Search Results

Search found 14506 results on 581 pages for 'document scanner'.

Page 492/581 | < Previous Page | 488 489 490 491 492 493 494 495 496 497 498 499  | Next Page >

  • How do I use HTML5's localStorage in a Google Chrome extension?

    - by davidkennedy85
    I am trying to develop an extension that will work with Awesome New Tab Page. I've followed the author's advice to the letter, but it doesn't seem like any of the script I add to my background page is being executed at all. Here's my background page: <script> var info = { poke: 1, width: 1, height: 1, path: "widget.html" } chrome.extension.onRequestExternal.addListener(function(request, sender, sendResponse) { if (request === "mgmiemnjjchgkmgbeljfocdjjnpjnmcg-poke") { chrome.extension.sendRequest( sender.id, { head: "mgmiemnjjchgkmgbeljfocdjjnpjnmcg-pokeback", body: info, } ); } }); function initSelectedTab() { localStorage.setItem("selectedTab", "Something"); } initSelectedTab(); </script> Here is manifest.json: { "update_url": "http://clients2.google.com/service/update2/crx", "background_page": "background.html", "name": "Test Widget", "description": "Test widget for mgmiemnjjchgkmgbeljfocdjjnpjnmcg.", "icons": { "128": "icon.png" }, "version": "0.0.1" } Here is the relevant part of widget.html: <script> var selectedTab = localStorage.getItem("selectedTab"); document.write(selectedTab); </script> Every time, the browser just displays null. The local storage isn't being set at all, which makes me think the background page is completely disconnected. Do I have something wired up incorrectly?

    Read the article

  • django-cms lighttpd redirect domain to url

    - by Robert
    Hello, I am using djano-cms for my site, but instead of language alias /en/ /de/ I need to use another domain. I would like to avoid running multiple django instances, and instead I would like to use lighttpd redirects if possible. I would like requests coming to domain2.com getting data from domain.com/en . The best would be if the user entering: domain2.com/offer got transparently data from domain.com/en/offer Tried many solutions with url.redirect, url.rewrite but none seems to work as desired. Also tried with: http://stackoverflow.com/questions/261904/matching-domains-with-regex-for-lighttpd-mod-evhost-www-domain-com-domain-com but that didn't work. Please help. This is my lighttpd configuration. $HTTP["host"] == "^domain2\.com" { url.redirect = ("^/(.*)" => "http://domain.com/en/$1") } $HTTP["host"] =~ "^domain\.com" { server.document-root = "/var/www/django/projects/domain/" accesslog.filename = "/var/log/lighttpd/domain.log-access.log" server.errorlog = "/var/log/lighttpd/www.domain-error.log" fastcgi.server = ( "/domain-service.fcgi" => ( "main" => ( "socket" => "/tmp/django-domain.sock", "check-local" => "disable", ) ), ) alias.url = ( "/media/" => "/var/www/django/projects/domain/media/", ) url.rewrite-once = ( "^(/site_media.*)$" => "$1", "^(/media.*)$" => "$1", "^/favicon\.ico$" => "/media/favicon.ico", "^(/.*)$" => "/domain-service.fcgi$1", } Thanks

    Read the article

  • Trying to fadein divs in a sequence, over time, using JQuery

    - by user346602
    Hi, I'm trying to figure out how to make 4 images fade in sequentially when the page loads. The following is my (amateurish) code: Here is the HTML: <div id="outercorners"> <img id="corner1" src="images/corner1.gif" width="6" height="6" alt=""/> <img id="corner2" src="images/corner2.gif" width="6" height="6" alt=""/> <img id="corner3" src="images/corner3.gif" width="6" height="6" alt=""/> <img id="corner4" src="images/corner4.gif" width="6" height="6" alt=""/> </div><!-- end #outercorners--> Here is the JQuery: $(document).ready(function() { $("#corner1").fadeIn("2000", function(){ $("#corner3").fadeIn("4000", function(){ $("#corner2").fadeIn("6000", function(){ $("#corner4").fadeIn("8000", function(){ }); }); }); }); Here is the css: #outercorners { position: fixed; top:186px; left:186px; width:558px; height:372px; } #corner1 { position: fixed; top:186px; left:186px; display: none; } #corner2 { position: fixed; top:186px; left:744px; display: none; } #corner3 { position: fixed; top:558px; left:744px; display: none; } #corner4 { position: fixed; top:558px; left:186px; display: none; } They seem to just wink at me, rather than fade in in the order I've ascribed to them. Should I be using the queue() function? And, if so, how would I implement it in this case? Thank you for any assistance.

