Search Results

Search found 14506 results on 581 pages for 'document scanner'.

Page 491/581 | < Previous Page | 487 488 489 490 491 492 493 494 495 496 497 498 | Next Page >

Latex - Apply an operation to every character in a string

- by hroest

Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

Read the article
XmlDocument.Load() throws XmlSchemaValidationException

- by Praetorian

Hi, I'm trying to validate an XML document against a schema (which is embedded in my program as a resource). I got everything to work, so I tried to test for errors by adding a second sibling node in the XML at a location where the schema specifies maxOccurs="1". The problem is that my ValidationEventHandler is never getting called, also XmlDocument.Load() is throwing an XmlSchemaValidationException exception when I'd expected XmlDocument.Validate() to do that. This is the code I have: private void ValidateUserData( string xmlPath ) { var resInfo = Application.GetResourceStream( new Uri( @"MySchema.xsd", UriKind.Relative ) ); var schema = XmlSchema.Read( resInfo.Stream, SchemaValidationCallBack ); XmlSchemaSet schemaSet = new XmlSchemaSet(); schemaSet.Add( schema ); schemaSet.ValidationEventHandler += SchemaValidationCallBack; XmlReaderSettings settings = new XmlReaderSettings(); settings.Schemas = schemaSet; settings.ValidationType = ValidationType.Schema; XmlDocument doc = new XmlDocument(); using( XmlReader reader = XmlReader.Create( xmlPath, settings ) ) { doc.Load( reader ); // <-- This line throws an exception if XML is ill-formed reader.Close(); } doc.Validate( SchemaValidationCallBack );// <-- This is never reached } private void SchemaValidationCallBack( object sender, ValidationEventArgs e ) { Console.WriteLine( "SchemaValidationCallBack: " + e.Message ); } How do I get the callback to be called so I can handle validation errors? Thanks for your help!

Read the article
How can i change a jquery plugin's option value with my value?

- by Pandiya Chendur

I have just jquery pagination plugin to work... But what happens is when i click page number 2 i get the first page and when i click 3 i get second page and so on.... My initial page my current page value changes to 0 instead 1 this causes the problem... My plugin has this, jQuery.fn.pagination = function(maxentries, opts){ opts = jQuery.extend({ items_per_page:10, num_display_entries:10, current_page:0, num_edge_entries:0, link_to:"#", prev_text:"Prev", next_text:"Next", ellipse_text:"...", prev_show_always:true, next_show_always:true, callback:function(){return false;} },opts||{}); current_page is set to 0 ... I have modified the current page value in my jquery function but it doesn't seem to work.... <script type="text/javascript"> var itemsPerPage = 5; var maxNumberOfElementsHere = 17; $(document).ready(function() { getRecordspage(1, itemsPerPage); $(".pager").pagination(maxNumberOfElementsHere, { callback: getRecordspage, current_page: 1, // Look here i have changed this but it doesn't work... items_per_page: itemsPerPage, num_display_entries: 5, next_text: 'Next', prev_text: 'Prev', num_edge_entries: 1 }); }); </script>

Read the article
javascript: waiting for an iframe page to load before writing to it (but not from the page that's tr

- by Bill Dawes

Apologies if this has been answered elsewhere, but I haven't been able to find it referenced. (Probably because nobody else would want to do such a daft thing, I admit). So, I have a page with three iframes in it. An event on one triggers a javascript function which loads new pages into the other two iframes; ['topright'] and ['bottomright']. However, javascript in the page that is being loaded into iframe 'topright' then needs to send information to elements in the 'bottomright' iframe. window.frames['bottomright'].document.subform.ID_client = client; etc But this will only work if the page has fully loaded into the bottomright frame. So what would be the most efficient way for that code in the 'topright' iframe to check and ensure that that form element in the bottomright frame is actually available to write to, before it does write to it? Bearing in mind that the page load has NOT been triggered from the topright frame, so I can't simply use an onLoad function. (I know this probably sounds like a hideously tortuous route for getting data from one page to another, but that's another story. The client is always right, etc...:-))

Read the article
add dynamic field near his parent field?

