Search Results

Search found 14506 results on 581 pages for 'document scanner'.

Page 493/581 | < Previous Page | 489 490 491 492 493 494 495 496 497 498 499 500  | Next Page >

  • How do I use Core Data with the Cocoa Text Input system?

    - by the Joel
    Hobbyist Cocoa programmer here. Have been looking around all the usual places, but this seems relatively under-explained: I am writing something a little out of the ordinary. It is much simpler than, but similar to, a desktop publishing app. I want editable text boxes on a canvas, arbitrarily placed. This is document-based and I’d really like to use Core Data. Now, The cocoa text-handling system seems to deal with a four-class structure: NSTextStorage, NSLayoutManager, NSTextContainer and finally NSTextView. I have looked into these and know how to use them, sort of. Have been making some prototypes and it works for simple apps. The problem arrives when I get into persistency. I don't know how to, by way of Cocoa Bindings or something else, store the contents of NSTextStorage (= the actual text) in my managed object context. I have considered overriding methods pairs like -words, -setWords: in these objects. This would let me link the words to a String, which I know how to store in Core Data. However, I’d have to override any method that affects the text - and that seems a little much. Thankful for any insights.

    Read the article

  • IE "Microsoft JScript runtime error: Object expected"

    - by Stephen Borg
    Hi there, I have problems with regards to javascript only when using IE. The error I am getting is "Microsoft JScript runtime error: Object expected" and I have no idea why. It is then jumping into the JQuery 1.4.2 file, without giving me a proper error message. All I am doing is simply reading on page load the raw URL, and getting a query string named Search. Using that in an AJAX call to return products and put then into a DIV. No biggies, but somehow IE is managing to blow my page up :-( Any ideas? Code as follows : <script type="text/javascript"> $(document).ready(function (e) { $('.boxLoader').show(); function getParameterByName(name) { name = name.replace(/[\[]/, "\\\[").replace(/[\]]/, "\\\]"); var regexS = "[\\?&]" + name + "=([^&#]*)"; var regex = new RegExp(regexS); var results = regex.exec(window.location.href); if (results == null) return ""; else return decodeURIComponent(results[1].replace(/\+/g, " ")); } var Search; Search = getParameterByName("search"); $('#searchCriteria').text(Search); $.get("/Handlers/processProducts.aspx", { SearchCriteria: Search }, function (data) { $('#innercontent').html(data); $('#innercontent').fadeIn(200); $('.boxLoader').fadeOut(200); }); $('#searchBox').live("click", function () { $.get("/Handlers/processProducts.aspx", { SearchCriteria: $('#searchCriteria').val() }, function (data) { $('#innercontent').html(data); $('#innercontent').fadeIn(200); $('.boxLoader').fadeOut(200); }); }); }); </script>

    Read the article

  • PreparedStatement question in Java against Oracle.

    - by fardon57
    Hi everyone, I'm working on the modification of some code to use preparedStatement instead of normal Statement, for security and performance reason. Our application is currently storing information into an embedded derby database, but we are going to move soon to Oracle. I've found two things that I need your help guys about Oracle and Prepared Statement : 1- I've found this document saying that Oracle doesn't handle bind parameters into IN clauses, so we cannot supply a query like : Select pokemon from pokemonTable where capacity in (?,?,?,?) Is that true ? Is there any workaround ? ... Why ? 2- We have some fields which are of type TIMESTAMP. So with our actual Statement, the query looks like this : Select raichu from pokemonTable where evolution = TO_TIMESTAMP('2500-12-31 00:00:00.000', 'YYYY-MM-DD HH24:MI:SS.FF') What should be done for a prepared Statement ? Should I put into the array of parameters : 2500-12-31 or TO_TIMESTAMP('2500-12-31 00:00:00.000', 'YYYY-MM-DD HH24:MI:SS.FF') ? Thanks for your help, I hope my questions are clear ! Regards,

    Read the article

  • How can click on a java show link programatically?

