Search Results

Search found 14506 results on 581 pages for 'document scanner'.

Page 493/581 | < Previous Page | 489 490 491 492 493 494 495 496 497 498 499 500  | Next Page >

  • ajax login problem

    - by rdanee
    $(document).ready(function() { $("form#login_form").submit(function() { var login_username = $('#login_username').attr('value'); var login_password = $('#login_password').attr('value'); type: "POST", $.ajax({ url: "login.php", data: "username="+ login_username +"& password="+ login_password, success: function(data){ alert(data); if (data == "ok"){ $('form#login_form').hide(function(){$('div.success').fadeIn();}); } } }); return false; }); Login.php: <?php include("settings.php"); $query = "select * from users where username = '{$_POST['login_username']}' and password = md5('{$_POST['login_password']}')"; $query = mysql_query($query, $connection); if ( mysql_num_rows($query) == 1 ) { print "ok"; $array = mysql_fetch_array($query); if ( $_POST['stay'] ) { $time = time()+2592000; } else { $time = 0; } } else { print "no"; } mysql_close($connection); ?> My problem: In the alert the message always "no" whether username/password is correct, however on the site "ok" appears when username/pw is correct. I have read the other questions in connection with this problem, but I couldn't solve the response problem from login.php with Json. Could you help me how should I response to the ajax calling? ( with a code if it is possible) Thank you very much, and sorry for questioning again.

    Read the article

  • How to make HTML layout whitespace-agnostic?

    - by ssg
    If you have consecutive inline-blocks white-space becomes significant. It adds some level of space between elements. What's the "correct" way of avoiding whitespace effect to HTML layout if you want those blocks to look stuck to each other? Example: <span>a</span> <span>b</span> This renders differently than: <span>a</span><span>b</span> because of the space inbetween. I want whitespace-effect to go away without compromising HTML source code layout. I want my HTML templates to stay clean and well-indented. I think these options are ugly: 1) Tweaking text-indent, margin, padding etc. (Because it would be dependent on font-size, default white-space width etc) 2) Putting everything on a single line, next to each other. 3) Zero font-size. That would require overriding font-size in blocks, which would otherwise be inherited. 4) Possible document-wide solutions. I want the solution to stay local for a certain block of HTML. Any ideas, any obvious points which I'm missing?

    Read the article

  • How someone using my Facebook website app can post to their pages timeline

    - by user1334414
    I have a website where businesses create content through a PHP backend system. Each time they create a new piece of content, I want it to publish to their Facebook pages timeline (not the users timeline). I have created the authenticate code: <div id="fb-root"></div> <script> window.fbAsyncInit = function() { FB.init({ appId : 'XXXXXXXXXX', status : true, cookie : true, xfbml : true, oauth : true, }); }; (function(d){ var js, id = 'facebook-jssdk'; if (d.getElementById(id)) {return;} js = d.createElement('script'); js.id = id; js.async = true; js.src = "//connect.facebook.net/en_US/all.js"; d.getElementsByTagName('head')[0].appendChild(js); }(document)); </script> <div class="fb-login-button" scope="manage_pages"> Login with Facebook </div> With manage_pages as a scope. I need to know how they can select which page they want the post to go to (if they have more than 1 page), and also how to automatically post to that pages wall when they submit the content (which is done via a PHP form). Thanks

    Read the article

  • JQuery date picker does not firing in ajax page using Rails

    - by prabu
    Hi Here I have using datepicker from JQueryUI in my public/javascript folder as effects,prototype,control,dragdrop js files. in my public folder contains jqueryui development buddle. (css,js,development-bundle) in layout/application.rhtml <%= stylesheet_link_tag 'application' %> <%=javascript_include_tag :defaults%> <%= stylesheet_link_tag '/jquery-ui/css/custom-theme/jquery-ui-1.8.1.custom.css' %> <%=javascript_include_tag "/jquery-ui/js/jquery-1.4.2.min.js"%> <%=javascript_include_tag "/jquery-ui/js/jquery-ui-1.8.1.custom.min.js"%> <script> $(document).ready(function(){ var $j=jQuery.noConflict(); $j( '#date' ).datepicker({ dateFormat: 'dd-mm-yy' }); }); </script> in home/index.rhtml <%title "Home"%> <%=link_to "Add Details" ,:action=>"add"%> <%=link_to_remote "Ajax Add Details", :update=>"add" , :url=>{ :action=>"add" }%> <div id='add' /> in home/add.rhtml <%title "Add details"%> <%form_tag :action=>"create" do%> Name : <%=text_field_tag "name" ,"",:size=>15%> DOB : <%=text_field_tag "dob","",:id=>"date"%> <%=submit_tag "Save"%> <%end%> the datepicker works when I run home/add.rhtml directly but the datepicker not work when i run ajax page home/index.rhtml Any solutions for that,????