    Read the article

  • Event type property lost in IE-8

    - by Channel72
    I've noticed a strange Javascript error which only seems to happen on Internet Explorer 8. Basically, on IE-8 if you have an event handler function which captures the event object in a closure, the event "type" property seems to become invalidated from within the closure. Here's a simple code snippet which reproduces the error: <html> <head> <script type = "text/javascript"> function handleClickEvent(ev) { ev = (ev || window.event); alert(ev.type); window.setTimeout(function() { alert(ev.type); // Causes error on IE-8 }, 20); } function foo() { var query = document.getElementById("query"); query.onclick = handleClickEvent; } </script> </head> <body> <input id = "query" type = "submit"> <script type = "text/javascript"> foo(); </script> </body> </html> So basically, what happens here is that within the handleClickEvent function, we have the event object ev. We call alert(ev.type) and we see the event type is "click". So far, so good. But then when we capture the event object in a closure, and then call alert(ev.type) again from within the closure, now all of a sudden Internet Explorer 8 errors, saying "Member not found" because of the expression ev.type. It seems as though the type property of the event object is mysteriously gone after we capture the event object in a closure. I tested this code snippet on Firefox, Safari and Chrome, and none of them report an error condition. But in IE-8, the event object seems to become somehow invalidated after it's captured in the closure. Question: Why is this happening in IE-8, and is there any workaround?

    Read the article

  • adding an uncertain number of fields using javascript

    - by user306472
    I'm new to javascript and a novice programmer, so this might be a really easy question to answer. I would like to loop over the values of x number of fields and add them up to display the sum in a final field. I can perform this function if I explicitly call each field, but I want to abstract this so I can deal with a flexible number of fields. Here's example code I've come up with (that's not working for me). Where am I going wrong? <html> <head> <script type="text/javascript"> function startAdd(){ interval = setInterval("addfields()",1); } function addfields(){ a = document.addition.total.value; b = getElementByTagName("sum").value; for (i=0; i<=b.length; i++){ a+=i; } return a; } function stopAdd(){ clearInterval(interval); } </script> </head> <body> <form name="addition"> <input type="text" name="sum" onFocus="startAdd();" onBlur="stopAdd;"> + <input type="text" name="sum" onFocus="startAdd();" onBlur="stopAdd;"> = <input type="text" name ="total"> </form> </body> </html>

    Read the article

  • jqtouch load content with ajax

    - by ndrizza
    I am loading this page directly inside of jqtouch. First the page shows "Loading..." Then it should execute a GET Request and refresh the content of the div ("tagcloud") as soon as it get's the content from another php file. (I prefer to load the content this way as otherwise jqtouch freezes for 2 seconds until the content is loaded and then animates to the next page.) <?php $link = $_GET['link']; ?> <div id="TagNews"> <div class="toolbar"> <h1>TagNews</h1> <a href="#" class="back">NZZ</a> </div> <div id="tagcloud">Loading...</div> <script type="text/javascript"> $.get("cloudnews2.php?link=<?php echo $link; ?>", function(data){ document.getElementById("tagcloud").innerHTML = data; }); </script> </div> Howewer, the request never gets loaded. The code is working outside of jqtouch. But inside jqtouch the GET Request doesn't work. I can't figure out why. Could you please help me to do this request?

