notice how a and c have a margin of 8 between them in normal browsers, but a margin of 0 in IE8. Remove the padding, and IE8 behaves like normal. Remove the timeout and IE8 behaves like normal. A border behaves the same way. I've been working with IE-bugs the last 10 years, but this has me stumped. The solution for now is to wrap the divs, and apply the margin to the outer element and other styles to the inner. But that's reminicent of horrible IE6-workarounds. Any better solutions?

    Read the article

  • jQuery/ajax working on IIS5.1 but not IIS6

    - by Mikejh99
    I'm running a weird issue here. I have code that makes jquery ajax calls to a web service and dynamically adds controls using jquery. Everything works fine on my dev machine running IIS 5.1, but not when deployed to IIS 6. I'm using VS2010/ASP.Net 4.0, C#, jQuery 1.4.2 and jQuery UI 1.8.1. I'm using the same browser for each. It partially works though. The code will add the controls to the page, but they aren't visible until I click them (they aren't visible though). I thought this was a css issue, but the styles are there too. The ajax calls look like this: $.ajax({ url: "/WebServices/AssetManager.asmx/Assets", type: "POST", datatype: "json", async: false, data: "{'q':'" + req.term + "', 'type':'Condition'}", contentType: "application/javascript; charset=utf-8", success: function (data) { res($.map(data.d, function (item) { return { label: item.Name, value: item.Name, id: item.Id, datatype: item.DataType } })) } }) Changing the content-type makes the autocomplete fail. I've quadruple checked and all the paths are correct, there is no document footer enabled in IIS, and I'm not using IIS compression. Any idea why the page will display and work properly in IIS 5 but only partially in IIS 6? (If it failed completely, that'd make more sense!). Is it a jQuery or CSS issue?

    Read the article

  • How to implement a download for dynamic files in asp.net with masterpages

    - by Tim
    Hello, the title says it all. I have seen some similar questions on SO like this or this, but either i have overlooked something or my requirement is different, neither works. My situation is following: i have a Masterpage one of its contentpage is called MasterData.aspx MasterData has an asp.net ajax tabcontainer control with one usercontrol in every tabpanel these usercontrols(f.e. MD_Customer.ascx)hold the main content(like a normal page) they all have GridViews in it and i want to provide an Excel-Export-Button What i've tried is is to use an iframe like here. But the function that adds the iframe to the document gets never called and therefore i never see the save-as-dialog. Maybe this is caused by using a MasterPage. Does somebody has an idea on how to provide a button in an UpdatePanel that causes an async postback, so that i can generate a CSV dynamically in codebehind and write it to the response? Thank you in advance. aspx-markup: <asp:UpdatePanel ID="UpdGridInfo" runat="server" > <ContentTemplate> <asp:Label ID="LblInfo" Font-Underline="false" runat="server" CssClass="content" ></asp:Label>&nbsp;&nbsp; <asp:ImageButton ToolTip="export to Excel" style="vertical-align:bottom" ID="BtnExcelExport" ImageUrl="~/images/excel2007logo.png" runat="server" /> </ContentTemplate> </asp:UpdatePanel> and the BtnExportExcel codebehind handler(of course it cannot work to write the csv to the response of this page): Private Sub BtnExcelExport_Click(ByVal sender As Object, ByVal e As System.Web.UI.ImageClickEventArgs) Handles BtnExcelExport.Click Dim csv As String = tableToCsv(DirectCast(Me.GridSource, DataTable)) Response.AddHeader("Content-disposition", "attachment; filename=RuleConfigurationFile.csv") Response.ContentType = "application/octet-stream" Response.Write(csv) Response.End() End Sub

