Search Results

Search found 14506 results on 581 pages for 'document scanner'.

Page 493/581 | < Previous Page | 489 490 491 492 493 494 495 496 497 498 499 500  | Next Page >

  • [jquery] multiple resizables acting strange

    - by Noweem
    Hi there everyone, I'm trying to place multiple resizable and draggable div's on one page that move (vertically) inside their own parent div. you can take a look at http://bit.ly/bCutBE However, these div's act really strange when I want to resize them, especially from the north side, they kind of move out of the screen very fast, while they shouldn't be able to get outside the parent div. I only want the div to be able to move and resize vertically inside it's parent, the dragging-part works pretty good, but the resize part give this problem. I can't really describe it better than this, but take a look for yourself and it will be clear immediately when you try to resize one of the coloured div's: move it a little downwards and try to resize it from the north side. the problem seems to be caused by the containment: 'parent', line of the resizable. when I delete this line it works fine, but then the coloured blocks don't stay in their parent, and I want them to stay inside their parent. I hope someone can help me with this... the jquery code I used: $(document).ready(function(){ $(".move") .draggable({ containment: 'parent', grid: [50,50], axis: 'y' }) .resizable({ containment: 'parent', grid: [50,50], handles: 'n, s', minHeight: 50 }); });

    Read the article

  • passing data from a servlet to javascript code in an Ajax application ?

    - by A.S al-shammari
    I have a simple jsp/servlet application and I want to add AJAX feature to this app. I use JQuery , but it doesn't matter what javascript framework I use. This is my code: <script type="text/javascript"> function callbackFunction(data){ $('#content').html(data); } $('document').ready(function(){ $('#x').click(function() { $.post('/ajax_2/servlet',callbackFunction) }); }); </script> <body> <a href="#" id="x">Increase it</a> <div id="content"></div> </body> </html> Servlet HttpSession session = request.getSession(); Integer myInteger = (Integer)session.getAttribute("myInteger"); if(myInteger == null) myInteger = new Integer(0); else myInteger = new Integer(myInteger+1); session.setAttribute("myInteger", myInteger); response.getWriter().println(myInteger); The Question: I use out.print to transfer data from a servlet to javascript code (ajax code) , but If I have a complex structure such as Vector of Object or something like this , what is the best way to transfer the data? what about an XML file , JSON ? Is there any special jsp/servlets library to transfer data from a servlet to ajax application ? How can I parse this data in callbackFunction ?

    Read the article

  • Embedding XSL Stylesheet into XML

    - by user700996
    I have the following XML: <?xml version="1.0" encoding="ISO-8859-1"?> <?xml-stylesheet type="text/xsl" href="http://www.fakedomain.com/sally.xsl"?> And the following content in sally.xsl: <?xml version="1.0" encoding="ISO-8859-1"?> <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:template match="/"> <html> <body> <xsl:for-each select="documentcollection/document"> <p> <xsl:for-each select="rss/channel/item"> <xsl:value-of select="title"/><br /> <xsl:value-of select="description"/><br /> <xsl:value-of select="link"/><br /> </xsl:for-each> </p> </xsl:for-each> </body> </html> </xsl:template> </xsl:stylesheet> However, the browser displays the XML as though the XSL line is not present. Do you know why the browser is ignoring the XSL stylesheet? Is the style sheet wrong? Thanks

    Read the article

  • How to make HTML layout whitespace-agnostic?

    - by ssg
    If you have consecutive inline-blocks white-space becomes significant. It adds some level of space between elements. What's the "correct" way of avoiding whitespace effect to HTML layout if you want those blocks to look stuck to each other? Example: <span>a</span> <span>b</span> This renders differently than: <span>a</span><span>b</span> because of the space inbetween. I want whitespace-effect to go away without compromising HTML source code layout. I want my HTML templates to stay clean and well-indented. I think these options are ugly: 1) Tweaking text-indent, margin, padding etc. (Because it would be dependent on font-size, default white-space width etc) 2) Putting everything on a single line, next to each other. 3) Zero font-size. That would require overriding font-size in blocks, which would otherwise be inherited. 4) Possible document-wide solutions. I want the solution to stay local for a certain block of HTML. Any ideas, any obvious points which I'm missing?