    Read the article

  • How do I get NHibernate to work with .NET Framework 2.0?

    - by Daniel Dolz
    I can not make NHibernate 2.1 work in machines without framework 3.X (basically, windows 2000 SP4, although it happens with XP too). NHibernate doc do not mention this. Maybe you can help? I NEED to make NHibernate 2.1 work in Windows 2000 PCs, do you think this can be done? PD: DataBase is SQL 2000/2005. Error is: NHibernate.MappingException: Could not compile the mapping document: Datos.NH_VEN_ComprobanteBF.hbm.xml ---> NHibernate.HibernateException: Could not instantiate dialect class NHibernate.Dialect.MsSql2000Dialect ---> System.Reflection.TargetInvocationException: Se produjo una excepción en el destino de la invocación. ---> System.TypeInitializationException: Se produjo una excepción en el inicializador de tipo de 'NHibernate.NHibernateUtil'. ---> System.TypeLoadException: No se puede cargar el tipo 'System.DateTimeOffset' del ensamblado'mscorlib, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089'. en NHibernate.Type.DateTimeOffsetType.get_ReturnedClass() en NHibernate.NHibernateUtil..cctor() --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Dialect.Dialect..ctor() en NHibernate.Dialect.MsSql2000Dialect..ctor() --- Fin del seguimiento de la pila de la excepción interna --- en System.RuntimeTypeHandle.CreateInstance(RuntimeType type, Boolean publicOnly, Boolean noCheck, Boolean& canBeCached, RuntimeMethodHandle& ctor, Boolean& bNeedSecurityCheck) en System.RuntimeType.CreateInstanceSlow(Boolean publicOnly, Boolean fillCache) en System.RuntimeType.CreateInstanceImpl(Boolean publicOnly, Boolean skipVisibilityChecks, Boolean fillCache) en System.Activator.CreateInstance(Type type, Boolean nonPublic) en NHibernate.Bytecode.ActivatorObjectsFactory.CreateInstance(Type type) en NHibernate.Dialect.Dialect.InstantiateDialect(String dialectName) --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Dialect.Dialect.InstantiateDialect(String dialectName) en NHibernate.Dialect.Dialect.GetDialect(IDictionary`2 props) en NHibernate.Cfg.Configuration.AddValidatedDocument(NamedXmlDocument doc) --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Cfg.Configuration.LogAndThrow(Exception exception) en NHibernate.Cfg.Configuration.AddValidatedDocument(NamedXmlDocument doc) en NHibernate.Cfg.Configuration.ProcessMappingsQueue() and continues...

    Read the article

  • How can click on a java show link programatically?

    - by Jules
    I'm trying to develop a new feature for our vb.net order entry system. At the moment I provide an assisted paypal login which loops through transactions and copies the transactions. My program then looks at this data and copies it into text boxes. The operator then approves and saves the record. So my code uses IHTMLFormElement and loops round form elements and adds values. However I only really use this to log in to paypal. See my code... Dim theObject As Object = Nothing theObject = "https://www.paypal.com/cgi-bin/webscr?cmd=_login-run" WebBrowPayPal.AxWebBrowser1.Navigate2(theObject) While WebBrowPayPal.AxWebBrowser1.ReadyState <> tagREADYSTATE.READYSTATE_COMPLETE Application.DoEvents() End While Dim HtmlDoc As IHTMLDocument2 = CType(WebBrowPayPal.AxWebBrowser1.Document, IHTMLDocument2) Dim FormCol As IHTMLElementCollection = HtmlDoc.forms Dim iForms As Integer = FormCol.length Dim i As Integer Dim x As Integer For i = 0 To iForms - 1 Dim oForm As IHTMLFormElement = CType(FormCol.item(CType(i, Object), CType(i, Object)), IHTMLFormElement) For x = 0 To oForm.length - 1 If oForm.elements(x).tagname = "INPUT" Then If oForm.elements(x).name = "login_email" Then oForm.elements(x).value = "[email protected]" End If If oForm.elements(x).name = "login_password" Then oForm.elements(x).value = "mypassword" End If If oForm.elements(x).type = "submit" Or _ oForm.elements(x).type = "SUBMIT" Then oForm.elements(x).click() End If End If Next Next i I'm now trying this page https://www.paypal.com/uk/cgi-bin/webscr?cmd=_history&nav=0.3.0 Which is the history page, which allows you to search on the paypal transaction id. Unfortunately you need to click on 'find a transaction' which then uses some javascript to shows the post fields. So the problem is that the fields I need to use are hidden. How can I click on this java link in code ?

