Search Results

Search found 14506 results on 581 pages for 'document scanner'.

Page 491/581 | < Previous Page | 487 488 489 490 491 492 493 494 495 496 497 498  | Next Page >

  • why the main method are not covered? urgent, please help me

    - by Mike.Huang
    main method: public static void main(String[] args) throws Exception { if (args.length != EXPECTED_NUMBER_OF_ARGUMENTS) { System.err.println("Usage - java XFRCompiler ConfigXML PackageXML XFR"); } String configXML = args[0]; String packageXML = args[1]; String xfr = args[2]; AutoConfigCompiler compiler = new AutoConfigCompiler(); compiler.setConfigDocument(loadDocument(configXML)); compiler.setPackageInfoDoc(loadDocument(packageXML)); // compiler.setVisiblityDoc(loadDocument("VisibilityFilter.xml")); compiler.compileModel(xfr); } private static Document loadDocument(String fileName) throws Exception { TXDOMParser parser = (TXDOMParser) ParserFactory.makeParser(TXDOMParser.class.getName()); InputSource source = new InputSource(new FileInputStream(fileName)); parser.parse(source); return parser.getDocument(); } testcase: @Test public void testCompileModel() throws Exception { // construct parameters URL configFile = Thread.currentThread().getContextClassLoader().getResource("Ford_2008_Mustang_Config.xml"); URL packageFile = Thread.currentThread().getContextClassLoader().getResource("Ford_2008_Mustang_Package.xml"); File tmpFile = new File("Ford_2008_Mustang_tmp.xfr"); if(!tmpFile.exists()) { tmpFile.createNewFile(); } String[] args = new String[]{configFile.getPath(),packageFile.getPath(),tmpFile.getPath()}; try { // test main method XFRCompiler.main(args); } catch (Exception e) { assertTrue(true); } try { // test args length is less than 3 XFRCompiler.main(new String[]{"",""}); } catch (Exception e) { assertTrue(true); } tmpFile.delete(); } coverage outputs displayed as the lines from “String configXML = args[0];" in main method are not covered

    Read the article

  • mvc jquery passing form values after user presses "Accept" button

    - by gdubs
    So I have a form and a submit button that posts the form to an action. But I wanted to show a popup where the user can deny or accept an agreement. Here's my jquery $(document).ready((function () { var dialog = $('#confirmation-dialog').dialog({ autoOpen: false, width: 500, height: 600, resizable: false, modal: true, buttons: { "Accept": function () { $(this).dialog('close'); $.ajax({ type: 'POST', data: {__RequestVerificationToken: $("input[name=__RequestVerificationToken]").val()} }); }, "Cancel": function () { $(this).dialog('close'); } } }); $('#registration-submit').click(function (e) { var action = $(this.form); console.log(action); var form = $('form'); dialog.dialog("open"); return false; }); })); My problem with this is that it would post, but it would only send my AntiforgeryToken, and not the values of the form. But when it goes through the TryupdateModel it would go through for some reason but will not Save (cuz of the missing data that wasn't passed on the formcollection).

    Read the article

  • OnSubmit does work right in the Validation plugin in jQuery

    - by novellino
    Hello, I an quite new to jQuery and I have a problem while trying to create a form. I am using the Validation plugin for validate the email (one the form's field). When I click the Submit button I want to call my own function because I want to save the data in an XML file. This is my button: (as I understood the plugin uses "submit" for understand the button) <input type="submit" name="submit" class="submit" id="submit_btn" value="Send"/> and here is the script for the validation: <script type="text/javascript"> $(document).ready(function() { //this is my form $("#contactForm").validate(); /*save the valid data in the xml*/ $(".submit").click(function() { var email = $("input#email").val(); var subject = $("input#subject").val(); var message = $("textarea#message").val(); if (email == "" || !$("#contactForm").valid()) { return false; } var dataString = 'email='+ email + '&subject=' + subject + '&message=' + message; //alert("DATA: " +dataString); $.ajax({ type: "POST", url: "SaveData.jsp", data: dataString, success: function(data){} }); return false; }); }); In general it works ok but I have two basic problems. When I click the button in the beginning having all the form empty, I get no message for the field required. Also when the data are valid and I am doing the submit, the form does not become clear after the submit. If I deleted this script code, these actions are working properly but I can not save the data! Does anyone know what is wrong? Thanks a lot!