    - by Jules
    I'm trying to develop a new feature for our vb.net order entry system. At the moment I provide an assisted paypal login which loops through transactions and copies the transactions. My program then looks at this data and copies it into text boxes. The operator then approves and saves the record. So my code uses IHTMLFormElement and loops round form elements and adds values. However I only really use this to log in to paypal. See my code... Dim theObject As Object = Nothing theObject = "https://www.paypal.com/cgi-bin/webscr?cmd=_login-run" WebBrowPayPal.AxWebBrowser1.Navigate2(theObject) While WebBrowPayPal.AxWebBrowser1.ReadyState <> tagREADYSTATE.READYSTATE_COMPLETE Application.DoEvents() End While Dim HtmlDoc As IHTMLDocument2 = CType(WebBrowPayPal.AxWebBrowser1.Document, IHTMLDocument2) Dim FormCol As IHTMLElementCollection = HtmlDoc.forms Dim iForms As Integer = FormCol.length Dim i As Integer Dim x As Integer For i = 0 To iForms - 1 Dim oForm As IHTMLFormElement = CType(FormCol.item(CType(i, Object), CType(i, Object)), IHTMLFormElement) For x = 0 To oForm.length - 1 If oForm.elements(x).tagname = "INPUT" Then If oForm.elements(x).name = "login_email" Then oForm.elements(x).value = "[email protected]" End If If oForm.elements(x).name = "login_password" Then oForm.elements(x).value = "mypassword" End If If oForm.elements(x).type = "submit" Or _ oForm.elements(x).type = "SUBMIT" Then oForm.elements(x).click() End If End If Next Next i I'm now trying this page https://www.paypal.com/uk/cgi-bin/webscr?cmd=_history&nav=0.3.0 Which is the history page, which allows you to search on the paypal transaction id. Unfortunately you need to click on 'find a transaction' which then uses some javascript to shows the post fields. So the problem is that the fields I need to use are hidden. How can I click on this java link in code ?

    Read the article

  • updating multiple nodes in xml with xquery and xdmp:node-replace

    - by morja
    Hi all, I wnat to update an XML document in my xml database (Marklogic). I have xml as input and want to replace each node that exists in the target xml. If a node does not exist it would be great if it gets added, but thats maybe another task. My XML in the database: <user> <username>username</username> <firstname>firstname</firstname> <lastname>lastname</lastname> <email>[email protected]</email> <comment>comment</comment> </user> The value of $user_xml: <user> <firstname>new firstname</firstname> <lastname>new lastname</lastname> </user> My function so far: declare function update-user ( $username as xs:string, $user_xml as node()) as empty-sequence() { let $uri := user-uri($username) return for $node in $user_xml/user return xdmp:node-replace(fn:doc($uri)/user/fn:node-name($node), $node) }; First of all I cannot iterate over $user_xml/user. If I try to iterate over $user_xml I get "arg1 is not of type node()" exception. But maybe its the wrong approach anyway? Does anybody maybe have sample code how to do this?

    Read the article

  • Javascript JQUERY AJAX: When Are These Implemented

    - by Michael Moreno
    I'm learning javascript. Poked around this excellent site to gather intel. Keep coming across questions / answers about javascript, JQUERY, JQUERY with AJAX, javascript with JQUERY, AJAX alone. My conclusion: these are all individually powerful and useful. My confusion: how does one determine which/which combination to use ? I've concluded that javascript is readily available on most browsers. For example, I can extend a simple HTML page with <html> <body> <script type="text/javascript"> document.write("Hello World!"); </script> </body> </html> However, within the scope of Python/DJANGO, many of these questions are JQUERY and AJAX related. At which point or under what development circumstances would I conclude that javascript alone isn't going to "cut it", and I need to implement JQUERY and/or AJAX and/or some other permutation ?