- by Kaps Hasija

hi in my web page i am using Add Dynamic Field Functionality by using jquery. I am adding new div bu clicking on Existing div Like <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> by clicking on parent div i am creating new daynamic div <div class="divA">DivA2 </div> its coming end of the all div's like that <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> <div class="divA">DivA2 </div> But i need along with his parent div Like that <div class="divA">divA1 </div> <div class="divA">DivA2 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> any idea Thanks. This is My Jquery Code newTextBoxDiv = $(document.createElement('div')) .attr("id", text).attr("class", 'test0 ' + text); newTextBoxDiv.html('<div style=" width:150px; class="DivA" float: left"> </div>'); } newTextBoxDiv.appendTo("#contents"); contents is id of main div

Read the article
Unable to send '+' through AJAX post?

- by Harish Kurup

I am using Ajax POST method to send data, but i am not able to send '+'(operator to the server i.e if i want to send 1+ or 20k+ it will only send 1 or 20k..just wipe out '+') HTML code goes here.. <form method='post' onsubmit='return false;' action='#'> <input type='input' name='salary' id='salary' /> <input type='submit' onclick='submitVal();' /> </form> and javascript code goes here, function submitVal() { var sal=document.getElementById("salary").value; alert(sal); var request=getHttpRequest(); request.open('post','updateSal.php',false); request.setRequestHeader("Content-Type","application/x-www-form-urlencoded"); request.send("sal="+sal); if(request.readyState == 4) { alert("update"); } } function getHttpRequest() { var request=false; if(window.XMLHttpRequest) { request=new XMLHttpRequest(); } else if(window.ActiveXObject) { try { request=new ActiveXObject("Msxml2.XMLHTTP"); } catch(e) { try { request=new ActiveXObject("Microsoft.XMLHTTP"); } catch(e) { request=false; } } } return request; } in the function submitVal() it first alert's the salary value as it is(if 1+ then alerts 1+), but when it is posted it just post's value without '+' operator which is needed... is it any problem with query string, as the PHP backend code is working fine...

Read the article
How do I animate text links in jquery?

- by Peter

I am somewhat new to jquery and I have a problem with something I am trying to implement using jquery. I have a vertical navigation menu where each link animates on hover by changing color, increasing letter spacing, and adding a border on the left. Everything is working the way I want it to except for when I click on the link. After I click on the link, the text changes to a different color and remains that same color even when I hover over the link. I am wanting to make it to where the color change on hover remains intact even after I click the link. I'm sure I am missing something simple, but I have tried everything I know to do with no luck. Any suggestions would be helpful! Here is what I have for the animation... <script type="text/javascript"> $(document).ready(function(){ $("ul.navlist li a").hover(function(){ $(this).stop() .animate({paddingLeft: '10px',letterSpacing: '2px',borderWidth:'20px'},{queue:false,easing:'easeInQuad'},50) }, function(){ $(this).stop() .animate({paddingLeft: '0px', letterSpacing: '0px',borderWidth:'0px'},{queue:false,easing:'easeOutQuad'},50) }); }); </script> My css for the navigation list is here... .navlist { list-style: none; } .navlist a { border-left-color: #555555; border-left-style: solid; border-left-width: 0px; color: #c4c4c4; } .navlist a:hover { border-left-color: #555555; border-left-style: solid; color: #555555; }

Read the article
How to only fade content once it is ready in Jquery?

- by Jared

Hello, I've seen examples for load() and ready(), but they always seem to apply to the window or document body, or a div or img or something like that. I have a hover() function, and when you hover over it, it uses fadeIn() to reveal it. Problem is, the images inside the div aren't loaded yet, so it ends up just appearing anyway. I need code that will only allow the image to fade when it's contents are fully loaded. When I just plug in other selectors like the following, it doesn't work $(this).next(".menuPopup").ready(function () { //or load(), neither work fadeTo(300, 1); }); EDIT: Relevant code $( '.leftMenuProductButton' ).hover ( function () { $(this).next(".menuPopup").stop().css("opacity", 1).fadeIn('slow'); }, function () { $(this).next(".menuPopup").stop().hide(); }); HTML <div class="leftMenuProductButton"> Product 1</div> <div id="raceramps56" class="menuPopup"><IMG SRC="myimage.jpeg"> </div>

Read the article
jquery load returns empty, possible MVC 2 problem?