    Read the article

  • jQuery Accordian

    - by Fuego DeBassi
    Just wondering if anyone can provide some basic advice on an accordion I'm trying to simplify. Got a working version, but it seems way overly complex. Here is my new JS. $(document).ready(function() { $("#themes li ul").hide(); $("#themes li").hover(function() { $("ul").show(); }, function() { $("li ul").hide(); }); The markup looks like this: <ul> <li>Tier 1 <ul> <li>Tier 2</li> <li>Tier 2</li> </ul> </li> <li>Tier 1 <ul> <li>Tier 2</li> <li>Tier 2</li> </ul> </li> </ul> My script works alright. But it shows all of the child ul's when any parent li is hovered, and it hide's all the child ul's when unhovered. Just not sure how I can get it to A.) Only .show the li ul when that specific li is hovered. And B.) Hide the show'n li ul only when another one is hovered (not itself). Example + explanation would be especially helpful! Thanks!!

    Read the article

  • IE "Microsoft JScript runtime error: Object expected"

    - by Stephen Borg
    Hi there, I have problems with regards to javascript only when using IE. The error I am getting is "Microsoft JScript runtime error: Object expected" and I have no idea why. It is then jumping into the JQuery 1.4.2 file, without giving me a proper error message. All I am doing is simply reading on page load the raw URL, and getting a query string named Search. Using that in an AJAX call to return products and put then into a DIV. No biggies, but somehow IE is managing to blow my page up :-( Any ideas? Code as follows : <script type="text/javascript"> $(document).ready(function (e) { $('.boxLoader').show(); function getParameterByName(name) { name = name.replace(/[\[]/, "\\\[").replace(/[\]]/, "\\\]"); var regexS = "[\\?&]" + name + "=([^&#]*)"; var regex = new RegExp(regexS); var results = regex.exec(window.location.href); if (results == null) return ""; else return decodeURIComponent(results[1].replace(/\+/g, " ")); } var Search; Search = getParameterByName("search"); $('#searchCriteria').text(Search); $.get("/Handlers/processProducts.aspx", { SearchCriteria: Search }, function (data) { $('#innercontent').html(data); $('#innercontent').fadeIn(200); $('.boxLoader').fadeOut(200); }); $('#searchBox').live("click", function () { $.get("/Handlers/processProducts.aspx", { SearchCriteria: $('#searchCriteria').val() }, function (data) { $('#innercontent').html(data); $('#innercontent').fadeIn(200); $('.boxLoader').fadeOut(200); }); }); }); </script>

    Read the article

  • JS: Why isn't this variable available to the other functions?

    - by Marius Jonsson
    Hello there, I've am trying to make a canvas animation: var context; var meter; var pin; function init() { var meter = new Image(); var pin = new Image(); var context = document.getElementById('canvas').getContext('2d'); meter.src = 'background.png'; pin.src = 'needle.png'; context.drawImage(meter,0,0); context.translate(275,297); context.save(); setTimeout(startup,500); } function startup() { var r=2; // set rpm here. var i=r*36-27; var angleInRadians = 3.14159265 * i/180; //converting degree to radian context.rotate(angleInRadians); //rotating by angle context.drawImage(pin,-250,-3); //adjusting pin center at meter center context.restore(); } You can see the script at http://www.kingoslo.com/instruments/ With firebug I get error saying that context is undefined, which I think is strange. Thanks. Kind regards, Marius

    Read the article

  • What does it mean to double license?

    - by Adrian Panasiuk
    What does it mean to double license code? I can't just put both licenses in the source files. That would mean that I mandate users to follow the rules of both of them, but the licenses will probably be contradictory (otherwise there'd be no reason to double license). I guess this is something like in cryptographic chaining, cipher = crypt_2(crypt_1(clear)) (generally) means, that cipher is neither the output of crypt_2 on clear nor the output of crypt_1 on clear. It's the output of the composition. Likewise, in double-licensing, in reality my code has one license, it's just that this new license says please follow all of the rules of license1, or all of the rules of license2, and you are hereby granted the right to redistribute this application under this "double" license, license1 or license2, or any license under which license1 or license2 allow you to redistribute this software, in which case you shall replace the relevant licensing information in this application with that of the new license. (Does this mean that before someone may use the app under license1, he has to perform the operation of redistributing to self? How would he document the fact that he did that operation?) Am I correct. What LICENSE file and what text to put in the source files would I need if I wanted to double license on, for the sake of example, Apachev2 and GPLv3 ?