    Read the article

  • [jquery] multiple resizables acting strange

    - by Noweem
    Hi there everyone, I'm trying to place multiple resizable and draggable div's on one page that move (vertically) inside their own parent div. you can take a look at http://bit.ly/bCutBE However, these div's act really strange when I want to resize them, especially from the north side, they kind of move out of the screen very fast, while they shouldn't be able to get outside the parent div. I only want the div to be able to move and resize vertically inside it's parent, the dragging-part works pretty good, but the resize part give this problem. I can't really describe it better than this, but take a look for yourself and it will be clear immediately when you try to resize one of the coloured div's: move it a little downwards and try to resize it from the north side. the problem seems to be caused by the containment: 'parent', line of the resizable. when I delete this line it works fine, but then the coloured blocks don't stay in their parent, and I want them to stay inside their parent. I hope someone can help me with this... the jquery code I used: $(document).ready(function(){ $(".move") .draggable({ containment: 'parent', grid: [50,50], axis: 'y' }) .resizable({ containment: 'parent', grid: [50,50], handles: 'n, s', minHeight: 50 }); });

    Read the article

  • Solr/Lucene Scorer

    - by TFor
    We are currently working on a proof-of-concept for a client using Solr and have been able to configure all the features they want except the scoring. Problem is that they want scores that make results fall in buckets: Bucket 1: exact match on category (score = 4) Bucket 2: exact match on name (score = 3) Bucket 3: partial match on category (score = 2) Bucket 4: partial match on name (score = 1) First thing we did was develop a custom similarity class that would return the correct score depending on the field and an exact or partial match. The only problem now is that when a document matches on both the category and name the scores are added together. Example: searching for "restaurant" returns documents in the category restaurant that also have the word restaurant in their name and thus get a score of 5 (4+1) but they should only get 4. I assume for this to work we would need to develop a custom Scorer class but we have no clue on how to incorporate this in Solr. Another option is to create a custom SortField implementation similar to the RandomSortField already present in Solr. Maybe there is even a simpler solution that we don't know about. All suggestions welcome!

    Read the article

  • Google Charts - Adding Tooltip to Colorized Column Chart

    - by David K
    I created a column chart with google charts that has a different color assigned to each column using the following posting: Assign different color to each bar in a google chart But now I'm trying to figure out how to customize the tooltips for each column to also include the number of users in addition to the percent, so "raw_data[i][1]" I would like it to look like "70% (80 Users)" I understand that there is "data.addColumn({type:'number',role:'tooltip'});" but I'm having trouble understanding how to implement it for this use-case. function drawAccountsChart() { var data = new google.visualization.DataTable(); var raw_data = [ ['Parents', 80, 160], ['Students', 94, 128], ['Teachers', 78, 90], ['Admins', 68, 120], ['Staff', 97, 111] ]; data.addColumn('string', 'Columns'); for (var i = 0; i < raw_data.length; ++i) { data.addColumn('number', raw_data[i][0]); } data.addRows(1); for (var i = 0; i < raw_data.length; ++i) { data.setValue(0, i+1, raw_data[i][1]/raw_data[i][2]*100); } var options = { height:220, chartArea: { left:30, width: "70%", height: "70%" }, backgroundColor: { fill:"transparent" }, tooltop:{ textStyle: {fontSize: "12px",}}, vAxis: {minValue: 0} }; var formatter = new google.visualization.NumberFormat({ suffix: '%', fractionDigits: 1 }); formatter.format(data, 1); formatter.format(data, 2); formatter.format(data, 3); formatter.format(data, 4); formatter.format(data, 5); var chart = new google.visualization.ColumnChart(document.getElementById('emailAccountsChart')); chart.draw(data, options); }

    Read the article

  • jQuery UI - Sortable isn't firing?

    - by Kenny Bones
    Hi, I'm trying to get the jQuery UI sortable plugin to work and I've created a list that looks like this: <ul id="sortable"> <li>Item 1</li> <li>Item 2</li> <li>Item 3</li> <li>Item 4</li> <li>Item 5</li> </ul> And I've included the plugin script files: $(function() { $("#sortable").sortable(); alert('test'); $("#sortable").disableSelection(); }); So I just tried putting the alert box before .sortable is run and the alertbox is showing. But putting it after .sortable isn't working. Which means that .sortable is failing right? I've included the scripts and put them in the head of the html document. <script type="text/javascript" src="js/jquery.ui.core.min.js"></script> <script type="text/javascript" src="js/jquery.ui.mouse.min.js"></script> <script type="text/javascript" src="js/jquery.ui.sortable.min.js"></script> <script type="text/javascript" src="js/jquery.ui.widget.min.js"></script> Which is correct right? And the function that actually runs .sortable is in a merged js file along with all other js snippets and plugins.