    Read the article

  • Question about the evolution of interaction paradigm between web server program and content provider program?

    - by smwikipedia
    Hi experts, In my opinion, web server is responsible to deliver content to client. If it is static content like pictures and static html document, web server just deliver them as bitstream directly. If it is some dynamic content that is generated during processing client's request, the web server will not generate the conetnt itself but call some external proram to genearte the content. AFAIK, this kind of dynamice content generation technologies include the following: CGI ISAPI ... And from here, I noticed that: ...In IIS 7, modules replace ISAPI filters... Is there any others? Could anyone help me complete the above list and elabrate on or show some links to their evolution? I think it would be very helpful to understand application such as IIS, TomCat, and Apache. I once wrote a small CGI program, and though it serves as a content generator, it is still nothing but a normal standalone program. I call it normal because the CGI program has a main() entry point. But with the recenetly technology like ASP.NET, I am not writing complete program, but only some class library. Why does such radical change happens? Many thanks.

    Read the article

  • Jquery selectors question

    - by Ben
    Hi all, I am not an expert at jquery but trying to get a menu to work. Basically, I have a menu made of up to 3 levels of nested lists. The first level has a little arrow has a background image that opens or close when opening the first level list. Any other nested lists don't need to have the background image. My script opens the menu when you click on it and is also supposed to switch the first level list from a class "inactive" to a class "active". Here is the script: $(document).ready(function(){ $("#left-navigation-holder ul.level1 li.inactive").toggle(function(){ $(this).addClass("active"); }, function () { $(this).removeClass("active"); }); $("#left-navigation-holder li a").click(function(){ menu = $(this).parent('li').children('ul'); menu.toggle(); }); }); The problem is that the toggle function also happens when clicking on second and third level lists causing the arrows to toggle even if the first level list isn't clicked on. I thought using $("#left-navigation-holder ul.level1 li.inactive").toggle would limit the function to the first level list with a class "inactive". Any help would be really appreciated. Ben

    Read the article

  • Create folder and insert file in Google Drive

    - by web_student
    I am trying to create a new folder in Drive and upload one (or more) files to that created folder. I use the code below, but the result is that both the folder and the file are placed in the root of my Drive. $client->setAccessToken($_SESSION['accessToken']); //create folder $folder_mime = "application/vnd.google-apps.folder"; $folder_name = 'New Folder'; $service = new Google_DriveService($client); $folder = new Google_DriveFile(); $folder->setTitle($folder_name); $folder->setMimeType($folder_mime); $service->files->insert($folder); //upload file $file_name = $_FILES["uploadFile"]["name"]; $file_mime = $_FILES["uploadFile"]["type"]; $file_path = $_FILES["uploadFile"]["tmp_name"]; $service = new Google_DriveService($client); $file = new Google_DriveFile(); $file->setParents(array($folder_name)); $file->setTitle($file_name); $file->setDescription('This is a '.$file_mime.' document'); $file->setMimeType($file_mime); $service->files->insert( $file, array( 'data' => file_get_contents($file_path) ) );