    Read the article

  • How to Resolve a Transformation Service with BRE that occurs after an Orchestration in an Itinerary?

    - by Maxime Labelle
    In trying to implement simple integration patterns with Biztalk ESB Toolkit 2.0, I'm facing a problem trying to resolve a Transformation Itinerary Service that occurs after an Orchestration. I'm using the BRE Resolver to execute rules that need to inspect the Context Message Type property to determine the appropriate map to use. However, once the message reaches the step in the Itinerary associated with the Transformation Service, the map fails to execute. From careful investigation, it appears that the message type is not supplied to the "Resolution" object that is used internally by the BRE resolver. Indeed, since the message leaving the preceding Orchestration is typed System.Xml.XmlDocument, the type of the message is "demoted" from the context. By tracking rules engine execution, I can observe that the type of the message is indeed lost when reaching the BRE resolver. The type of the message is empty, whereas the strongly-typed of the document is Microsoft.XLANGs.BaseTypes.Any. The Orchestration service that I use is taken straight from the samples that ship with ESB Toolkit 2.0. Is there a way to perform Context-Based BRE resolution after an Orchestration in an Itinerary?

    Read the article

  • W3C error doc error? Output tag browser support.

    - by ThomasReggi
    Was looking at the reference page here : http://www.w3.org/TR/html5/offline.html I copied and pasted the code on my server here in separate files. All of the pages are linked correctly but the clock won't show. Just to double check, it wasn't my "server config" I put it on jsfiddle.net here: http://jsfiddle.net/reggi/Dy8PU/. Fails: MAC / FIREFOX 3.6.13 Wins: MAC / FIREFOX 4.0.b8 Is this dummy example code? <!-- clock.html --> <!DOCTYPE HTML> <html> <head> <title>Clock</title> <script src="clock.js"></script> <link rel="stylesheet" href="clock.css"> </head> <body> <p>The time is: <output id="clock"></output></p> </body> </html> /* clock.css */ output { font: 2em sans-serif; } /* clock.js */ setTimeout(function () { document.getElementById('clock').value = new Date(); }, 1000); UPDATE: The W3C code above works on only the NEWEST Beta releases of certain browsers Below are some viable current javascript workarounds

    Read the article

  • Javascript onclick() event bubbling - working or not?

    - by user1071914
    I have a table in which the table row tag is decorated with an onclick() handler. If the row is clicked anywhere, it will load another page. In one of the elements on the row, is an anchor tag which also leads to another page. The desired behavior is that if they click on the link, "delete.html" is loaded. If they click anywhere else in the row, "edit.html" is loaded. The problem is that sometimes (according to users) both the link and the onclick() are fired at once, leading to a problem in the back end code. They swear they are not double-clicking. I don't know enough about Javascript event bubbling, handling and whatever to even know where to start with this bizarre problem, so I'm asking for help. Here's a fragment of the rendered page, showing the row with the embedded link and associated script tag. Any suggestions are welcomed: <tr id="tableRow_3339_0" class="odd"> <td class="l"></td> <td>PENDING</td> <td>Yabba Dabba Doo</td> <td>Fred Flintstone</td> <td> <a href="/delete.html?requestId=3339"> <div class="deleteButtonIcon"></div> </a> </td> <td class="r"></td> </tr> <script type="text/javascript">document.getElementById("tableRow_3339_0").onclick = function(event) { window.location = '//edit.html?requestId=3339'; };</script>