    Read the article

  • Jquery cant get facebox working inside ajax call

    - by John
    From my main page I call an ajax file via jquery, in that ajax file is some additional jquery code. Original link looks like this: <a href="/page1.php" class="guest-action notify-function"><img src="/icon1.png"></a> Then the code: $(document).ready(function(){ $('a[rel*=facebox]').facebox(); $('.guest-action').click( function() { $.get( $(this).attr('href'), function(responseText) { $.jGrowl(responseText); }); return false; }); $('.notify-function').click( function() { $(this).find('img').attr('src','/icon2.png'); $(this).attr('href','/page2.php'); $(this).removeClass('guest-action').removeClass('notify-function').attr('rel','facebox'); }); }); So basically after notify-function is clicked I am changing the icon and the url of the link, I then am removing the classes so that the click wont be ran again and add rel="facebox" to the link so that the facebox window will pop up if they try to click the new icon2.png that shows up. The problem is after I click the initial icon everything works just fine except when I try to click the new icon2.png it still executes the jgrowl code from the guest-action. But when I view the source it shows this: <a href="/page2.php" rel="facebox" class=""><img src="/icon2.png"></a> So it seemed that should work right? What am I doing wrong? I tried adding the facebox code to the main page that is calling the ajax file as well and still same issue.

    Read the article

  • pdf external streams in Max OS X Preview

    - by olpa
    According to the specification, a part of a PDF document can reside in an external file. An example for an image: 2 0 obj << /Type /XObject /Subtype /Image /Width 117 /Height 117 /BitsPerComponent 8 /Length 0 /ColorSpace /DeviceRGB /FFilter /DCTDecode /F (pinguine.jpg) >> stream endstream endobj I found that this functionality does work in Adobe Acrobat 5.0 for Windows (sample PDF with the image), also I managed to view this file in Adobe Acrobat Reader 8.1.3 for Mac OS X after I found the setting "Allow external content". Unfortunately, it seems that non-Adobe tools ignore the external stream feature. I hope I'm wrong, therefore ask the question: How to enable external streams in Mac OS X? (I think that all the system Mac OS X tools use the same library, therefore say "Mac OS X" instead of "Preview".) Or maybe there could be a programming hook to emulate external streams? My task is: store a big set of images (total ˜300Mb) outside of a small PDF (˜1Mb). At some moment, I want to filter PDF through a quartz filter and get a PDF with the images embedded. Any suggestions are welcome.

    Read the article

  • Question about the evolution of interaction paradigm between web server program and content provider program?

    - by smwikipedia
    Hi experts, In my opinion, web server is responsible to deliver content to client. If it is static content like pictures and static html document, web server just deliver them as bitstream directly. If it is some dynamic content that is generated during processing client's request, the web server will not generate the conetnt itself but call some external proram to genearte the content. AFAIK, this kind of dynamice content generation technologies include the following: CGI ISAPI ... And from here, I noticed that: ...In IIS 7, modules replace ISAPI filters... Is there any others? Could anyone help me complete the above list and elabrate on or show some links to their evolution? I think it would be very helpful to understand application such as IIS, TomCat, and Apache. I once wrote a small CGI program, and though it serves as a content generator, it is still nothing but a normal standalone program. I call it normal because the CGI program has a main() entry point. But with the recenetly technology like ASP.NET, I am not writing complete program, but only some class library. Why does such radical change happens? Many thanks.

    Read the article

  • Call ASP.NET 2.0 Server side code from Javascript

    - by Kannabiran
    I'm struggling with this for the past 3 days. I need to call asp.net serverside code from Javascript when the user closes the browser. I'm using the following code to accomplish this. In my asp.net form I have various validation controls. Even if there are some validation errors, When I close the form the server side code works perfectly in my development box(windows 7). But the same code doesnt work in my production environment(windows server). Does it have something to do with the Validation summary or Validation controls. The button control has Causes validation set to false. So even if there is a validation error still my form will post back. Am I correct? I suspect the form is not getting post back to the server when there is a validation error. But i'm disabling all the validation controls in the javascript before calling the button click event. Can someone throw some light on this issue. There are few blogs which suggests to use JQUERY, AJAX (Pagemethods and script manager). function ConfirmClose(e) { var evtobj = window.event ? event : e; if (evtobj == e) { //firefox if (!evtobj.clientY) { evtobj.returnValue = message; } } else { //IE if (evtobj.clientY < 0) { DisablePageValidators(); document.getElementById('<%# buttonBrowserCloseClick.ClientID %>').click(); } } } function DisablePageValidators() { if ((typeof (Page_Validators) != "undefined") && (Page_Validators != null)) { var i; for (i = 0; i < Page_Validators.length; i++) { ValidatorEnable(Page_Validators[i], false); } } } //HTML <div style="display:none" > <asp:Button ID="buttonBrowserCloseClick" runat="server" onclick="buttonBrowserCloseClick_Click" Text="Button" Width="141px" CausesValidation="False" /> //Server Code protected void buttonBrowserCloseClick_Click(object sender, EventArgs e) { //Some C# code goes here }