- by Max Fraser

I have a site that need to get some data from a different sit that is using asp.net MVC/ The data to get loaded is from these pages: http://charity.hondaclassic.com/home/totaldonations http://charity.hondaclassic.com/Home/CharityList This should be a no brainer but for some reason I get an empty response, here is my JS: <script> jQuery.noConflict(); jQuery(document).ready(function($){ $('.totalDonations').load('http://charity.hondaclassic.com/home/totaldonations'); $('#charityList').load('http://charity.hondaclassic.com/home/CharityList'); }); </script> in firebug I see the request is made and come back with a response of 200 OK but the response is empty, if you browse to these pages they work fine! What the heck? Here are the controller actions from the MVC site: public ActionResult TotalDonations() { var total = "$" + repo.All<Customer>().Sum(x => x.AmountPaid).ToString(); return Content(total); } public ActionResult CharityList() { var charities = repo.All<Company>(); return View(charities); } Someone please out what stupid little thing I am missing - this should have taken me 5 minutes and it's been hours!

Read the article
How to make HTML layout whitespace-agnostic?

- by ssg

If you have consecutive inline-blocks white-space becomes significant. It adds some level of space between elements. What's the "correct" way of avoiding whitespace effect to HTML layout if you want those blocks to look stuck to each other? Example: <span>a</span> <span>b</span> This renders differently than: <span>a</span><span>b</span> because of the space inbetween. I want whitespace-effect to go away without compromising HTML source code layout. I want my HTML templates to stay clean and well-indented. I think these options are ugly: 1) Tweaking text-indent, margin, padding etc. (Because it would be dependent on font-size, default white-space width etc) 2) Putting everything on a single line, next to each other. 3) Zero font-size. That would require overriding font-size in blocks, which would otherwise be inherited. 4) Possible document-wide solutions. I want the solution to stay local for a certain block of HTML. Any ideas, any obvious points which I'm missing?

Read the article
asp.net jquery how to use Plugin/Validation with web content

- by Eyla

I have a asp.net web content from that have a asp.net textbox and I want to use Plugin/Validation but it is not working with me here is my code: <%@ Page Title="" Language="C#" MasterPageFile="~/Master.Master" AutoEventWireup="true" CodeBehind="WebForm1.aspx.cs" Inherits="IMAM_APPLICATION.WebForm1" %> <%@ Register assembly="AjaxControlToolkit" namespace="AjaxControlToolkit" tagprefix="asp" %> <asp:Content ID="Content1" ContentPlaceHolderID="head" runat="server"> <script src="js/jquery-1.4.1.js" type="text/javascript"></script> <script src="js/jquery.validate.js" type="text/javascript"></script> <script type="text/javascript"> $(document).ready(function() { $.validator.addMethod("#<%=TextBox1.ClientID %>", function(value, element) { return this.optional(element) || /^(?=.*\d)(?=.*[a-z])(?=.*[A-Z]).{8,16}$/i.test(value); }, "Passwords are 8-16 characters with uppercase letters, lowercase letters and at least one number."); }); </script> </asp:Content> <asp:Content ID="Content2" ContentPlaceHolderID="ContentPlaceHolder1" runat="server"> </asp:Content> <asp:Content ID="Content3" ContentPlaceHolderID="ContentPlaceHolder2" runat="server"> <asp:TextBox ID="TextBox1" runat="server"></asp:TextBox> </asp:Content>