    Read the article

  • why the main method are not covered? urgent, please help me

    - by Mike.Huang
    main method: public static void main(String[] args) throws Exception { if (args.length != EXPECTED_NUMBER_OF_ARGUMENTS) { System.err.println("Usage - java XFRCompiler ConfigXML PackageXML XFR"); } String configXML = args[0]; String packageXML = args[1]; String xfr = args[2]; AutoConfigCompiler compiler = new AutoConfigCompiler(); compiler.setConfigDocument(loadDocument(configXML)); compiler.setPackageInfoDoc(loadDocument(packageXML)); // compiler.setVisiblityDoc(loadDocument("VisibilityFilter.xml")); compiler.compileModel(xfr); } private static Document loadDocument(String fileName) throws Exception { TXDOMParser parser = (TXDOMParser) ParserFactory.makeParser(TXDOMParser.class.getName()); InputSource source = new InputSource(new FileInputStream(fileName)); parser.parse(source); return parser.getDocument(); } testcase: @Test public void testCompileModel() throws Exception { // construct parameters URL configFile = Thread.currentThread().getContextClassLoader().getResource("Ford_2008_Mustang_Config.xml"); URL packageFile = Thread.currentThread().getContextClassLoader().getResource("Ford_2008_Mustang_Package.xml"); File tmpFile = new File("Ford_2008_Mustang_tmp.xfr"); if(!tmpFile.exists()) { tmpFile.createNewFile(); } String[] args = new String[]{configFile.getPath(),packageFile.getPath(),tmpFile.getPath()}; try { // test main method XFRCompiler.main(args); } catch (Exception e) { assertTrue(true); } try { // test args length is less than 3 XFRCompiler.main(new String[]{"",""}); } catch (Exception e) { assertTrue(true); } tmpFile.delete(); } coverage outputs displayed as the lines from “String configXML = args[0];" in main method are not covered

    Read the article

  • Rack, FastCGI, Lighttpd configuration

    - by zacsek
    Hi! I want to run a simple application using Rack, FastCGI and Lighttpd, but I cannot get it working. I get the following error: /usr/lib/ruby/1.8/rack/handler/fastcgi.rb:23:in `initialize': Address already in use - bind(2) (Errno::EADDRINUSE) from /usr/lib/ruby/1.8/rack/handler/fastcgi.rb:23:in `new' from /usr/lib/ruby/1.8/rack/handler/fastcgi.rb:23:in `run' from /www/test.rb:7 Here is the application: #!/usr/bin/ruby app = Proc.new do |env| [200, {'Content-Type' => 'text/plain'}, "Hello World!"] end require 'rack' Rack::Handler::FastCGI.run app, :Port => 4000 ... and the lighttpd.conf: server.modules += ( "mod_access", "mod_accesslog", "mod_fastcgi" ) server.port = 80 server.document-root = "/www" mimetype.assign = ( ".html" => "text/html", ".txt" => "text/plain", ".jpg" => "image/jpeg", ".png" => "image/png" ) index-file.names = ( "test.rb" ) fastcgi.debug = 1 fastcgi.server = ( ".rb" => (( "host" => "127.0.0.1", "port" => 4000, "bin-path" => "/www/test.rb", "check-local" => "disable", "max-procs" => 1 )) ) Can someone help me? What am I doing wrong?