    Read the article

  • Can't write to dynamic iframe using jQuery

    - by Fremont Troll
    My goal is to dynamically create an iframe and write ad JavaScript into it using jQuery (e.g. Google AdSense script). My code works on Chrome, but fails intermittently in Firefox i.e. sometimes the ad script runs and renders the ad, and other times it doesn't. When it doesn't work, the script code itself shows up in the iframe. My guess is these intermittent failures occur because the iframe is not ready by the time I write to it. I have tried various iterations of *iframe_html* (my name for the function which is supposed to wait for the iframe to be ready), but no luck. Any help appreciated! PS: I have read various threads (e.g. http://stackoverflow.com/questions/205087/jquery-ready-in-a-dynamically-inserted-iframe). Just letting everyone know that I've done my research on this, but I'm stuck :) Iteration 1: function iframe_html(html){ $('<iframe name ="myiframe" id="myiframe"/>').appendTo('#maindiv'); $('#myiframe').load( function(){ $('#myiframe').ready( function(){ var d = $("#myiframe")[0].contentWindow.document; d.open(); d.close(); d.write(html); }); } ); }; Iteration 2: function iframe_html(html){ $('<iframe id="myiframe"/>').appendTo('#maindiv').ready( function(){ $("#myiframe").contents().get(0).write(html); } ); };

    Read the article

  • How to make HTML layout whitespace-agnostic?

    - by ssg
    If you have consecutive inline-blocks white-space becomes significant. It adds some level of space between elements. What's the "correct" way of avoiding whitespace effect to HTML layout if you want those blocks to look stuck to each other? Example: <span>a</span> <span>b</span> This renders differently than: <span>a</span><span>b</span> because of the space inbetween. I want whitespace-effect to go away without compromising HTML source code layout. I want my HTML templates to stay clean and well-indented. I think these options are ugly: 1) Tweaking text-indent, margin, padding etc. (Because it would be dependent on font-size, default white-space width etc) 2) Putting everything on a single line, next to each other. 3) Zero font-size. That would require overriding font-size in blocks, which would otherwise be inherited. 4) Possible document-wide solutions. I want the solution to stay local for a certain block of HTML. Any ideas, any obvious points which I'm missing?

    Read the article

  • Divs, flash and doctype :(

    - by nick
    I have a web-site, that uses colorbox, it also has flash header. Everything works fine in both ff and ie. Before ive started to use colorbox, i had little div that covered small part of flash header for menu purposes. Now, since im using colorbox, i had to declare doctype, and set wmode on flash to 'opaque', in order everything to work right way.But now i cant get that little div, to appear on top of my flash header. If anyone can help me with this, please do so.... or atleast tell me what should i read : ( im will be very gratefull for any solution. current html document structure: ... all the js and css files ... heres that div's style from corresponding css file: .cell_r0_c0{position: absolute;left: 61%;width:260;height:69; background-color: #000000; vertical-align: bottom;} I think i've allready tried all the combinations of position attribute, also tried diff z-index values, and i can't get it work the way i want. Maybe ive missed something idk. Please help me :(

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • How do I use Core Data with the Cocoa Text Input system?