Read the article
Checking whether images loaded after page load

- by johkar

Determining whether an image has loaded reliably seems to be one of the great JavaScript mysteries. I have tried various scripts/script libraries which check the onload and onerror events but I have had mixed and unreliable results. Can I reliably just check the complete property (IE 6-8 and Firefox) as I have done in the script below? I simply have a page wich lists out servers and I link to an on.gif on each server. If it doesn't load I just want to load an off.gif instead. This is just for internal use...I just need it to be reliable in showing the status!!! <script type="text/javascript"> var allimgs = document.getElementsByTagName('img'); function checkImages(){ for (i = 0; i < allimgs.length; i++){ var result = Math.random(); allimgs[i].src = allimgs[i].src + '?' + result; } serverDown(); setInterval('serverDown()',5000); } window.onload=checkImages; function serverDown(){ for (i = 0; i < allimgs.length; i++){ var imgholder=new Image(); imgholder.src=allimgs[i].src; if(!allimgs[i].complete){ allimgs[i].src='off.gif'; } } } </script>

Read the article
JQuery Dragging Outside Parent

- by Andy

I'm using JQuery's draggable(); to make li elements draggable. The only problem is when the element is dragged outside its parent, it doesn't show up. That is, it doesn't leave the confines of its parent div. An example is here: http://imgur.com/N2N1L.png - it's as if the z-index for everything else has greater priority (and the element slides under everything). Here's the code: $('.photoList li').draggable({ distance: 20, snap: theVoteBar, revert: true, containment: 'document' }); And the li elements are placed in DIVs like this: <div class="coda-slider preload" id="coda-slider-1"> <div class="panel"> <div class="panel-wrapper"> <h2 class="title" style="display:none;">Page 1</h2> <ul class="photoList"> <li> <img class="ui-widget-content" src="photos/1.jpg" style="width:100px;height:100px;" /> </li> </ul> </div> </div> I'm positive the problem is it won't leave its parent container, but I'm not sure what to do to get it out. Any direction or help would be appreciated GREATLY!

Read the article
Interchange structured data between Haskell and C

- by Eonil

First, I'm a Haskell beginner. I'm planning integrating Haskell into C for realtime game. Haskell does logic, C does rendering. To do this, I have to pass huge complexly structured data (game state) from/to each other for each tick (at least 30 times per second). So the passing data should be lightweight. This state data may laid on sequential space on memory. Both of Haskell and C parts should access every area of the states freely. In best case, the cost of passing data can be copying a pointer to a memory. In worst case, copying whole data with conversion. I'm reading Haskell's FFI(http://www.haskell.org/haskellwiki/FFICookBook#Working_with_structs) The Haskell code look specifying memory layout explicitly. I have a few questions. Can Haskell specify memory layout explicitly? (to be matched exactly with C struct) Is this real memory layout? Or any kind of conversion required? (performance penalty) If Q#2 is true, Any performance penalty when the memory layout specified explicitly? What's the syntax #{alignment foo}? Where can I find the document about this? If I want to pass huge data with best performance, how should I do that? *PS Explicit memory layout feature which I said is just C#'s [StructLayout] attribute. Which is specifying in-memory position and size explicitly. http://www.developerfusion.com/article/84519/mastering-structs-in-c/ I'm not sure Haskell has matching linguistic construct matching with fields of C struct.

Read the article
Django Template For Loop Removing <img> Self-Closing

- by Zack

Django's for loop seems to be removing all of my <img> tag's self-closing...ness (/>). In the Template, I have this code: {% for item in item_list %} <li> <a class="left" href="{{ item.url }}">{{ item.name }}</a> <a class="right" href="{{ item.url }}"> <img src="{{ item.icon.url }}" alt="{{ item.name }} Logo." /> </a> </li> {% endfor %} It outputs this: <li> <a class="left" href="/some-url/">This is an item</a> <a class="right" href="/some-url/"> <img src="/media/img/some-item.jpg" alt="This is an item Logo."> </a> </li> As you can see, the <img> tag is no longer closed, and thus the page doesn't validate. This isn't a huge issue since it'll still render properly in all browsers, but I'd like to know how to solve it. I've tried wrapping the whole for loop in {% autoescape off %}...{% endautoescape %} but that didn't change anything. All other self-closed <img> tags in the document outside the for loop still properly close.