    Read the article

  • Iterating Over <select> Using jQuery + Multi Select

    - by Kezzer
    This isn't quite as straight forward as one may think. I'm using a plugin called jQuery MultiSelect and multiple <select options using XSLT as follows: <xsl:for-each select="RootField"> <select id="{RootField}" multiple="multiple" size="3"> <option value=""></option> <xsl:for-each select="ChildField"> <option value="{ChildField}"><xsl:value-of select="ChildField"/></option> </xsl:for-each> </select> </xsl:for-each> The accompanying JavaScript is as follows: var selects = document.getElementsByTagName("select"); $.each(selects, function() { $(this).multiSelect(); }); This allows me to apply the multiSelect(); function to every single <select on the page. The behaviour is quite strange, every other <select is being changed into the dropdown list (all the even ones anyway). I can't see anything wrong in my JavaScript to cause this issue as it would iterate over every single one. To make it more clear, the only lists that have that JavaScript applied to it are ones in position 2, 4, 6 and 8 (out of the 9 which are on the page). Any ideas?

    Read the article

  • XSLT: Transforming into non-xml content?

    - by Ian Boyd
    Is it possible to use XSLT to transform XML into something other than XML? e.g. i want the final non-xml content: <HTML> <BODY> <IMG src="file1.png"><BR> <IMG src="file2.png"><BR> ... <IMG src="filen.png"><BR> </BODY> </HTML> You'll notice this document is HTML, because in HTML IMG and BR tags are forbidden from having a closing tag. This constrasts with xhtml, the reformulation of HTML using xml, where all elements are required from having a closing tag (because in xml every tag must be closed). Is it possible, using XSLT, to generate non-xml output? Another example of non-xml output might be: INSERT INTO Documents (Filename) VALUES ('file1.png') INSERT INTO Documents (Filename) VALUES ('file2.png') ... INSERT INTO Documents (Filename) VALUES ('file3.png') The reason i ask is that as soon as my XSLT contains an <IMG>, the stylesheet contains an error; no closing </IMG>.

    Read the article

  • cycle through spans on jquery click, removing the first-child

    - by jacob
    Basically, this advances to the next hidden span when clicked. The markup: <div id="facts"> <span>click to cycle</span> <span>fact 1</span> <span>fact 2</span> <span>fact 3</span> <span>fact 4</span> </div> The js: $(document).ready(function() { var current = 1; $('#facts span').click(function() { // Hide all of them $('#facts span').hide(); // Unhide the current one: $('#facts span:eq(' + (current % $('#facts span').length) + ')').show(); // Increment the variable console.log(current % 4); current++; }); // Unhide the first one on load $('#facts span:first-child').show(); });? What I'm trying to do now is remove the first span after it's been clicked, because it is not necessary for the user to see the 'click to cycle' instruction again.

    Read the article

  • Using javascript and php together

    - by EmmyS
    I have a PHP form that needs some very simple validation on submit. I'd rather do the validation client-side, as there's quite a bit of server-side validation that happens to deal with writing form values to a database. So I just want to call a javascript function onsubmit to compare values in two password fields. This is what I've got: function validate(form){ var password = form.password.value; var password2 = form.password2.value; alert("password:"+password+" password2:" + password2); if (password != password2) { alert("not equal"); document.getElementByID("passwordError").style.display="inline"; return false; } alert("equal"); return true; } The idea being that a default-hidden div containing an error message would be displayed if the two passwords don't match. The alerts are just to display the values of password and password2, and then again to indicate whether they match or not (will not be used in production code). I'm using an input type=submit button, and calling the function in the form tag: <form action="<?php echo $_SERVER['PHP_SELF']; ?>" method="post" onsubmit="return validate(this);"> Everything is alerting as expected when entering non-matching values. I would have hoped (and assumed, based on past use) that if the function returned false, the actual submit would not occur. And yet, it is. I'm testing by entering non-matching values in the password fields, and the alerts clearly show me the values and the not equal result, but the actual form action is still occurring and it's trying to write to my database. I'm pretty new at PHP; is there something about it that will not let me combine with javascript this way? Would it be better to use an input type=button and include submit() in the function itself if it returns true?