    Read the article

  • Loading an FLV in Facebox with jQuery for IE7 and IE8

    - by Trip
    It goes almost without saying, this works perfectly in Chrome, Firefox, and Safari. IE (any version) being the problem. Objective: I am trying to load JWplayer which loads an FLV from S3 in a Facebox popup. jQuery(document).ready(function($) { $('a[rel*=facebox]').facebox() }) HTML (haml): %li#videoGirl = link_to 'What is HQchannel?', '#player', :rel => 'facebox' .grid_8.omega.alpha#player{:style => 'display: none;'} :javascript var so = new SWFObject('/flash/playerTrans.swf','mpl','640px','360px','0'); so.addParam('allowscriptaccess','always'); so.addParam('allowfullscreen','true'); so.addParam('wmode','transparent'); so.addVariable('file', 'http://hometownquarterlyvideos.s3.amazonaws.com/whatishqchannel.flv&autostart=true&controlbar=none&repeat=always&image=/flash/video_girl/whatishqchannel.jpg&icons=false&screencolor=none&backcolor=FFFFFF&screenalpha=0&overstretch'); so.addVariable('overstretch', 'true') so.write('player'); Problem: Despite the video being set to display: none;. It begins playing anyway. When clicking on the activation div, IE7 pops up a wrong sized blank div with a nav (params are set to not show nav and scrubber), and no buttons on the nav and srubber work. IE8 shows the right size but same behavior with nav and scrubber not working, and blank screen. My guess: I'm thinking that the problem is with the javascript not being called at the right times. It seems it's loading the facebox without the jwplayer. At least I assume. Hence the reason why the nav is there. I thinking that it did not read the javascript for that.

    Read the article

  • undefined method `key?' for nil:NilClass when using MongoMapper

    - by Radek Slupik
    I set up a new Rails application by following these instructions. I generated a new controller and added resources :tickets to the routes file. Hexapoda::Application.routes.draw do resources :tickets end This is the controller (`/app/controllers/tickets_controller.rb'). class TicketsController < ApplicationController def index @tickets = Ticket.all end end I then added a new model Ticket in /app/models/ticket.rb. class Ticket include MongoMapper::Document key :summary, String, :required => true end Here's the view (/app/views/index.html.erb): <h1>Tickets#index</h1> <p>Find me in app/views/tickets/index.html.erb</p> Now when I go to /tickets in my browser, I get an error message. NoMethodError in TicketsController#index undefined method `key?' for nil:NilClass I have no idea what's going on. What could be the problem? I'm using Rails 3.2.5 and MongoMapper 0.11.1.

    Read the article

  • add dynamic field near his parent field?

    - by Kaps Hasija
    hi in my web page i am using Add Dynamic Field Functionality by using jquery. I am adding new div bu clicking on Existing div Like <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> by clicking on parent div i am creating new daynamic div <div class="divA">DivA2 </div> its coming end of the all div's like that <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> <div class="divA">DivA2 </div> But i need along with his parent div Like that <div class="divA">divA1 </div> <div class="divA">DivA2 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> any idea Thanks. This is My Jquery Code newTextBoxDiv = $(document.createElement('div')) .attr("id", text).attr("class", 'test0 ' + text); newTextBoxDiv.html('<div style=" width:150px; class="DivA" float: left"> </div>'); } newTextBoxDiv.appendTo("#contents"); contents is id of main div

    Read the article

  • Servlet receiving data both in ISO-8859-1 and UTF-8. How to URL-decode?

    - by AJPerez
    I've a web application (well, in fact is just a servlet) which receives data from 3 different sources: Source A is a HTML document written in UTF-8, and sends the data via <form method="get">. Source B is written in ISO-8859-1, and sends the data via <form method="get">, too. Source C is written in ISO-8859-1, and sends the data via <a href="http://my-servlet-url?param=value&param2=value2&etc">. The servlet receives the request params and URL-decodes them using UTF-8. As you can expect, A works without problems, while B and C fail (you can't URL-decode in UTF-8 something that's encoded in ISO-8859-1...). I can make slight modifications to B and C, but I am not allowed to change them from ISO-8859-1 to UTF-8, which would solve all the problems. In B, I've been able to solve the problem by adding accept-charset="UTF-8" to the <form>. So the <form> sends the data in UTF-8 even with the page being ISO. What can I do to fix C? Alternatively, is there any way to determine the charset on the servlet, so I can call URL-decode with the right encoding in each case?