    Read the article

  • Lights off effect and jquery placement on wordpress

    - by Alexander Santiago
    I'm trying to implement a lights on/off on single posts of my wordpress theme. I know that I have to put this code on my css, which I did already: #the_lights{ background-color:#000; height:1px; width:1px; position:absolute; top:0; left:0; display:none; } #standout{ padding:5px; background-color:white; position:relative; z-index:1000; } Now this is the code that I'm having trouble with: function getHeight() { if ($.browser.msie) { var $temp = $("").css("position", "absolute") .css("left", "-10000px") .append($("body").html()); $("body").append($temp); var h = $temp.height(); $temp.remove(); return h; } return $("body").height(); } $(document).ready(function () { $("#the_lights").fadeTo(1, 0); $("#turnoff").click(function () { $("#the_lights").css("width", "100%"); $("#the_lights").css("height", getHeight() + "px"); $("#the_lights").css({‘display’: ‘block’ }); $("#the_lights").fadeTo("slow", 1); }); $("#soft").click(function () { $("#the_lights").css("width", "100%"); $("#the_lights").css("height", getHeight() + "px"); $("#the_lights").css("display", "block"); $("#the_lights").fadeTo("slow", 0.8); }); $("#turnon").click(function () { $("#the_lights").css("width", "1px"); $("#the_lights").css("height", "1px"); $("#the_lights").css("display", "block"); $("#the_lights").fadeTo("slow", 0); }); }); I think it's a jquery. Where do I place it and how do I call it's function? Been stuck on this thing for 6 hours now and any help would be greatly appreciated...

    Read the article

  • How to have multiple instances of jQuery plugin on single page?

    - by James Skidmore
    I'm writing a simple jQuery plugin, but I'm having trouble being able to use multiple instances on a page. For instance, here is a sample plugin to illustrate my point: (function($) { $.fn.samplePlugin = function(options) { if (typeof foo != 'undefined') { alert('Already defined!'); } else { var foo = 'bar'; } }; })(jQuery); And then if I do this: $(document).ready(function(){ $('#myDiv').samplePlugin({}); // does nothing $('#myDiv2').samplePlugion({}); // alerts "Already defined!" }); This is obviously an over-simplified example to get across the point. So my question is, how do I have two separate instances of the plugin? I'd like to be able to use it across multiple instances on the same page. I'm guessing that part of the problem might be with defining the variables in a global scope. How can I define them unique to that instance of the plugin then? Thank you for your guidance!

    Read the article

  • opening a new page and passing a parameter to it with Javascript

    - by recipriversexclusion
    I have a JS function that processes XML I GET from a server to dynamically create a table as below // Generate table of services by parsing the returned XML service list. function convertServiceXmlDataToTable(xml) { var tbodyElem = document.getElementById("myTbody"); var trElem, tdElem; var j = 0; $(xml).find("Service").each(function() { trElem = tbodyElem.insertRow(tbodyElem.rows.length); trElem.className = "tr" + (j % 2); // first column -> service ID var serviceID = $(this).attr("service__id"); tdElem = trElem.insertCell(trElem.cells.length); tdElem.className = "col0"; tdElem.innerHTML = serviceID; // second column -> service name tdElem = trElem.insertCell(trElem.cells.length); tdElem.className = "col1"; tdElem.innerHTML = "<a href=javascript:showServiceInfo(" + serviceID + ")>" + $(this).find("name").text() + "</a>"; j++; }); // each service } where showServiceInfo retrieves more detailed information about each service from the server based on the serviceID and displays it in the same page as the services table. So far so good. But, it turns out that I have to display the detailed service information in another page rather than the same page as the table. I have creates a generic service_info.html with an empty layout template, but I don't understand how to pass serviceID to this new page so that it gets customized with the detailed service info. How can I do this? Or, is there a better way to handle these situations? Thanks!

    Read the article

  • Add xml-stylesheet and get standalone = yes.

    - by tumba25
    The code at the bottom is what I have. I removed the creation of all tags. At the top in the xml file I get.<?xml version="1.0" encoding="UTF-8" standalone="no"?> Note that standalone is no, even thou I have it set to yes. The first question: How do I get standalone = yes? I would like to add <?xml-stylesheet type="text/xsl" href="my.stylesheet.xsl"?> at line two in the xml file. Second question: How do I do that? Some useful links? Anything? DocumentBuilderFactory dbfac = DocumentBuilderFactory.newInstance(); DocumentBuilder docBuilder = dbfac.newDocumentBuilder(); Document doc = docBuilder.newDocument(); <cut> TransformerFactory transfac = TransformerFactory.newInstance(); transfac.setAttribute("indent-number", new Integer(2)); Transformer trans = transfac.newTransformer(); trans.setOutputProperty(OutputKeys.OMIT_XML_DECLARATION, "no"); trans.setOutputProperty(OutputKeys.STANDALONE, "yes"); trans.setOutputProperty(OutputKeys.INDENT, "yes"); trans.setOutputProperty(OutputKeys.CDATA_SECTION_ELEMENTS, "name"); FileOutputStream fout = new FileOutputStream(filepath); BufferedOutputStream bout= new BufferedOutputStream(fout); trans.transform(new DOMSource(doc), new StreamResult(new OutputStreamWriter(bout, "utf-8")));