    Read the article

  • How to make HTML layout whitespace-agnostic?

    - by ssg
    If you have consecutive inline-blocks white-space becomes significant. It adds some level of space between elements. What's the "correct" way of avoiding whitespace effect to HTML layout if you want those blocks to look stuck to each other? Example: <span>a</span> <span>b</span> This renders differently than: <span>a</span><span>b</span> because of the space inbetween. I want whitespace-effect to go away without compromising HTML source code layout. I want my HTML templates to stay clean and well-indented. I think these options are ugly: 1) Tweaking text-indent, margin, padding etc. (Because it would be dependent on font-size, default white-space width etc) 2) Putting everything on a single line, next to each other. 3) Zero font-size. That would require overriding font-size in blocks, which would otherwise be inherited. 4) Possible document-wide solutions. I want the solution to stay local for a certain block of HTML. Any ideas, any obvious points which I'm missing?

    Read the article

  • How do I implement "cash out" on my site using PayPal?

    - by Alex
    I have a credit system set up on my site where user A can purchase a document from user B, let's say for 1 credit and user B's account gets credited, let's say for $1. User B can then "cash out" and recieve the money they earned from my (the site's) PayPal account into their PayPal account (let's assume that their email address is valid for now). When user A purchases a credit, they are taken to PayPal where they can login and complete the purchase, for this purpose I have an IPN listener set up on my site that stores credit information to my site's database. However, I can't find a mechanism to send the "cash out" information (i.e. user's email and amount to be paid) to PayPal. To elaborate: I understand that PayPal sends the IPN when someone purchases from me, but how do I post from my site to PayPal when the user clicks the "cash out" button? I have seen mention of Mass Pay, but can't seem to locate any code samples to go from. Am I missing something, or is there perhaps a different (and better) way to do this? Thanks!

    Read the article

  • Jquery click event propagation

    - by ozsenegal
    I've a table with click events bind to it rows (tr). Also,there're A elements with it owns click events assigned inside those rows. Problem is when i click on A element,it also fires click event from TD.And Im dont want this behavior,i just want to fire A click's event. Code: //Event row TR $("tr:not(:first)").click(function(){ $(".window,.backFundo,.close").remove(); var position = $(this).offset().top; position = position < 0 ? 20 : position; $("body").append($("<div></div>").addClass("backFundo")); $("body").append($("<div></div>").addClass("window").html("<span class=close><img src=Images/close.png id=fechar /></span>").append("<span class=titulo>O que deseja fazer?</span><span class=crud><a href=# id=edit>Editar</a></span><span class=crud><a href=# id=delete codigo=" + $(this).children("td:first").html() + ">Excluir</a></span>").css({top:"20px"}).fadeIn("slow")); $(document).scrollTop(0); }); //Element event $("a").live("click",function(){alert("clicked!");}); Whenever you click the anchor it fires event from it parent row.Any ideas?

    Read the article

  • jQuery Swapping Elements

    - by zuk1
    Ok let me make an example: <head> <script type="text/javascript"> $(document).ready(function(){ $("#options_2").hide(); $("#options_3").hide(); }); </script> </head> <body> <div id="options_1">option 1</div> <div id="options_2">option 2</div> <div id="options_3">option 3</div> <a href="" class="selected">choose option 1</a> <a href="">choose option 2</a> <a href="">choose option 3</a> </body> As you can see only option 1 is visible by default, and the link you click to show option 1 has the class="selected" by default, showing the user that that option is currently selected. I basically want it so that when they click "choose option 2" the options 1 div hides itself and the options 2 div shows itself, and then gives the second link the selected class and removes the class from the image link. It basically just tabs using links and divs but due to the format I have to display it in I cannot use any of the tabs plugins I have found online.