    Read the article

  • Trying to fadein divs in a sequence, over time, using JQuery

    - by user346602
    Hi, I'm trying to figure out how to make 4 images fade in sequentially when the page loads. The following is my (amateurish) code: Here is the HTML: <div id="outercorners"> <img id="corner1" src="images/corner1.gif" width="6" height="6" alt=""/> <img id="corner2" src="images/corner2.gif" width="6" height="6" alt=""/> <img id="corner3" src="images/corner3.gif" width="6" height="6" alt=""/> <img id="corner4" src="images/corner4.gif" width="6" height="6" alt=""/> </div><!-- end #outercorners--> Here is the JQuery: $(document).ready(function() { $("#corner1").fadeIn("2000", function(){ $("#corner3").fadeIn("4000", function(){ $("#corner2").fadeIn("6000", function(){ $("#corner4").fadeIn("8000", function(){ }); }); }); }); Here is the css: #outercorners { position: fixed; top:186px; left:186px; width:558px; height:372px; } #corner1 { position: fixed; top:186px; left:186px; display: none; } #corner2 { position: fixed; top:186px; left:744px; display: none; } #corner3 { position: fixed; top:558px; left:744px; display: none; } #corner4 { position: fixed; top:558px; left:186px; display: none; } They seem to just wink at me, rather than fade in in the order I've ascribed to them. Should I be using the queue() function? And, if so, how would I implement it in this case? Thank you for any assistance.

    Read the article

  • jquery animate from object center

    - by mtwallet
    Hi. I am trying to create a product viewer similar to the one at the bottom of this page http://www.logitech.com/en-gb/. As you can see the product animates from the center rather than top left which I think is Jquery's default. So what I am doing is trying animate the width and height and then also the offset to make it look like it animates from the center. My code looks like this: <style> body { background: black; } .box { background: #fff url('pic.jpg') no-repeat 0 0; width: 200px; height: 200px; margin: 10px 4%; float: left; } </style> <script type="text/javascript"> $(document).ready(function() { $(".box").hover(function() { $(".box").not(this).fadeTo(500, 0.5); $(this).animate({ width: 300, height: 300, left: -100, top: -100 }, 500); }, function() { $(this).animate({ width: 200, height: 200, left: 100, top: 100 }, 500); $(".box").fadeTo(500, 1); }); }); </script> I cannot seem to get this working as I want. Can anyone help with this or suggest a better technique? Many thanks

    Read the article

  • How do I use HTML5's localStorage in a Google Chrome extension?

    - by davidkennedy85
    I am trying to develop an extension that will work with Awesome New Tab Page. I've followed the author's advice to the letter, but it doesn't seem like any of the script I add to my background page is being executed at all. Here's my background page: <script> var info = { poke: 1, width: 1, height: 1, path: "widget.html" } chrome.extension.onRequestExternal.addListener(function(request, sender, sendResponse) { if (request === "mgmiemnjjchgkmgbeljfocdjjnpjnmcg-poke") { chrome.extension.sendRequest( sender.id, { head: "mgmiemnjjchgkmgbeljfocdjjnpjnmcg-pokeback", body: info, } ); } }); function initSelectedTab() { localStorage.setItem("selectedTab", "Something"); } initSelectedTab(); </script> Here is manifest.json: { "update_url": "http://clients2.google.com/service/update2/crx", "background_page": "background.html", "name": "Test Widget", "description": "Test widget for mgmiemnjjchgkmgbeljfocdjjnpjnmcg.", "icons": { "128": "icon.png" }, "version": "0.0.1" } Here is the relevant part of widget.html: <script> var selectedTab = localStorage.getItem("selectedTab"); document.write(selectedTab); </script> Every time, the browser just displays null. The local storage isn't being set at all, which makes me think the background page is completely disconnected. Do I have something wired up incorrectly?