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • IE "Microsoft JScript runtime error: Object expected"

    - by Stephen Borg
    Hi there, I have problems with regards to javascript only when using IE. The error I am getting is "Microsoft JScript runtime error: Object expected" and I have no idea why. It is then jumping into the JQuery 1.4.2 file, without giving me a proper error message. All I am doing is simply reading on page load the raw URL, and getting a query string named Search. Using that in an AJAX call to return products and put then into a DIV. No biggies, but somehow IE is managing to blow my page up :-( Any ideas? Code as follows : <script type="text/javascript"> $(document).ready(function (e) { $('.boxLoader').show(); function getParameterByName(name) { name = name.replace(/[\[]/, "\\\[").replace(/[\]]/, "\\\]"); var regexS = "[\\?&]" + name + "=([^&#]*)"; var regex = new RegExp(regexS); var results = regex.exec(window.location.href); if (results == null) return ""; else return decodeURIComponent(results[1].replace(/\+/g, " ")); } var Search; Search = getParameterByName("search"); $('#searchCriteria').text(Search); $.get("/Handlers/processProducts.aspx", { SearchCriteria: Search }, function (data) { $('#innercontent').html(data); $('#innercontent').fadeIn(200); $('.boxLoader').fadeOut(200); }); $('#searchBox').live("click", function () { $.get("/Handlers/processProducts.aspx", { SearchCriteria: $('#searchCriteria').val() }, function (data) { $('#innercontent').html(data); $('#innercontent').fadeIn(200); $('.boxLoader').fadeOut(200); }); }); }); </script>

    Read the article

  • How can I bind a simple Javascript array to an MVC3 controller action method?

    - by Sergio Tapia
    Here is the javascript code I use to create the array and send it on it's way: <script type="text/javascript" language="javascript"> $(document).ready(function () { $("#update-cart-btn").click(function() { var items = []; $(".item").each(function () { var productKey = $(this).find("input[name='item.ProductId']").val(); var productQuantity = $(this).find("input[type='text']").val(); items[productKey] = productQuantity; }); $.ajax({ type: "POST", url: "@Url.Action("UpdateCart", "Cart")", data: items, success: function () { alert("Successfully updated your cart!"); } }); }); }); </script> The items object is properly constructed with the values I need. What data type must my object be on the backend of my controller? I tried this but the variable remains null and is not bound. [Authorize] [HttpPost] public ActionResult UpdateCart(object[] items) // items remains null. { // Some magic here. return RedirectToAction("Index"); }

    Read the article

  • Event type property lost in IE-8

    - by Channel72
    I've noticed a strange Javascript error which only seems to happen on Internet Explorer 8. Basically, on IE-8 if you have an event handler function which captures the event object in a closure, the event "type" property seems to become invalidated from within the closure. Here's a simple code snippet which reproduces the error: <html> <head> <script type = "text/javascript"> function handleClickEvent(ev) { ev = (ev || window.event); alert(ev.type); window.setTimeout(function() { alert(ev.type); // Causes error on IE-8 }, 20); } function foo() { var query = document.getElementById("query"); query.onclick = handleClickEvent; } </script> </head> <body> <input id = "query" type = "submit"> <script type = "text/javascript"> foo(); </script> </body> </html> So basically, what happens here is that within the handleClickEvent function, we have the event object ev. We call alert(ev.type) and we see the event type is "click". So far, so good. But then when we capture the event object in a closure, and then call alert(ev.type) again from within the closure, now all of a sudden Internet Explorer 8 errors, saying "Member not found" because of the expression ev.type. It seems as though the type property of the event object is mysteriously gone after we capture the event object in a closure. I tested this code snippet on Firefox, Safari and Chrome, and none of them report an error condition. But in IE-8, the event object seems to become somehow invalidated after it's captured in the closure. Question: Why is this happening in IE-8, and is there any workaround?