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • How do I use HTML5's localStorage in a Google Chrome extension?

    - by davidkennedy85
    I am trying to develop an extension that will work with Awesome New Tab Page. I've followed the author's advice to the letter, but it doesn't seem like any of the script I add to my background page is being executed at all. Here's my background page: <script> var info = { poke: 1, width: 1, height: 1, path: "widget.html" } chrome.extension.onRequestExternal.addListener(function(request, sender, sendResponse) { if (request === "mgmiemnjjchgkmgbeljfocdjjnpjnmcg-poke") { chrome.extension.sendRequest( sender.id, { head: "mgmiemnjjchgkmgbeljfocdjjnpjnmcg-pokeback", body: info, } ); } }); function initSelectedTab() { localStorage.setItem("selectedTab", "Something"); } initSelectedTab(); </script> Here is manifest.json: { "update_url": "http://clients2.google.com/service/update2/crx", "background_page": "background.html", "name": "Test Widget", "description": "Test widget for mgmiemnjjchgkmgbeljfocdjjnpjnmcg.", "icons": { "128": "icon.png" }, "version": "0.0.1" } Here is the relevant part of widget.html: <script> var selectedTab = localStorage.getItem("selectedTab"); document.write(selectedTab); </script> Every time, the browser just displays null. The local storage isn't being set at all, which makes me think the background page is completely disconnected. Do I have something wired up incorrectly?

    Read the article

  • Event type property lost in IE-8

    - by Channel72
    I've noticed a strange Javascript error which only seems to happen on Internet Explorer 8. Basically, on IE-8 if you have an event handler function which captures the event object in a closure, the event "type" property seems to become invalidated from within the closure. Here's a simple code snippet which reproduces the error: <html> <head> <script type = "text/javascript"> function handleClickEvent(ev) { ev = (ev || window.event); alert(ev.type); window.setTimeout(function() { alert(ev.type); // Causes error on IE-8 }, 20); } function foo() { var query = document.getElementById("query"); query.onclick = handleClickEvent; } </script> </head> <body> <input id = "query" type = "submit"> <script type = "text/javascript"> foo(); </script> </body> </html> So basically, what happens here is that within the handleClickEvent function, we have the event object ev. We call alert(ev.type) and we see the event type is "click". So far, so good. But then when we capture the event object in a closure, and then call alert(ev.type) again from within the closure, now all of a sudden Internet Explorer 8 errors, saying "Member not found" because of the expression ev.type. It seems as though the type property of the event object is mysteriously gone after we capture the event object in a closure. I tested this code snippet on Firefox, Safari and Chrome, and none of them report an error condition. But in IE-8, the event object seems to become somehow invalidated after it's captured in the closure. Question: Why is this happening in IE-8, and is there any workaround?

    Read the article

  • Events still not showing up despite the many tries...sigh

    - by sheng88
    I have tried the recommendation from this forum and through the many google searches...but i still can't get the events to show up on my calendar via jsp....i tried with php and it worked...sigh...i wonder where is the error....sigh.... The processRequest method is fine but when it dispatches to the JSP page...nothing appears from the browser.... protected void processRequest(HttpServletRequest request, HttpServletResponse response) throws ServletException, IOException { String email=request.getParameter("email"); try { ArrayList<CalendarEvt> calc=CalendarDAO.retrieveEvent(email); for (CalendarEvt calendarEvt : calc) { System.out.println(calendarEvt.getEventId()); } request.setAttribute("calendar", calc); request.getRequestDispatcher("calendar.jsp").forward(request, response); } catch (Exception e) { } } Here is the JSP section that's giving me headaches...(Without the loop...the Google link does appear...)...I have tried putting quotations and leaving them out....still no luck: <%--Load user's calendar--%> <script type='text/javascript'> $(document).ready(function() { var date = new Date(); var d = date.getDate(); var m = date.getMonth(); var y = date.getFullYear(); $('#calendar').fullCalendar({ editable: false, events: [ <c:forEach items="calendar" var="calc"> { title: '${calc.eventName}', start: ${calc.eventStart} }, </c:forEach> { title: 'Click for Google', start: new Date(y, m, 1), end: new Date(y, m, 1), url: 'http://google.com/' } ]//end of events }); }); </script> <%--Load user's calendar--%> ...any kind of help would be greatly appreciated...thx!!