    Read the article

  • Problem with OnSubmit in Validation plugin in jQuery

    - by novellino
    Hello, I an quite new to jQuery and I have a problem while trying to create a form. I am using the Validation plugin for validate the email (one the form's field). When I click the Submit button I want to call my own function because I want to save the data in an XML file. This is my button: (as I understood the plugin uses "submit" for understand the button) <input type="submit" name="submit" class="submit" id="submit_btn" value="Send"/> and here is the script for the validation: <script type="text/javascript"> $(document).ready(function() { //this is my form $("#contactForm").validate(); /*save the valid data in the xml*/ $(".submit").click(function() { var email = $("input#email").val(); var subject = $("input#subject").val(); var message = $("textarea#message").val(); if (email == "" || !$("#contactForm").valid()) { return false; } var dataString = 'email='+ email + '&subject=' + subject + '&message=' + message; //alert("DATA: " +dataString); $.ajax({ type: "POST", url: "SaveData.jsp", data: dataString, success: function(data){} }); return false; }); }); </script> In general it works ok but I have two basic problems. When I click the button in the beginning having all the form empty, I get no message for the field required. Also when the data are valid and I am doing the submit, the form does not become clear after the submit. If I deleted this script code, these actions are working properly but I can not save the data! Does anyone know what is wrong? Thanks a lot!

    Read the article

  • How can I access a parent DOM from an iframe on a different domain?

    - by Dexter
    I have a website and my domain is registered through Network Solutions. I'm using their Web Forwarding feature which allows me to "mask" my domain so that when a user visits http://lucasmccoy.com they are actually seeing http://lucasmccoy.comlu.com/ through an HTML frame. The advantages of this are that the address bar still shows http://lucasmccoy.com/. The disadvantages are that I cannot directly edit the HTML page in which the frame is owned. For example, I cannot change the page title or favicon. I have tried doing it like so: $(function() { parent.document.title = 'Lucas McCoy'; }); But of course this gives me a JavaScript error: Unsafe JavaScript attempt to access frame with URL http://lucasmccoy.com/ from frame with URL http://lucasmccoy.comlu.com/. Domains, protocols and ports must match. I looked at this question attempting to do the same thing except the OP has access to the other pages HTML whereas I do not. Is there anyway in JavaScript/jQuery to make a cross-domain request to the DOM when you don't have access to that domain? Or is this something browsers just will not let happen for security reasons.

    Read the article

  • Hidden youtube player loses its methods

    - by zaius
    I'm controlling a embedded youtube chromeless player with javascript, and I want to hide it occasionally by setting display: none. However, when I show the player again, it loses its youtube methods. For example: <script> swfobject.embedSWF("http://www.youtube.com/apiplayer?enablejsapi=1&playerapiid=player", "player", "425", "356", "8", null, null, {allowScriptAccess: "always"}, {id: 'player'} ); var player = null; function onYouTubePlayerReady(playerId) { player = document.getElementById(playerId); player.addEventListener('onStateChange', 'playerStateChanged'); } function hidePlayer() { player.pauseVideo(); player.style.display = 'none'; } function showPlayer() { player.style.display = 'block'; player.playVideo(); } </script> <a href="#" onClick="hidePlayer();">hide</a> <a href="#" onClick="showPlayer();">show</a> <div id="player"></div> Calling hidePlayer followed by showPlayer gives this error on the playVideo call: Uncaught TypeError: Object #<an HTMLObjectElement> has no method 'playVideo' The only solution I can find is to use visibility: hidden, but that is messing with my page layout. Any other solutions out there?

    Read the article

  • cycle through spans on jquery click, removing the first-child

    - by jacob
    Basically, this advances to the next hidden span when clicked. The markup: <div id="facts"> <span>click to cycle</span> <span>fact 1</span> <span>fact 2</span> <span>fact 3</span> <span>fact 4</span> </div> The js: $(document).ready(function() { var current = 1; $('#facts span').click(function() { // Hide all of them $('#facts span').hide(); // Unhide the current one: $('#facts span:eq(' + (current % $('#facts span').length) + ')').show(); // Increment the variable console.log(current % 4); current++; }); // Unhide the first one on load $('#facts span:first-child').show(); });? What I'm trying to do now is remove the first span after it's been clicked, because it is not necessary for the user to see the 'click to cycle' instruction again.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • How to report progress of a JavaScript function?