    Read the article

  • Jquery cant get facebox working inside ajax call

    - by John
    From my main page I call an ajax file via jquery, in that ajax file is some additional jquery code. Original link looks like this: <a href="/page1.php" class="guest-action notify-function"><img src="/icon1.png"></a> Then the code: $(document).ready(function(){ $('a[rel*=facebox]').facebox(); $('.guest-action').click( function() { $.get( $(this).attr('href'), function(responseText) { $.jGrowl(responseText); }); return false; }); $('.notify-function').click( function() { $(this).find('img').attr('src','/icon2.png'); $(this).attr('href','/page2.php'); $(this).removeClass('guest-action').removeClass('notify-function').attr('rel','facebox'); }); }); So basically after notify-function is clicked I am changing the icon and the url of the link, I then am removing the classes so that the click wont be ran again and add rel="facebox" to the link so that the facebox window will pop up if they try to click the new icon2.png that shows up. The problem is after I click the initial icon everything works just fine except when I try to click the new icon2.png it still executes the jgrowl code from the guest-action. But when I view the source it shows this: <a href="/page2.php" rel="facebox" class=""><img src="/icon2.png"></a> So it seemed that should work right? What am I doing wrong? I tried adding the facebox code to the main page that is calling the ajax file as well and still same issue.

    Read the article

  • macro collapse all in solution visual studio 2010

    - by rod
    Hi All, I found the CollapseAll macro online that has worked for me in vs2005 and vs2008. However, this half way works in vs2010. It looks like it only collapses the top nodes and not any subnodes that may be expanded? any ideas? Thanks, rod. Sub CollapseAll() ' Get the the Solution Explorer tree Dim UIHSolutionExplorer As UIHierarchy UIHSolutionExplorer = DTE.Windows.Item(Constants.vsext_wk_SProjectWindow).Object() ' Check if there is any open solution If (UIHSolutionExplorer.UIHierarchyItems.Count = 0) Then ' MsgBox("Nothing to collapse. You must have an open solution.") Return End If ' Get the top node (the name of the solution) Dim UIHSolutionRootNode As UIHierarchyItem UIHSolutionRootNode = UIHSolutionExplorer.UIHierarchyItems.Item(1) UIHSolutionRootNode.DTE.SuppressUI = True ' Collapse each project node Dim UIHItem As UIHierarchyItem For Each UIHItem In UIHSolutionRootNode.UIHierarchyItems 'UIHItem.UIHierarchyItems.Expanded = False If UIHItem.UIHierarchyItems.Expanded Then Collapse(UIHItem) End If Next ' Select the solution node, or else when you click ' on the solution window ' scrollbar, it will synchronize the open document ' with the tree and pop ' out the corresponding node which is probably not what you want. UIHSolutionRootNode.Select(vsUISelectionType.vsUISelectionTypeSelect) UIHSolutionRootNode.DTE.SuppressUI = False End Sub Private Sub Collapse(ByVal item As UIHierarchyItem) For Each eitem As UIHierarchyItem In item.UIHierarchyItems If eitem.UIHierarchyItems.Expanded AndAlso eitem.UIHierarchyItems.Count > 0 Then Collapse(eitem) End If Next item.UIHierarchyItems.Expanded = False End Sub End Module

    Read the article

  • Can someone tell me why this JavaScript code isn't lining up an array in order?

    - by DarkLightA
    Live code: http://jsfiddle.net/fCUZC/ //INPUT ARRAY: var input = [28,32,21,11,8,2,14,32,64]; //VARIABLE DECLARATION. a = highest number so far, b = position of that number entireLoop: for (var i = 1; i<=input.length; i++) { if(input[i] > input[i-1]) { for(var o = i; o>=0; o--) { if(input[i-1] > input[o]) { input.splice(i,0,input[o]); input.splice((o+1),1); continue entireLoop; } else if(input[o] > input[0]) { input.splice(0,0,input[o]); input.splice((o+1),1); continue entireLoop; } } } } document.write(input); I'm trying to order the array from largest to smallest, but there's a 32 stuck somewhere. I know there's the sort method, but I'm a newbie and want to try this for myself.

    Read the article

  • 'send' button error 401

    - by jjd
    I'm having a strange error with 'Send' button I have the following code on my page <div id="fb-root"></div> <script type="text/javascript"> (function(d, s, id) { var js, fjs = d.getElementsByTagName(s)[0]; if (d.getElementById(id)) return; js = d.createElement(s); js.id = id; js.src = "//connect.facebook.net/en_US/all.js#xfbml=1&amp;appId=<myAppId>"; fjs.parentNode.insertBefore(js, fjs); }(document, 'script', 'facebook-jssdk')); </script> <br/> <fb:like send="true" width="450" show_faces="true"></fb:like> The 'send' button works fine if I access the application via IP address, but if I use a domain name, Facebook returns The page at http://<...>.com:8080/pages/question.jsf could not be reached because the server returned status code 401. Meantime 'like' button works fine. The application front-end is built with JSF2+Primefaces. Any ideas would be appreciated Thanks

    Read the article

  • how do I call a javacript function every 60 seconds?