    Read the article

  • jquery image fading with tabs

    - by StealthRT
    Hey all, i am trying my best to figure out how to go about doing this: I have 2 tabs. When the page loads tab1 is selected automatically. This shows the tab as 1.0 transparency while tab2 stays at 0.7. Once the user clicks on tab2, tab1 goes to 0.7 transparency and tab2 goes to 1.0. However, i can not seem to get it to do that! Here is my code: <script type="text/javascript"> function checkTab(theTab) { $('#tab1').fadeTo(250, 0.70); $('#tab2').fadeTo(250, 0.70); if ($("#tabActive").val() == theTab) { $(theTab).fadeTo(250, 1); } } $(document).ready(function() { $('#tab1').hover(function() {$(this).fadeTo(250, 1)}, function() {checkTab('#tab1')}); $('#tab2').hover(function() {$(this).fadeTo(250, 1)}, function() {checkTab('#tab2')}); $('#tab2').fadeTo(250, 0.70); $('#tabActive').val('tab1'); }); </script> <li class="stats"><img src="images/Stats.png" name="nav1" width="70" height="52" id="tab1" onclick="$('#tabActive').val('tab1');" /></li> <li class="cal"><img src="images/cal.png" name="nav1" width="70" height="52" id="tab2" onclick="$('#tabActive').val('tab2');" /></li> <input name="tabActive" id="tabActive" type="text" /> Any help would be great! :) David

    Read the article

  • How to make HTML layout whitespace-agnostic?

    - by ssg
    If you have consecutive inline-blocks white-space becomes significant. It adds some level of space between elements. What's the "correct" way of avoiding whitespace effect to HTML layout if you want those blocks to look stuck to each other? Example: <span>a</span> <span>b</span> This renders differently than: <span>a</span><span>b</span> because of the space inbetween. I want whitespace-effect to go away without compromising HTML source code layout. I want my HTML templates to stay clean and well-indented. I think these options are ugly: 1) Tweaking text-indent, margin, padding etc. (Because it would be dependent on font-size, default white-space width etc) 2) Putting everything on a single line, next to each other. 3) Zero font-size. That would require overriding font-size in blocks, which would otherwise be inherited. 4) Possible document-wide solutions. I want the solution to stay local for a certain block of HTML. Any ideas, any obvious points which I'm missing?

    Read the article

  • Interchange structured data between Haskell and C

    - by Eonil
    First, I'm a Haskell beginner. I'm planning integrating Haskell into C for realtime game. Haskell does logic, C does rendering. To do this, I have to pass huge complexly structured data (game state) from/to each other for each tick (at least 30 times per second). So the passing data should be lightweight. This state data may laid on sequential space on memory. Both of Haskell and C parts should access every area of the states freely. In best case, the cost of passing data can be copying a pointer to a memory. In worst case, copying whole data with conversion. I'm reading Haskell's FFI(http://www.haskell.org/haskellwiki/FFICookBook#Working_with_structs) The Haskell code look specifying memory layout explicitly. I have a few questions. Can Haskell specify memory layout explicitly? (to be matched exactly with C struct) Is this real memory layout? Or any kind of conversion required? (performance penalty) If Q#2 is true, Any performance penalty when the memory layout specified explicitly? What's the syntax #{alignment foo}? Where can I find the document about this? If I want to pass huge data with best performance, how should I do that? *PS Explicit memory layout feature which I said is just C#'s [StructLayout] attribute. Which is specifying in-memory position and size explicitly. http://www.developerfusion.com/article/84519/mastering-structs-in-c/ I'm not sure Haskell has matching linguistic construct matching with fields of C struct.

    Read the article

  • Unable to send '+' through AJAX post?