    Read the article

  • Convert XML to TCL Object

    - by pws5068
    Greetings, I'm new to TCL scripting, and I have a very very basic xml file which I need to import information from into tcl. Example of XML Document Structure: <object> <type>Hardware</type> <name>System Name</name> <description>Basic Description of System.</description> <attributes> <vendor>Dell</vendor> <contract>MM/DD/YY</contract> <supportExpiration>MM/DD/YY</supportExpiration> <location>Building 123</location> <serial>xxx-xxx-xxxx</serial> <mac>some-mac-address</mac> </attributes> </object> Etc... I've seen something called TCLXML but I'm not sure if this is the best route or even how to create the package to use it.. Any help will be greatly appreciated.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • calling java script function then C# function after clicking ASP.NET button

    - by Eyla
    I have this serious: I have ASP.NET page, This page contents Update panel with ASP.NET control. I have Java script function to do validation so when I click the button I will use onclientclick to call the java function to do the validation and after this one done should call then event click button function from code behind. I tried vew methods but they did not work for me. here is sample of my code that after I click the button onclientclick will call the java script function for validation and if the validation is OK should call onclick event. .................... java script function ........................ <script type="text/javascript" > function add(){ if (tag == trye) { document.getElementById('<%=btnInfor.ClientID%>').click(); alert("DataAdded") } else { alert("Requiered Field Missing.") return false; } } </script> ..................... ASP.NET button ................... <asp:Button ID="btnInfor" runat="server" Text="Add Information" Style="position: absolute; top: 1659px; left: 433px;" onclientclick="JavaScript: return myAdd()" /> .................... code behind in C# ...................... protected void btnInfor_Click(object sender, EventArgs e) { \\mycode }

    Read the article

  • Sharepoint user details not visible to other users

    - by richardoz
    I am managing a SharePoint site that uses Form Based Authentication. We have several generic lists, document libraries and active task lists that users can create update and delete. Users can use the people pickers to select/search for everyone. But the users cannot see other users names, email addresses etc. in display lists or the people pickers. If I log in as the site collection administrator, I can see everyones details. So I know the data is available. Updated details on this problem (non-administrators) SharePoint users cannot see other users information. Example: User A assigns a task to user B. User A creates a new task and uses the people picker to find user B. User B is only visible by the login name “bname” and any information about user B is not visible or searchable within the people picker. Once user B is assigned the task, user A no longer sees the name in the task list – even though user A created it. No modified by, created by, assigned to or owner field data is visible to non-administrator users. Facts: Extranet site is configured to use Forms Based Authentication. Intranet uses windows based authentication Users of both the intranet and extranet have the same problem All databases are local The site uses SSRS integration SharePoint WSS on Windows 2003 Std -- After activating the verbose logging it looks like SharePoint is definately asking SQL server for only the user info for the currently logged in user: SELECT TOP 6 /lots-of-columns/ FROM UserData INNER MERGE JOIN Docs AS t1 ON ( 1 = 1 AND UserData.[tp_RowOrdinal] = 0 AND t1.SiteId = UserData.tp_SiteId AND t1.SiteId = @L2 AND t1.DirName = UserData.tp_DirName AND t1.LeafName = UserData.tp_LeafName AND t1.Level = UserData.tp_Level AND t1.IsCurrentVersion = 1 AND (1 = 1) ) LEFT OUTER JOIN AllUserData AS t2 ON ( UserData.[tp_Author]=t2.[tp_ID] AND UserData.[tp_RowOrdinal] = 0 AND t2.[tp_RowOrdinal] = 0 AND ( (t2.tp_IsCurrent = 1) ) AND t2.[tp_CalculatedVersion] = 0 AND t2.[tp_DeleteTransactionId] = 0x AND t2.tp_ListId = @L3 AND UserData.tp_ListId = @L4 AND t2.[tp_Author]=162 /* this is the currently logged in user */ ) WHERE (UserData.tp_IsCurrent = 1) AND UserData.tp_SiteId=@L2 AND (UserData.tp_DirName=@DN) AND UserData.tp_RowOrdinal=0 AND ( ( (UserData.[datetime1] IS NULL ) OR (UserData.[datetime1] = @L5DTP) ) AND t1.SiteId=@L2 AND (t1.DirName=@DN) ) ORDER BY UserData.[tp_Modified] Desc, UserData.[tp_ID] Asc Again, any ideas would be appreciated.

    Read the article

  • How do I use Core Data with the Cocoa Text Input system?