    Read the article

  • Embedding XSL Stylesheet into XML

    - by user700996
    I have the following XML: <?xml version="1.0" encoding="ISO-8859-1"?> <?xml-stylesheet type="text/xsl" href="http://www.fakedomain.com/sally.xsl"?> And the following content in sally.xsl: <?xml version="1.0" encoding="ISO-8859-1"?> <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:template match="/"> <html> <body> <xsl:for-each select="documentcollection/document"> <p> <xsl:for-each select="rss/channel/item"> <xsl:value-of select="title"/><br /> <xsl:value-of select="description"/><br /> <xsl:value-of select="link"/><br /> </xsl:for-each> </p> </xsl:for-each> </body> </html> </xsl:template> </xsl:stylesheet> However, the browser displays the XML as though the XSL line is not present. Do you know why the browser is ignoring the XSL stylesheet? Is the style sheet wrong? Thanks

    Read the article

  • curl post picture multipart/form-data, php cURL need help!

    - by user331071
    I'm trying to upload a picture to a specific website using php cURL but I don't really understand what parameters do I need to send because the data looks a bit weird . Here is what i got with the http analyzer Type : multipart/form-data; boundary=---------------------------182983931283 -----------------------------182983931283 Content-Disposition: form-data; name="file"; filename="Blue hills.jpg" Content-Type: image/jpeg Here appears the souce of the image itself like "ÿØÿàÿØÿàÿØÿàÿØÿàÿØÿàÿØÿà" -----------------------------182983931283 Content-Disposition: form-data; name="action" images -----------------------------182983931283 Content-Disposition: form-data; name="anonymous_email" Y -----------------------------182983931283 Content-Disposition: form-data; name="site_id" 1 -----------------------------182983931283 and so on other parameters. The issue that I have is that I don't understand what is the boundary, where do I get it from (because it doesn't appear in the html document that generates the POST and how should I make the post . If you would give me a simple example to post the above parameters to http://example.com I will definitely get the trick . Currently I'm using the following function to make the post : function processPicturesPage($title, $price, $numbedrooms, $description) { //Set the login parameters and initiate the Login process $fields = array( "changedImages" = "", "site_id" = "1", "posting_id" = "", "current_live_date" = "", "images_loaded" = "", "image_actions" = "", "title" = $title, ); foreach($fields as $key=$value) { $fields_string .= $key.'='.$value.'&'; } rtrim($fields_string,'&'); $URL = "http://www.example.com/cgi-bin/add_posting.pl"; return $this-processCurlrequest($URL, count($fields), $fields_string); } and in the processCurlrequest I have the curl options (cookies etc) and url .

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • opening a new page and passing a parameter to it with Javascript

    - by recipriversexclusion
    I have a JS function that processes XML I GET from a server to dynamically create a table as below // Generate table of services by parsing the returned XML service list. function convertServiceXmlDataToTable(xml) { var tbodyElem = document.getElementById("myTbody"); var trElem, tdElem; var j = 0; $(xml).find("Service").each(function() { trElem = tbodyElem.insertRow(tbodyElem.rows.length); trElem.className = "tr" + (j % 2); // first column -> service ID var serviceID = $(this).attr("service__id"); tdElem = trElem.insertCell(trElem.cells.length); tdElem.className = "col0"; tdElem.innerHTML = serviceID; // second column -> service name tdElem = trElem.insertCell(trElem.cells.length); tdElem.className = "col1"; tdElem.innerHTML = "<a href=javascript:showServiceInfo(" + serviceID + ")>" + $(this).find("name").text() + "</a>"; j++; }); // each service } where showServiceInfo retrieves more detailed information about each service from the server based on the serviceID and displays it in the same page as the services table. So far so good. But, it turns out that I have to display the detailed service information in another page rather than the same page as the table. I have creates a generic service_info.html with an empty layout template, but I don't understand how to pass serviceID to this new page so that it gets customized with the detailed service info. How can I do this? Or, is there a better way to handle these situations? Thanks!

    Read the article

< Previous Page | 488 489 490 491 492 493 494 495 496 497 498 499  | Next Page >