    - by Harish Kurup
    I am using Ajax POST method to send data, but i am not able to send '+'(operator to the server i.e if i want to send 1+ or 20k+ it will only send 1 or 20k..just wipe out '+') HTML code goes here.. <form method='post' onsubmit='return false;' action='#'> <input type='input' name='salary' id='salary' /> <input type='submit' onclick='submitVal();' /> </form> and javascript code goes here, function submitVal() { var sal=document.getElementById("salary").value; alert(sal); var request=getHttpRequest(); request.open('post','updateSal.php',false); request.setRequestHeader("Content-Type","application/x-www-form-urlencoded"); request.send("sal="+sal); if(request.readyState == 4) { alert("update"); } } function getHttpRequest() { var request=false; if(window.XMLHttpRequest) { request=new XMLHttpRequest(); } else if(window.ActiveXObject) { try { request=new ActiveXObject("Msxml2.XMLHTTP"); } catch(e) { try { request=new ActiveXObject("Microsoft.XMLHTTP"); } catch(e) { request=false; } } } return request; } in the function submitVal() it first alert's the salary value as it is(if 1+ then alerts 1+), but when it is posted it just post's value without '+' operator which is needed... is it any problem with query string, as the PHP backend code is working fine...

    Read the article

  • XmlDocument.Load() throws XmlSchemaValidationException

    - by Praetorian
    Hi, I'm trying to validate an XML document against a schema (which is embedded in my program as a resource). I got everything to work, so I tried to test for errors by adding a second sibling node in the XML at a location where the schema specifies maxOccurs="1". The problem is that my ValidationEventHandler is never getting called, also XmlDocument.Load() is throwing an XmlSchemaValidationException exception when I'd expected XmlDocument.Validate() to do that. This is the code I have: private void ValidateUserData( string xmlPath ) { var resInfo = Application.GetResourceStream( new Uri( @"MySchema.xsd", UriKind.Relative ) ); var schema = XmlSchema.Read( resInfo.Stream, SchemaValidationCallBack ); XmlSchemaSet schemaSet = new XmlSchemaSet(); schemaSet.Add( schema ); schemaSet.ValidationEventHandler += SchemaValidationCallBack; XmlReaderSettings settings = new XmlReaderSettings(); settings.Schemas = schemaSet; settings.ValidationType = ValidationType.Schema; XmlDocument doc = new XmlDocument(); using( XmlReader reader = XmlReader.Create( xmlPath, settings ) ) { doc.Load( reader ); // <-- This line throws an exception if XML is ill-formed reader.Close(); } doc.Validate( SchemaValidationCallBack );// <-- This is never reached } private void SchemaValidationCallBack( object sender, ValidationEventArgs e ) { Console.WriteLine( "SchemaValidationCallBack: " + e.Message ); } How do I get the callback to be called so I can handle validation errors? Thanks for your help!

    Read the article

  • Javascript onclick() event bubbling - working or not?

    - by user1071914
    I have a table in which the table row tag is decorated with an onclick() handler. If the row is clicked anywhere, it will load another page. In one of the elements on the row, is an anchor tag which also leads to another page. The desired behavior is that if they click on the link, "delete.html" is loaded. If they click anywhere else in the row, "edit.html" is loaded. The problem is that sometimes (according to users) both the link and the onclick() are fired at once, leading to a problem in the back end code. They swear they are not double-clicking. I don't know enough about Javascript event bubbling, handling and whatever to even know where to start with this bizarre problem, so I'm asking for help. Here's a fragment of the rendered page, showing the row with the embedded link and associated script tag. Any suggestions are welcomed: <tr id="tableRow_3339_0" class="odd"> <td class="l"></td> <td>PENDING</td> <td>Yabba Dabba Doo</td> <td>Fred Flintstone</td> <td> <a href="/delete.html?requestId=3339"> <div class="deleteButtonIcon"></div> </a> </td> <td class="r"></td> </tr> <script type="text/javascript">document.getElementById("tableRow_3339_0").onclick = function(event) { window.location = '//edit.html?requestId=3339'; };</script>

    Read the article

  • jQuery image fader slow in IE6 & 7

    - by Jamie
    Hi guys, I'm using the following jQuery script to rotate through a series of images pulled into an unordered list using PHP: function theRotator() { $('#rotator li').css({opacity: 0.0}); $('#rotator li:first').css({opacity: 1.0}); setInterval('rotate()',5000); }; function rotate() { var current = ($('#rotator li.show') ? $('#rotator li.show') : $('#rotator li:first')); var next = ((current.next().length) ? ((current.next().hasClass('show')) ? $('#rotator li:first') :current.next()) : $('#rotator li:first')); next.css({opacity: 0.0}).addClass('show').animate({opacity: 1.0}, 2000); current.animate({opacity: 0.0}, 2000).removeClass('show'); }; $(document).ready(function() { theRotator(); }); It works brilliantly in FF, Safari, Chrome and even IE8 but IE6 & 7 are really slow. Can anyone make any suggestions on making it more efficient or just work better in IE6 & 7? The script is from here btw. Thanks.