    - by the Joel
    Hobbyist Cocoa programmer here. Have been looking around all the usual places, but this seems relatively under-explained: I am writing something a little out of the ordinary. It is much simpler than, but similar to, a desktop publishing app. I want editable text boxes on a canvas, arbitrarily placed. This is document-based and I’d really like to use Core Data. Now, The cocoa text-handling system seems to deal with a four-class structure: NSTextStorage, NSLayoutManager, NSTextContainer and finally NSTextView. I have looked into these and know how to use them, sort of. Have been making some prototypes and it works for simple apps. The problem arrives when I get into persistency. I don't know how to, by way of Cocoa Bindings or something else, store the contents of NSTextStorage (= the actual text) in my managed object context. I have considered overriding methods pairs like -words, -setWords: in these objects. This would let me link the words to a String, which I know how to store in Core Data. However, I’d have to override any method that affects the text - and that seems a little much. Thankful for any insights.

    Read the article

  • Javascript onclick() event bubbling - working or not?

    - by user1071914
    I have a table in which the table row tag is decorated with an onclick() handler. If the row is clicked anywhere, it will load another page. In one of the elements on the row, is an anchor tag which also leads to another page. The desired behavior is that if they click on the link, "delete.html" is loaded. If they click anywhere else in the row, "edit.html" is loaded. The problem is that sometimes (according to users) both the link and the onclick() are fired at once, leading to a problem in the back end code. They swear they are not double-clicking. I don't know enough about Javascript event bubbling, handling and whatever to even know where to start with this bizarre problem, so I'm asking for help. Here's a fragment of the rendered page, showing the row with the embedded link and associated script tag. Any suggestions are welcomed: <tr id="tableRow_3339_0" class="odd"> <td class="l"></td> <td>PENDING</td> <td>Yabba Dabba Doo</td> <td>Fred Flintstone</td> <td> <a href="/delete.html?requestId=3339"> <div class="deleteButtonIcon"></div> </a> </td> <td class="r"></td> </tr> <script type="text/javascript">document.getElementById("tableRow_3339_0").onclick = function(event) { window.location = '//edit.html?requestId=3339'; };</script>

    Read the article

  • php not redirecting

    - by NSchulze
    I'm trying to write the logout of a website. When I do this I want the page to redirect to the login page. I think I'm doing it the correct way, but can't get the right result. Could you guys point me in the right direction? Relevant Code: <button onclick="logout()">Logout</button> function logout() { var xmlhttp; if (window.XMLHttpRequest) {// code for IE7+, Firefox, Chrome, Opera, Safari xmlhttp=new XMLHttpRequest(); } else {// code for IE6, IE5 xmlhttp=new ActiveXObject("Microsoft.XMLHTTP"); } xmlhttp.onreadystatechange=function() { if (xmlhttp.readyState==4 && xmlhttp.status==200) { document.location=xmlhttp.responseText; } } xmlhttp.open("GET","logout.php",true); xmlhttp.send(); } <?php session_destroy(); header("Location:http://localhost:8888/loginns.html"); mysql_close($con); ?> Thanks!

    Read the article

  • Javascript JQUERY AJAX: When Are These Implemented

    - by Michael Moreno
    I'm learning javascript. Poked around this excellent site to gather intel. Keep coming across questions / answers about javascript, JQUERY, JQUERY with AJAX, javascript with JQUERY, AJAX alone. My conclusion: these are all individually powerful and useful. My confusion: how does one determine which/which combination to use ? I've concluded that javascript is readily available on most browsers. For example, I can extend a simple HTML page with <html> <body> <script type="text/javascript"> document.write("Hello World!"); </script> </body> </html> However, within the scope of Python/DJANGO, many of these questions are JQUERY and AJAX related. At which point or under what development circumstances would I conclude that javascript alone isn't going to "cut it", and I need to implement JQUERY and/or AJAX and/or some other permutation ?