    - by William
    So I'm trying to work on a Canvas demo, and I want this square to move from one side to the other, but I can't figure out how to call javascript in a way that repeats every 60 seconds. Here's what I got so far: <!DOCTYPE html> <html lang="en"> <head> <title>Canvas test</title> <meta charset="utf-8" /> <link href="/bms/style.css" rel="stylesheet" /> <style> body { text-align: center; background-color: #000000;} canvas{ background-color: #ffffff;} </style> <script type="text/javascript"> var x = 50; var y = 250; function update(){ draw(); x = x + 5; } function draw(){ var canvas = document.getElementById('screen1'); if (canvas.getContext){ var ctx = canvas.getContext('2d'); ctx.fillStyle = 'rgb(236,138,68)'; ctx.fillRect(x,y,24,24); } } </script> </head> <body onLoad="setTimeout(update(), 0);"> <canvas id="screen1" width="500" height="500"></canvas> </body> </html>

    Read the article

  • Why doesn't Javascript recognize the HTML class attribute?

    - by Cornflake
    Can anyone help me with a Javascript question, please? Why does the following code display only message boxes with the word "null" in them? And I think there are not enough of them either. <html> <head> <script type="text/javascript"> function showElementClasses(node) { var els = node.getElementsByTagName("*"); for(var i=0,j=els.length; i<j; i++) alert(els[i].getAttribute("class")); alert("Class: " + els[i].className); } showElementClasses(document); </script> </head> <body class="bla"> <div class="myclass" style="width: 500; height: 400" id="map"></div> </body> </html>

    Read the article

  • JQuery fadeIn fadeOut loop issue

    - by Tarun
    I am trying to create a jQuery fadeIn fadeout effect for my page content using the code below. $(document).ready(function (){ $("#main").click(function(){ $("#content").fadeOut(800, function(){ $("#content").load("main.html", function(){ $("#content").fadeIn(800); }); }); }); $("#gallery").click(function(){ $("#content").fadeOut(800, function(){ $("#content").load("gallery.html", function(){ $("#content").fadeIn(800); }); }); }); }); So whenever a user clicks on either the main link or gallery link, the old content fades out and new content fades in. The problem I am facing is that for every link I have to repeat the same code again and again. So I tried to use a loop to simplify this but it doesn't work. Here is my code: var p = ["#main","#gallery", "#contact"]; var q = ["main.html", "gallery.html", "contact.html"]; for (i=0;i<=(p.length-1);i++){ $(p[i]).click(function(){ $("#content").fadeOut(500, function(){ $("#content").load(q[i], function(){ $("#content").fadeIn(500); }); }); }); } It works fine when I write repeat the scripts for each link but it doesn't work when I combine them in a loop. I only get the FadeOut effect and nothing happens after that. This might be a very simple issue or may be something deep into jQuery. Any hint or help is greatly appreciated. TK

    Read the article

  • Choosing a W3C valid DOCTYPE and charset combination?

    - by George Carter
    I have a homepage with the following: <DOCTYPE html> <meta http-equiv="Content-Type" content="text/html; charset=utf-8"> My choice of the DOCTYPE "html" is based on a recommendation for html pages using jQuery. My choice of charset=utf=8 is based on a recommendation to make my pages readable on most browsers. But these choices may be wrong. When I run this page thru the W3C HTML validator, I get messages you see below. Any way I can eliminate the 2 errors? ! Using experimental feature: HTML5 Conformance Checker. The validator checked your document with an experimental feature: HTML5 Conformance Checker. This feature has been made available for your convenience, but be aware that it may be unreliable, or not perfectly up to date with the latest development of some cutting-edge technologies. If you find any issue with this feature, please report them. Thank you. Validation Output: 2 Errors 1. Error Line 18, Column 70: Changing character encoding utf-8 and reparsing. …ntent-Type" content="text/html; charset=utf-8"> 2. Error Line 18, Column 70: Changing encoding at this point would need non-streamable behavior. …ntent-Type" content="text/html; charset=utf-8">

    Read the article

< Previous Page | 489 490 491 492 493 494 495 496 497 498 499 500  | Next Page >