    Read the article

  • How do I animate text links in jquery?

    - by Peter
    I am somewhat new to jquery and I have a problem with something I am trying to implement using jquery. I have a vertical navigation menu where each link animates on hover by changing color, increasing letter spacing, and adding a border on the left. Everything is working the way I want it to except for when I click on the link. After I click on the link, the text changes to a different color and remains that same color even when I hover over the link. I am wanting to make it to where the color change on hover remains intact even after I click the link. I'm sure I am missing something simple, but I have tried everything I know to do with no luck. Any suggestions would be helpful! Here is what I have for the animation... <script type="text/javascript"> $(document).ready(function(){ $("ul.navlist li a").hover(function(){ $(this).stop() .animate({paddingLeft: '10px',letterSpacing: '2px',borderWidth:'20px'},{queue:false,easing:'easeInQuad'},50) }, function(){ $(this).stop() .animate({paddingLeft: '0px', letterSpacing: '0px',borderWidth:'0px'},{queue:false,easing:'easeOutQuad'},50) }); }); </script> My css for the navigation list is here... .navlist { list-style: none; } .navlist a { border-left-color: #555555; border-left-style: solid; border-left-width: 0px; color: #c4c4c4; } .navlist a:hover { border-left-color: #555555; border-left-style: solid; color: #555555; }

    Read the article

  • add dynamic field near his parent field?

    - by Kaps Hasija
    hi in my web page i am using Add Dynamic Field Functionality by using jquery. I am adding new div bu clicking on Existing div Like <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> by clicking on parent div i am creating new daynamic div <div class="divA">DivA2 </div> its coming end of the all div's like that <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> <div class="divA">DivA2 </div> But i need along with his parent div Like that <div class="divA">divA1 </div> <div class="divA">DivA2 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> any idea Thanks. This is My Jquery Code newTextBoxDiv = $(document.createElement('div')) .attr("id", text).attr("class", 'test0 ' + text); newTextBoxDiv.html('<div style=" width:150px; class="DivA" float: left"> </div>'); } newTextBoxDiv.appendTo("#contents"); contents is id of main div

    Read the article

  • Why would this Lua optimization hack help?

    - by Ian Boyd
    i'm looking over a document that describes various techniques to improve performance of Lua script code, and i'm shocked that such tricks would be required. (Although i'm quoting Lua, i've seen similar hacks in Javascript). Why would this optimization be required: For instance, the code for i = 1, 1000000 do local x = math.sin(i) end runs 30% slower than this one: local sin = math.sin for i = 1, 1000000 do local x = sin(i) end They're re-declaring sin function locally. Why would this be helpful? It's the job of the compiler to do that anyway. Why is the programmer having to do the compiler's job? i've seen similar things in Javascript; and so obviously there must be a very good reason why the interpreting compiler isn't doing its job. What is it? i see it repeatedly in the Lua environment i'm fiddling in; people redeclaring variables as local: local strfind = strfind local strlen = strlen local gsub = gsub local pairs = pairs local ipairs = ipairs local type = type local tinsert = tinsert local tremove = tremove local unpack = unpack local max = max local min = min local floor = floor local ceil = ceil local loadstring = loadstring local tostring = tostring local setmetatable = setmetatable local getmetatable = getmetatable local format = format local sin = math.sin What is going on here that people have to do the work of the compiler? Is the compiler confused by how to find format? Why is this an issue that a programmer has to deal with? Why would this not have been taken care of in 1993? i also seem to have hit a logical paradox: Optimizatin should not be done without profiling Lua has no ability to be profiled Lua should not be optimized