    - by LambyPie
    I have a JavaScript function which is quite long and performs a number of tasks, I would like to report progress to the user by updating the contents of a SPAN element with a message as I go. I tried adding document.getElementById('spnProgress').innerText = ... statements throughout the function code. However, whilst the function is executing the UI will not update and so you only ever see the last message written to the SPAN which is not very helpful. My current solution is to break the task up into a number of functions, at the end of each I set the SPAN message and then "trigger" the next one with a window.setTimeout call with a very short delay (say 10ms). This yields control and allows the browser to repaint the SPAN with the updated message before starting the next step. However I find this very messy and difficult to follow the code, I'm thinking there must be a better way. Does anyone have any suggestions? Is there any way to force the SPAN to repaint without having to leave the context of the function? Thanks

    Read the article

  • JQuery date picker does not firing in ajax page using Rails

    - by prabu
    Hi Here I have using datepicker from JQueryUI in my public/javascript folder as effects,prototype,control,dragdrop js files. in my public folder contains jqueryui development buddle. (css,js,development-bundle) in layout/application.rhtml <%= stylesheet_link_tag 'application' %> <%=javascript_include_tag :defaults%> <%= stylesheet_link_tag '/jquery-ui/css/custom-theme/jquery-ui-1.8.1.custom.css' %> <%=javascript_include_tag "/jquery-ui/js/jquery-1.4.2.min.js"%> <%=javascript_include_tag "/jquery-ui/js/jquery-ui-1.8.1.custom.min.js"%> <script> $(document).ready(function(){ var $j=jQuery.noConflict(); $j( '#date' ).datepicker({ dateFormat: 'dd-mm-yy' }); }); </script> in home/index.rhtml <%title "Home"%> <%=link_to "Add Details" ,:action=>"add"%> <%=link_to_remote "Ajax Add Details", :update=>"add" , :url=>{ :action=>"add" }%> <div id='add' /> in home/add.rhtml <%title "Add details"%> <%form_tag :action=>"create" do%> Name : <%=text_field_tag "name" ,"",:size=>15%> DOB : <%=text_field_tag "dob","",:id=>"date"%> <%=submit_tag "Save"%> <%end%> the datepicker works when I run home/add.rhtml directly but the datepicker not work when i run ajax page home/index.rhtml Any solutions for that,????

    Read the article

  • radiobutton checked on condition in jquery

    - by RememberME
    I have the following fields: <label>Company Type:</label> <label for="primary"><input onclick="javascript: $('#sec').hide('slow');$('#primary_company').find('option:first').attr('selected','selected');" type="radio" runat="server" name="companyType" id="primary" />Primary</label> <label for="secondary"><input onclick="javascript: $('#sec').show('slow');" type="radio" runat="server" name="companyType" id="secondary" />Secondary</label> <div id="sec"> <fieldset> <label for="primary_company">Primary Company:</label> <%= Html.DropDownList("primary_company", Model.SelectPrimaryCompanies, "** Select Primary Company **") %> </fieldset> If there is a primary_company, then the secondary radio button should be selected. If there is no primary_company, then the primary radio button should be selected. Here is my jQuery: $(document).ready(function() { if ($('#primary_company').val().length > 0) { $('#secondary').attr({ checked: true }); } else { $("#primary").attr('checked', true ); $('#sec').hide(); } The sec div hides and shows properly, but a radio button is never selected. I've tried .attr('checked', 'checked') and .attr({ checked: true }) and .attr('checked', true) but nothing is ever selected.