    - by the Joel
    Hobbyist Cocoa programmer here. Have been looking around all the usual places, but this seems relatively under-explained: I am writing something a little out of the ordinary. It is much simpler than, but similar to, a desktop publishing app. I want editable text boxes on a canvas, arbitrarily placed. This is document-based and I’d really like to use Core Data. Now, The cocoa text-handling system seems to deal with a four-class structure: NSTextStorage, NSLayoutManager, NSTextContainer and finally NSTextView. I have looked into these and know how to use them, sort of. Have been making some prototypes and it works for simple apps. The problem arrives when I get into persistency. I don't know how to, by way of Cocoa Bindings or something else, store the contents of NSTextStorage (= the actual text) in my managed object context. I have considered overriding methods pairs like -words, -setWords: in these objects. This would let me link the words to a String, which I know how to store in Core Data. However, I’d have to override any method that affects the text - and that seems a little much. Thankful for any insights.

    Read the article

  • opening a new page and passing a parameter to it with Javascript

    - by recipriversexclusion
    I have a JS function that processes XML I GET from a server to dynamically create a table as below // Generate table of services by parsing the returned XML service list. function convertServiceXmlDataToTable(xml) { var tbodyElem = document.getElementById("myTbody"); var trElem, tdElem; var j = 0; $(xml).find("Service").each(function() { trElem = tbodyElem.insertRow(tbodyElem.rows.length); trElem.className = "tr" + (j % 2); // first column -> service ID var serviceID = $(this).attr("service__id"); tdElem = trElem.insertCell(trElem.cells.length); tdElem.className = "col0"; tdElem.innerHTML = serviceID; // second column -> service name tdElem = trElem.insertCell(trElem.cells.length); tdElem.className = "col1"; tdElem.innerHTML = "<a href=javascript:showServiceInfo(" + serviceID + ")>" + $(this).find("name").text() + "</a>"; j++; }); // each service } where showServiceInfo retrieves more detailed information about each service from the server based on the serviceID and displays it in the same page as the services table. So far so good. But, it turns out that I have to display the detailed service information in another page rather than the same page as the table. I have creates a generic service_info.html with an empty layout template, but I don't understand how to pass serviceID to this new page so that it gets customized with the detailed service info. How can I do this? Or, is there a better way to handle these situations? Thanks!

    Read the article

  • How can I bind a javascript dialog using Knockout?

    - by Brian
    I've got a list of data in an observableArray and I want to show it in a javascript dialog window (I'm using jQuery.blockUI if it matters). Unfortunately the dialog seems to come unbound after the page is loaded. The dialog initializes correctly (the data is displayed), but it isn't updating with changes. There are no Javascript errors and I've moved the binding to after the dialog is generated and added to the document (no effect). I've also tried calling ko.applyBinding on the main div that makes up the dialog but that, for some reason, causes part of the main page to hide (the DOM is there, but they are hidden). EDIT: I've created a project on jsfiddle that reproduces the problem. The main culprit seems to be wrapping the content of the dialog in a div. If I show the content directly it seems to work (of course I can't do that, the wrappers provide a common style for our dialogs). I'm recovering from the flu and could easily be missing something obvious, but I've been trying all day and nothing is coming to me. Any ideas?

    Read the article

  • Select ID in table ...

    - by Kris-I
    Hello, I have this code <% foreach (var item in Model.List) { %> <tr> <td><%: item.LastName %></td> <td><%: item.FirstName %></td> <td><%: item.IsEnable %></td> <td><a href="#" class="CustomerEdit">Edit</a></td> <td><a href="#" class="CustomerDetail">Detail</a></td> <td><a href="#" class="CustomerDelete">Delete</a></td> </tr> <% } %> <script language="javascript" type="text/javascript"> $(document).ready(function () { $(".CustomerEdit").click(function () { alert("blabla"); //need id here }); }); </script> It's not in the code but I have an "Item.Id", it's not place anywhere because I don't know where place it ;-). I'd like when I click on the "Edit" hyperlink get the id (item.Id) of the current line. Any idea ? Thanks,

    Read the article

  • Choosing a W3C valid DOCTYPE and charset combination?