    Read the article

  • jquery animate from object center

    - by mtwallet
    Hi. I am trying to create a product viewer similar to the one at the bottom of this page http://www.logitech.com/en-gb/. As you can see the product animates from the center rather than top left which I think is Jquery's default. So what I am doing is trying animate the width and height and then also the offset to make it look like it animates from the center. My code looks like this: <style> body { background: black; } .box { background: #fff url('pic.jpg') no-repeat 0 0; width: 200px; height: 200px; margin: 10px 4%; float: left; } </style> <script type="text/javascript"> $(document).ready(function() { $(".box").hover(function() { $(".box").not(this).fadeTo(500, 0.5); $(this).animate({ width: 300, height: 300, left: -100, top: -100 }, 500); }, function() { $(this).animate({ width: 200, height: 200, left: 100, top: 100 }, 500); $(".box").fadeTo(500, 1); }); }); </script> I cannot seem to get this working as I want. Can anyone help with this or suggest a better technique? Many thanks

    Read the article

  • curl post picture multipart/form-data, php cURL need help!

    - by user331071
    I'm trying to upload a picture to a specific website using php cURL but I don't really understand what parameters do I need to send because the data looks a bit weird . Here is what i got with the http analyzer Type : multipart/form-data; boundary=---------------------------182983931283 -----------------------------182983931283 Content-Disposition: form-data; name="file"; filename="Blue hills.jpg" Content-Type: image/jpeg Here appears the souce of the image itself like "ÿØÿàÿØÿàÿØÿàÿØÿàÿØÿàÿØÿà" -----------------------------182983931283 Content-Disposition: form-data; name="action" images -----------------------------182983931283 Content-Disposition: form-data; name="anonymous_email" Y -----------------------------182983931283 Content-Disposition: form-data; name="site_id" 1 -----------------------------182983931283 and so on other parameters. The issue that I have is that I don't understand what is the boundary, where do I get it from (because it doesn't appear in the html document that generates the POST and how should I make the post . If you would give me a simple example to post the above parameters to http://example.com I will definitely get the trick . Currently I'm using the following function to make the post : function processPicturesPage($title, $price, $numbedrooms, $description) { //Set the login parameters and initiate the Login process $fields = array( "changedImages" = "", "site_id" = "1", "posting_id" = "", "current_live_date" = "", "images_loaded" = "", "image_actions" = "", "title" = $title, ); foreach($fields as $key=$value) { $fields_string .= $key.'='.$value.'&'; } rtrim($fields_string,'&'); $URL = "http://www.example.com/cgi-bin/add_posting.pl"; return $this-processCurlrequest($URL, count($fields), $fields_string); } and in the processCurlrequest I have the curl options (cookies etc) and url .

    Read the article

  • updating multiple nodes in xml with xquery and xdmp:node-replace

    - by morja
    Hi all, I wnat to update an XML document in my xml database (Marklogic). I have xml as input and want to replace each node that exists in the target xml. If a node does not exist it would be great if it gets added, but thats maybe another task. My XML in the database: <user> <username>username</username> <firstname>firstname</firstname> <lastname>lastname</lastname> <email>[email protected]</email> <comment>comment</comment> </user> The value of $user_xml: <user> <firstname>new firstname</firstname> <lastname>new lastname</lastname> </user> My function so far: declare function update-user ( $username as xs:string, $user_xml as node()) as empty-sequence() { let $uri := user-uri($username) return for $node in $user_xml/user return xdmp:node-replace(fn:doc($uri)/user/fn:node-name($node), $node) }; First of all I cannot iterate over $user_xml/user. If I try to iterate over $user_xml I get "arg1 is not of type node()" exception. But maybe its the wrong approach anyway? Does anybody maybe have sample code how to do this?

    Read the article

  • jquery CSS doesn't work in webkit

    - by Mauro74
    I'm trying to apply some css to an image tag if the image is portrait, but for some reason .css() doesn't work in webkit. Basically the image tag doesn't get the 'style' property. Here's my code: $(document).ready(function () { $('.listing .item .thumb img').each(function () { var _img = $(this); var _imgWidth = _img.outerWidth(); var _imgHeight = _img.outerHeight(); if (_imgHeight > _imgWidth) { _img.css('top', '-40%'); } }); }); <div class="listing about"> <div class="item"> <a href="#" class="thumb"> <img src="../_uploads/siteassets/images/thumb-carousel-2.jpg" /> <span class="frame"></span> </a> <span class="snippet"> <a href="#" class="title">Name Surname</a> <span class="date">Role in the company</span> <p class="description">Lorem ipsum dolor sit amet...</p> </span> </div> </div> I've tried to use .attr() instead of .css() but nothing. It doesn't work! Any idea why?