    Read the article

  • calling java script function then C# function after clicking ASP.NET button

    - by Eyla
    I have this serious: I have ASP.NET page, This page contents Update panel with ASP.NET control. I have Java script function to do validation so when I click the button I will use onclientclick to call the java function to do the validation and after this one done should call then event click button function from code behind. I tried vew methods but they did not work for me. here is sample of my code that after I click the button onclientclick will call the java script function for validation and if the validation is OK should call onclick event. .................... java script function ........................ <script type="text/javascript" > function add(){ if (tag == trye) { document.getElementById('<%=btnInfor.ClientID%>').click(); alert("DataAdded") } else { alert("Requiered Field Missing.") return false; } } </script> ..................... ASP.NET button ................... <asp:Button ID="btnInfor" runat="server" Text="Add Information" Style="position: absolute; top: 1659px; left: 433px;" onclientclick="JavaScript: return myAdd()" /> .................... code behind in C# ...................... protected void btnInfor_Click(object sender, EventArgs e) { \\mycode }

    Read the article

  • Syntax Error? When parsing XML value

    - by Ace Munim
    I don't know if I'm having a syntax error but the compiler is giving me TypeError: 'undefined' is not an object (evaluating 'xmlDoc.getElementsByTagName("icon")[i].childNodes') Its me giving me this problem when im parsing the XML from my server, my actual javascript code is like this var xmlDoc = Obj.responseXML; var count = 0; if(xmlDoc){ while(count <= xmlDoc.getElementsByTagName("item").length){ document.getElementById("flow").innerHTML += "<div class='item'><img class='content' src='" + xmlDoc.getElementsByTagName("icon")[i].childNodes[0].nodeValue.replace(/\s+$/g,' ') +"' /></div>"; count++; } }else{ alert("Unable to parse!"); } and my XML goes like this. <feed> <item> <title>Given Title</title> <icon> http://i178.photobucket.com/albums/w255/ace003_album/Logo-ETC-RGB-e1353503652739.jpg </icon> </item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> </feed> i just want to parse the image link and to show it.

    Read the article

  • php not redirecting

    - by NSchulze
    I'm trying to write the logout of a website. When I do this I want the page to redirect to the login page. I think I'm doing it the correct way, but can't get the right result. Could you guys point me in the right direction? Relevant Code: <button onclick="logout()">Logout</button> function logout() { var xmlhttp; if (window.XMLHttpRequest) {// code for IE7+, Firefox, Chrome, Opera, Safari xmlhttp=new XMLHttpRequest(); } else {// code for IE6, IE5 xmlhttp=new ActiveXObject("Microsoft.XMLHTTP"); } xmlhttp.onreadystatechange=function() { if (xmlhttp.readyState==4 && xmlhttp.status==200) { document.location=xmlhttp.responseText; } } xmlhttp.open("GET","logout.php",true); xmlhttp.send(); } <?php session_destroy(); header("Location:http://localhost:8888/loginns.html"); mysql_close($con); ?> Thanks!

    Read the article

  • Add xml-stylesheet and get standalone = yes.

    - by tumba25
    The code at the bottom is what I have. I removed the creation of all tags. At the top in the xml file I get.<?xml version="1.0" encoding="UTF-8" standalone="no"?> Note that standalone is no, even thou I have it set to yes. The first question: How do I get standalone = yes? I would like to add <?xml-stylesheet type="text/xsl" href="my.stylesheet.xsl"?> at line two in the xml file. Second question: How do I do that? Some useful links? Anything? DocumentBuilderFactory dbfac = DocumentBuilderFactory.newInstance(); DocumentBuilder docBuilder = dbfac.newDocumentBuilder(); Document doc = docBuilder.newDocument(); <cut> TransformerFactory transfac = TransformerFactory.newInstance(); transfac.setAttribute("indent-number", new Integer(2)); Transformer trans = transfac.newTransformer(); trans.setOutputProperty(OutputKeys.OMIT_XML_DECLARATION, "no"); trans.setOutputProperty(OutputKeys.STANDALONE, "yes"); trans.setOutputProperty(OutputKeys.INDENT, "yes"); trans.setOutputProperty(OutputKeys.CDATA_SECTION_ELEMENTS, "name"); FileOutputStream fout = new FileOutputStream(filepath); BufferedOutputStream bout= new BufferedOutputStream(fout); trans.transform(new DOMSource(doc), new StreamResult(new OutputStreamWriter(bout, "utf-8")));

    Read the article

< Previous Page | 489 490 491 492 493 494 495 496 497 498 499 500  | Next Page >