    - by George Carter
    I have a homepage with the following: <DOCTYPE html> <meta http-equiv="Content-Type" content="text/html; charset=utf-8"> My choice of the DOCTYPE "html" is based on a recommendation for html pages using jQuery. My choice of charset=utf=8 is based on a recommendation to make my pages readable on most browsers. But these choices may be wrong. When I run this page thru the W3C HTML validator, I get messages you see below. Any way I can eliminate the 2 errors? ! Using experimental feature: HTML5 Conformance Checker. The validator checked your document with an experimental feature: HTML5 Conformance Checker. This feature has been made available for your convenience, but be aware that it may be unreliable, or not perfectly up to date with the latest development of some cutting-edge technologies. If you find any issue with this feature, please report them. Thank you. Validation Output: 2 Errors 1. Error Line 18, Column 70: Changing character encoding utf-8 and reparsing. …ntent-Type" content="text/html; charset=utf-8"> 2. Error Line 18, Column 70: Changing encoding at this point would need non-streamable behavior. …ntent-Type" content="text/html; charset=utf-8">

    Read the article

  • ASP.NET - Webservice not being called from javascript

    - by Robert
    Ok I'm stumped on this one. I've got a ASMX web service up and running. I can browse to it (~/Webservice.asmx) and see the .NET generated page and test it out.. and it works fine. I've got a page with a Script Manager with the webservice registered... and i can call it in javascript (Webservice.Method(...)) just fine. However, I want to use this Webservice as part of a jQuery Autocomplete box. So I have use the url...? and the Webservice is never being called. Here's the code. [WebService(Namespace = "http://tempuri.org/")] [WebServiceBinding(ConformsTo = WsiProfiles.BasicProfile1_1)] // To allow this Web Service to be called from script, using ASP.NET AJAX, uncomment the following line. [System.Web.Script.Services.ScriptService] public class User : System.Web.Services.WebService { public User () { //Uncomment the following line if using designed components //InitializeComponent(); } [WebMethod] public string Autocomplete(string q) { StringBuilder sb = new StringBuilder(); //doStuff return sb.ToString(); } web.config <system.web> <webServices> <protocols> <add name="HttpGet"/> <add name="HttpPost"/> </protocols> </webServices> And the HTML $(document).ready(function() { User.Autocomplete("rr", function(data) { alert(data); });//this works ("#<%=txtUserNbr.ClientID %>").autocomplete("/User.asmx/Autocomplete"); //doesn't work $.ajax({ url: "/User.asmx/Autocomplete", success: function() { alert(data); }, error: function(e) { alert(e); } }); //just to test... calls "error" function });

    Read the article

  • Create folder and insert file in Google Drive

    - by web_student
    I am trying to create a new folder in Drive and upload one (or more) files to that created folder. I use the code below, but the result is that both the folder and the file are placed in the root of my Drive. $client->setAccessToken($_SESSION['accessToken']); //create folder $folder_mime = "application/vnd.google-apps.folder"; $folder_name = 'New Folder'; $service = new Google_DriveService($client); $folder = new Google_DriveFile(); $folder->setTitle($folder_name); $folder->setMimeType($folder_mime); $service->files->insert($folder); //upload file $file_name = $_FILES["uploadFile"]["name"]; $file_mime = $_FILES["uploadFile"]["type"]; $file_path = $_FILES["uploadFile"]["tmp_name"]; $service = new Google_DriveService($client); $file = new Google_DriveFile(); $file->setParents(array($folder_name)); $file->setTitle($file_name); $file->setDescription('This is a '.$file_mime.' document'); $file->setMimeType($file_mime); $service->files->insert( $file, array( 'data' => file_get_contents($file_path) ) );