    Read the article

  • how to run click function after default behaviour of a element

    - by Somebody is in trouble
    My code <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=iso-8859-1" /> <title>Untitled Document</title> <script src="jquery.js"></script> <script> $(function(){ $("body").on("click",".mes_sel",function(){ if($(".mes_sel:checked").length==0){ alert("Checked"); } else alert("Not Checked"); }); }); </script></head> <body> <input type="checkbox" class="mes_sel"> </body> </html> It is alerting checked when the textbox is unchecked because onclick is running before the checking of checkbox.How can i make the click event to run after checking/unchecking of the input

    Read the article

  • PreparedStatement question in Java against Oracle.

    - by fardon57
    Hi everyone, I'm working on the modification of some code to use preparedStatement instead of normal Statement, for security and performance reason. Our application is currently storing information into an embedded derby database, but we are going to move soon to Oracle. I've found two things that I need your help guys about Oracle and Prepared Statement : 1- I've found this document saying that Oracle doesn't handle bind parameters into IN clauses, so we cannot supply a query like : Select pokemon from pokemonTable where capacity in (?,?,?,?) Is that true ? Is there any workaround ? ... Why ? 2- We have some fields which are of type TIMESTAMP. So with our actual Statement, the query looks like this : Select raichu from pokemonTable where evolution = TO_TIMESTAMP('2500-12-31 00:00:00.000', 'YYYY-MM-DD HH24:MI:SS.FF') What should be done for a prepared Statement ? Should I put into the array of parameters : 2500-12-31 or TO_TIMESTAMP('2500-12-31 00:00:00.000', 'YYYY-MM-DD HH24:MI:SS.FF') ? Thanks for your help, I hope my questions are clear ! Regards,

    Read the article

  • How can click on a java show link programatically?

    - by Jules
    I'm trying to develop a new feature for our vb.net order entry system. At the moment I provide an assisted paypal login which loops through transactions and copies the transactions. My program then looks at this data and copies it into text boxes. The operator then approves and saves the record. So my code uses IHTMLFormElement and loops round form elements and adds values. However I only really use this to log in to paypal. See my code... Dim theObject As Object = Nothing theObject = "https://www.paypal.com/cgi-bin/webscr?cmd=_login-run" WebBrowPayPal.AxWebBrowser1.Navigate2(theObject) While WebBrowPayPal.AxWebBrowser1.ReadyState <> tagREADYSTATE.READYSTATE_COMPLETE Application.DoEvents() End While Dim HtmlDoc As IHTMLDocument2 = CType(WebBrowPayPal.AxWebBrowser1.Document, IHTMLDocument2) Dim FormCol As IHTMLElementCollection = HtmlDoc.forms Dim iForms As Integer = FormCol.length Dim i As Integer Dim x As Integer For i = 0 To iForms - 1 Dim oForm As IHTMLFormElement = CType(FormCol.item(CType(i, Object), CType(i, Object)), IHTMLFormElement) For x = 0 To oForm.length - 1 If oForm.elements(x).tagname = "INPUT" Then If oForm.elements(x).name = "login_email" Then oForm.elements(x).value = "[email protected]" End If If oForm.elements(x).name = "login_password" Then oForm.elements(x).value = "mypassword" End If If oForm.elements(x).type = "submit" Or _ oForm.elements(x).type = "SUBMIT" Then oForm.elements(x).click() End If End If Next Next i I'm now trying this page https://www.paypal.com/uk/cgi-bin/webscr?cmd=_history&nav=0.3.0 Which is the history page, which allows you to search on the paypal transaction id. Unfortunately you need to click on 'find a transaction' which then uses some javascript to shows the post fields. So the problem is that the fields I need to use are hidden. How can I click on this java link in code ?

    Read the article

< Previous Page | 489 490 491 492 493 494 495 496 497 498 499 500  | Next Page >