    Read the article

  • How someone using my Facebook website app can post to their pages timeline

    - by user1334414
    I have a website where businesses create content through a PHP backend system. Each time they create a new piece of content, I want it to publish to their Facebook pages timeline (not the users timeline). I have created the authenticate code: <div id="fb-root"></div> <script> window.fbAsyncInit = function() { FB.init({ appId : 'XXXXXXXXXX', status : true, cookie : true, xfbml : true, oauth : true, }); }; (function(d){ var js, id = 'facebook-jssdk'; if (d.getElementById(id)) {return;} js = d.createElement('script'); js.id = id; js.async = true; js.src = "//connect.facebook.net/en_US/all.js"; d.getElementsByTagName('head')[0].appendChild(js); }(document)); </script> <div class="fb-login-button" scope="manage_pages"> Login with Facebook </div> With manage_pages as a scope. I need to know how they can select which page they want the post to go to (if they have more than 1 page), and also how to automatically post to that pages wall when they submit the content (which is done via a PHP form). Thanks

    Read the article

  • How to only fade content once it is ready in Jquery?

    - by Jared
    Hello, I've seen examples for load() and ready(), but they always seem to apply to the window or document body, or a div or img or something like that. I have a hover() function, and when you hover over it, it uses fadeIn() to reveal it. Problem is, the images inside the div aren't loaded yet, so it ends up just appearing anyway. I need code that will only allow the image to fade when it's contents are fully loaded. When I just plug in other selectors like the following, it doesn't work $(this).next(".menuPopup").ready(function () { //or load(), neither work fadeTo(300, 1); }); EDIT: Relevant code $( '.leftMenuProductButton' ).hover ( function () { $(this).next(".menuPopup").stop().css("opacity", 1).fadeIn('slow'); }, function () { $(this).next(".menuPopup").stop().hide(); }); HTML <div class="leftMenuProductButton"> Product 1</div> <div id="raceramps56" class="menuPopup"><IMG SRC="myimage.jpeg"> </div>

    Read the article

  • Any solution to IE8 bug rendering error when hiding elements?

    - by Magnar
    Bug: when hiding an element with JavaScript in IE8, the margin of still-visible other elements on the side is ignored. This bug has been introduced with IE8, since it works as expected in IE6+7 (and other browsers). <html> <head> <style> #a, #b, #c, #d {background: #ccf; padding: 4px; margin-bottom: 8px;} </style> </head> <body> <div id="a">a</div> <div id="b">b</div> <div id="c">c</div> <div id="d">d</div> <script> setTimeout(function () { document.getElementById("b").style.display = "none"; }, 1000); </script> </body> </html> When running this code, notice how a and c have a margin of 8 between them in normal browsers, but a margin of 0 in IE8. Remove the padding, and IE8 behaves like normal. Remove the timeout and IE8 behaves like normal. A border behaves the same way. I've been working with IE-bugs the last 10 years, but this has me stumped. The solution for now is to wrap the divs, and apply the margin to the outer element and other styles to the inner. But that's reminicent of horrible IE6-workarounds. Any better solutions?

    Read the article

  • Anchor as a Submit button

    - by griegs
    I have an MVC 2 application that has the following on it; <% using( Html.BeginForm("Results","Quote", FormMethod.Post, new { name="Results" })){ %> <% Html.RenderPartial("Needs", Model.needs); %> <div class="But green" style=""> <a href="." onclick="javascript:document.Results.submit();">Go</a> </div> <input type="submit" /> <%} %> Pressing the Submit button or the anchor both post back to the right ActionResult. However, when in the controller I return View(stuff..) only the Submit button will come back to the page. When the call finishes from pressing the anchor, I go to an error page informing me that the resource cannot be found. I suspect it has something to do with href="." but am unsure what to set it to.

    Read the article

  • why limxml2 quotes starting double slash in CDATA with javascript

    - by Vincenzo
    This is my code: <?php $data = <<<EOL <?xml version="1.0"?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html> <script type="text/javascript"> //<![CDATA[ var a = 123; // JS code //]]> </script> </html> EOL; $dom = new DOMDocument(); $dom->preserveWhiteSpace = false; $dom->formatOutput = false; $dom->loadXml($data); echo '<pre>' . htmlspecialchars($dom->saveXML()) . '</pre>'; This is result: <?xml version="1.0"?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <script type="text/javascript"><![CDATA[ //]]><![CDATA[ var a = 123; // JS code //]]><![CDATA[ ]]></script></html> If and when I remove the DOCTYPE notation from XML document, CDATA works properly and leading/trailing double slash is not turned into CDATA. What is the problem here? Bug in libxml2? PHP version is 5.2.13 on Linux. Thanks.