    Read the article

  • Instanced drawing with OpenGL ES 2.0

    - by Mårten Wikström
    In short: Is it possible to use the gl_InstanceID built-in variable in OpenGL ES 2.0? And, if so, how? Some more info: I want to draw multiple instances of an object using glDrawArraysInstanced and gl_InstanceID, and I want my application to run on multiple platforms, including iOS. The specification clearly says that these features require ES 3.0. According to the iOS Device Compatibility Reference ES 3.0 is only available on a few devices (those based on the A7 GPU; so iPhone 5s, but not on iPhone 5 or earlier). So my first assumption was that I needed to avoid using instanced drawing on older iOS devices. However, further down in the compatibility reference document it says that the EXT_draw_instanced extension is supported for all SGX Series 5 processors (that includes iPhone 5 and 4s). This makes me think that I could indeed use instanced drawing on older iOS devices too, by looking up and using the appropriate extension function (EXT or ARB) for glDrawArraysInstanced. I'm currently just running some test code using SDL and GLEW on Windows so I haven't tested anything on iOS yet. However, in my current setup I'm having trouble using the gl_InstanceID built-in variable in a vertex shader. I'm getting the following error message: 'gl_InstanceID' : variable is not available in current GLSL version Enabling the "draw_instanced" extension in GLSL has no effect: #extension GL_ARB_draw_instanced : enable #extension GL_EXT_draw_instanced : enable The error goes away when I specifically declare that I need ES 3.0 (GLSL 300 ES): #version 300 es Although that seem to work fine on my Windows desktop machine in an ES 2.0 context I doubt that this would work on an iPhone 5. So, shall I abandon the idea of being able to use instanced drawing on older iOS devices?

    Read the article

  • PHP with Javascript: Email confirmation script not working

    - by Josh K
    Hey Heres what i got: echo "<script type=\"text/javascript\"> function finishForm() { var answer = confirm('Are you sure these are the teams you want to enter with?'); if (answer) { if(document.getElementByID(emailconfirm).value == ".$_SESSION[Email].") { form.action=\"esubmit.php\"; form.submit(); } else { alert('E-mail address do not match'); return false; } } } function restartForm() { var answer = confirm('Are you sure you want to start over?'); if (answer) { form.action=\"e1.php\"; form.submit(); } } </script>"; I have a regular button calling this function. emailconfirm is a text input. I want to confirm that they have chosen the right teams, then check if the email in the session and the email confirmation text match. If they do match Then i want to submit the form. If they dont match, I want to alert the user they dont match, and just return to page so user can check emails and then resubmit. This script is in my header. EDIT: Haha sorry i submitted one before and it didnt go through, forgot to add my problem!! When you click the button it comes up with the confirmation, clicking either yes or no doesnt do anything. The alert doesnt pop up if they dont match and if they do match it doesnt submit. Also it might be good to note I had it without the email confirmation if statement and it worked fine (going to the submit page)

    Read the article

  • Changing html content of a div before and after ajax request

    - by R27
    I am trying to change the button "ADD" (in a div) to some text/img as soon as it is clicked. And after the ajax request is processed, in the success block , I want the div to get the button back. I see the ajax request is itself not getting processed. Can someone explain whats my mistake. I just removed the jsfiddle link and pasting the script here to avoid confusion about the dependencies. JS script var ajax_load = "Please wait..."; jQuery(document).ready(function($) { $("#add_button").click(function(event){ var st = $("#add_div").html(); $("#add_div").html(ajax_load); $("#sform").validate({ errorClass: "error", submitHandler: function (form) { alert('inside submit'); $.ajax({ type: "GET", url: 'form.cgi', data: $("#sform").serialize(), success: function (msg) { alert('msg'); $("#add_div").html(st); $("#sform")[0].reset(); } }); } }); }); }); And the html piece is <form id=sform>LABEL <input id=field1 type=text> <div id="add_div"> <input type="button" value="ADD" id="add_button"> </div> </form> I have jquery.validate.min.js script included.

    Read the article

  • Add xml-stylesheet and get standalone = yes.