    Read the article

  • jeditable table cell

    - by user666262
    Hi all, I am having an issue when using jeditable to edit a cell in a table. The project is the MVC 2 web application and the table has been put on the standard about page. How do i tell the script to call a specific method in the controller ? because it is currently just loading the entire page into the cell. This is the javascript: $(document).ready(function () { $('.editable').editable('http://localhost:2196/Home/About', { type: 'text', cancel: 'Cancel', event: 'dblclick', submit: 'OK', tooltip: 'double Click to edit...' }); }); This is the table : <% foreach (DataTableEditable.Models.Company item in (IEnumerable<DataTableEditable.Models.Company>)Model) {%> <tr id="<%= Html.Encode(item.ID) %>"> <td class="editable"><%= Html.Encode(item.Name) %> </td> <td><%= Html.Encode(item.Address) %> </td> <td><%= Html.Encode(item.Town) %> </td> </tr> <% }%> Thanks lots John

    Read the article

  • radio input replacement using jquery

    - by altvali
    It may seem a bit odd to ask this since there are several solutions out there but the fact is that all of them look pretty and none of what i've seem save the input value for form submission the right way. I'm looking for something that will replace all radio inputs with divs that get special classes when they are hovered or clicked, and an input type hidden for every group of radio inputs with the same name, hidden input that will be updated with the value corresponding to the div the user clicks on. Long sentence, i know. Here's what i've come up with: $('input:radio').each(function(){ if (this.style.display!='none') { var inputName = $(this).attr('name'); var inputValue = $(this).attr('value'); var isChecked = $(this).attr('checked'); if (!$('input:hidden[name='+inputName+']').length) // if the hidden input wasn't already created $(this).replaceWith('<div class="inputRadioButton" id="'+inputName+'X'+inputValue+'"></div><input type="hidden" name="'+inputName+'" value="'+inputValue+'" />'); else{ $(this).replaceWith('<div class="inputRadioButton" id="'+inputName+'X'+inputValue+'"></div>'); if (isChecked) $('input:hidden[name='+inputName+']').attr({'value':inputValue}); } //this bind doesn't work $("#"+inputName+"X"+inputValue).click(function(){ if($('input:hidden[name='+inputName+']').val()!=inputValue){ $('input:hidden[name='+inputName+']').attr({'value':inputValue}); $('div[id*='+inputName+'].inputRadioButton').removeClass('inputRadioButtonSelected'); } if (!$("#"+inputName+"X"+inputValue).hasClass('inputRadioButtonSelected')) $("#"+inputName+"X"+inputValue).addClass('inputRadioButtonSelected'); }); } }); Please tell me how to fix it. Thank you. Edit I've found the reason. It should normally work but some of my radio inputs generated by an e-commerce software had brackets in them (e.g. id[12] ) and jQuery was parsing that. The fix is adding var inputButton = document.getElementById(inputName+"X"+inputValue); before the bind and replacing $("#"+inputName+"X"+inputValue) with $(inputButton).

    Read the article

  • JSP: Refresh ComboBox options

    - by framara
    Hi, There's a class 'Car' with brand and model as properties. I have a list of items of this class List<Car> myCars. I need to represent in a JSP website 2 ComboBox, one for brand and another for model, that when you select the brand, in the model list only appear the ones from that brand. I don't know how to do this in a dynamic way. Any suggestion where to start? Thanks Update Ok, what I do now is send in the request a list with all the brand names, and a list of the items. The JSP code is like: <select name="manufacturer" id="id_manufacturer" onchange="return getManufacturer();"> <option value=""></option> <c:forEach items="${manufacturers}" var="man"> <option value="${man}" >${man}</option> </c:forEach> </select> <select name="model" id="id_model"> <c:forEach items="${mycars}" var="car"> <c:if test="${car.manufacturer eq man_selected}"> <option value="${car.id}">${car.model}</option> </c:if> </c:forEach> </select> <script> function getManufacturer() { man_selected = document.getElementById('id_manufacturer').value; } </script> How do I do to refresh the 'model' select options according to the selected 'man_selected' ?

    Read the article

< Previous Page | 487 488 489 490 491 492 493 494 495 496 497 498  | Next Page >