    - by tumba25
    The code at the bottom is what I have. I removed the creation of all tags. At the top in the xml file I get.<?xml version="1.0" encoding="UTF-8" standalone="no"?> Note that standalone is no, even thou I have it set to yes. The first question: How do I get standalone = yes? I would like to add <?xml-stylesheet type="text/xsl" href="my.stylesheet.xsl"?> at line two in the xml file. Second question: How do I do that? Some useful links? Anything? DocumentBuilderFactory dbfac = DocumentBuilderFactory.newInstance(); DocumentBuilder docBuilder = dbfac.newDocumentBuilder(); Document doc = docBuilder.newDocument(); <cut> TransformerFactory transfac = TransformerFactory.newInstance(); transfac.setAttribute("indent-number", new Integer(2)); Transformer trans = transfac.newTransformer(); trans.setOutputProperty(OutputKeys.OMIT_XML_DECLARATION, "no"); trans.setOutputProperty(OutputKeys.STANDALONE, "yes"); trans.setOutputProperty(OutputKeys.INDENT, "yes"); trans.setOutputProperty(OutputKeys.CDATA_SECTION_ELEMENTS, "name"); FileOutputStream fout = new FileOutputStream(filepath); BufferedOutputStream bout= new BufferedOutputStream(fout); trans.transform(new DOMSource(doc), new StreamResult(new OutputStreamWriter(bout, "utf-8")));

    Read the article

  • Validate a XDocument against schema without the ValidationEventHandler (for use in a HTTP handler)

    - by Vaibhav Garg
    Hi everyone, (I am new to Schema validation) Regarding the following method, System.Xml.Schema.Extensions.Validate( ByVal source As System.Xml.Linq.XDocument, ByVal schemas As System.Xml.Schema.XmlSchemaSet, ByVal validationEventHandler As System.Xml.Schema.ValidationEventHandler, ByVal addSchemaInfo As Boolean) I am using it as follows inside a IHttpHandler - Try Dim xsd As XmlReader = XmlReader.Create(context.Server.MapPath("~/App_Data/MySchema.xsd")) Dim schemas As New XmlSchemaSet() : schemas.Add("myNameSpace", xsd) : xsd.Close() myXDoxumentOdj.Validate(schemas, Function(s As Object, e As ValidationEventArgs) SchemaError(s, e, context), True) Catch ex1 As Threading.ThreadAbortException 'manage schema error' Return Catch ex As Exception 'manage other errors' End Try The handler- Function SchemaError(ByVal s As Object, ByVal e As ValidationEventArgs, ByVal c As HttpContext) As Object If c Is Nothing Then c = HttpContext.Current If c IsNot Nothing Then HttpContext.Current.Response.Write(e.Message) HttpContext.Current.Response.End() End If Return New Object() End Function This is working fine for me at present but looks very weak. I do get errors when I feed it bad XML. But i want to implement it in a more elegant way. This looks like it would break for large XML etc. Is there some way to validate without the handler so that I get the document validated in one go and then deal with errors? To me it looks Async such that the call to Validate() would pass and some non deterministic time later the handler would get called with the result/errors. Is that right? Thanks and sorry for any goofy mistakes :).

    Read the article

  • Fixed div once page is scrolled is flickering

    - by jasondavis
    I am trying to have an advertisement block/div that will be hald way down the page, once you scroll do the page to this point it will stick to the top. Here is a demo of what I am trying to do and the code I am using to do it with... http://jsfiddle.net/jasondavis/6vpA7/3/embedded/result/ In the demo it works perfectly how I am wanting it to be, however when I implement it on my live site, http://goo.gl/zuaZx it works but when you scroll down the div flickers in and out of view on each scroll or down key press. On my site to see the problem live it is the blokc on the right sidebar that says "Recommended Books" Here is the code I am using... $(document).ready( function() { $(window).scroll( function() { if ($(window).scrollTop() > $('#social-container').offset().top) $('#social').addClass('floating'); else $('#social').removeClass('floating'); } ); } );? css #social.floating { position: fixed; top: 0; }? My demo jsfiddle where it works correctly http://jsfiddle.net/jasondavis/6vpA7/3/ The only thing different on my live site is the div/id name is different. As you can see it is somewhat working on my live site except the flickering in and out of view as you scroll down the page. Anyone have any ideas why this would happen on my live site and not on my jsfiddle demo?

    Read the article

< Previous Page | 489 490 491 492 493 494 495 496 497 498 499 500  | Next Page >