Read the article
How someone using my Facebook website app can post to their pages timeline

- by user1334414

I have a website where businesses create content through a PHP backend system. Each time they create a new piece of content, I want it to publish to their Facebook pages timeline (not the users timeline). I have created the authenticate code: <div id="fb-root"></div> <script> window.fbAsyncInit = function() { FB.init({ appId : 'XXXXXXXXXX', status : true, cookie : true, xfbml : true, oauth : true, }); }; (function(d){ var js, id = 'facebook-jssdk'; if (d.getElementById(id)) {return;} js = d.createElement('script'); js.id = id; js.async = true; js.src = "//connect.facebook.net/en_US/all.js"; d.getElementsByTagName('head')[0].appendChild(js); }(document)); </script> <div class="fb-login-button" scope="manage_pages"> Login with Facebook </div> With manage_pages as a scope. I need to know how they can select which page they want the post to go to (if they have more than 1 page), and also how to automatically post to that pages wall when they submit the content (which is done via a PHP form). Thanks

Read the article
jquery image fading with tabs

- by StealthRT

Hey all, i am trying my best to figure out how to go about doing this: I have 2 tabs. When the page loads tab1 is selected automatically. This shows the tab as 1.0 transparency while tab2 stays at 0.7. Once the user clicks on tab2, tab1 goes to 0.7 transparency and tab2 goes to 1.0. However, i can not seem to get it to do that! Here is my code: <script type="text/javascript"> function checkTab(theTab) { $('#tab1').fadeTo(250, 0.70); $('#tab2').fadeTo(250, 0.70); if ($("#tabActive").val() == theTab) { $(theTab).fadeTo(250, 1); } } $(document).ready(function() { $('#tab1').hover(function() {$(this).fadeTo(250, 1)}, function() {checkTab('#tab1')}); $('#tab2').hover(function() {$(this).fadeTo(250, 1)}, function() {checkTab('#tab2')}); $('#tab2').fadeTo(250, 0.70); $('#tabActive').val('tab1'); }); </script> <li class="stats"><img src="images/Stats.png" name="nav1" width="70" height="52" id="tab1" onclick="$('#tabActive').val('tab1');" /></li> <li class="cal"><img src="images/cal.png" name="nav1" width="70" height="52" id="tab2" onclick="$('#tabActive').val('tab2');" /></li> <input name="tabActive" id="tabActive" type="text" /> Any help would be great! :) David

Read the article
How do I use HTML5's localStorage in a Google Chrome extension?

- by davidkennedy85

I am trying to develop an extension that will work with Awesome New Tab Page. I've followed the author's advice to the letter, but it doesn't seem like any of the script I add to my background page is being executed at all. Here's my background page: <script> var info = { poke: 1, width: 1, height: 1, path: "widget.html" } chrome.extension.onRequestExternal.addListener(function(request, sender, sendResponse) { if (request === "mgmiemnjjchgkmgbeljfocdjjnpjnmcg-poke") { chrome.extension.sendRequest( sender.id, { head: "mgmiemnjjchgkmgbeljfocdjjnpjnmcg-pokeback", body: info, } ); } }); function initSelectedTab() { localStorage.setItem("selectedTab", "Something"); } initSelectedTab(); </script> Here is manifest.json: { "update_url": "http://clients2.google.com/service/update2/crx", "background_page": "background.html", "name": "Test Widget", "description": "Test widget for mgmiemnjjchgkmgbeljfocdjjnpjnmcg.", "icons": { "128": "icon.png" }, "version": "0.0.1" } Here is the relevant part of widget.html: <script> var selectedTab = localStorage.getItem("selectedTab"); document.write(selectedTab); </script> Every time, the browser just displays null. The local storage isn't being set at all, which makes me think the background page is completely disconnected. Do I have something wired up incorrectly?

Read the article
beautifulsoup can't find exist href in file

- by young001

I have a html file like following: <form action="/2811457/follow?gsid=3_5bce9b871484d3af90c89f37" method="post"> <div> <a href="/2811457/follow?page=2&gsid=3_5bce9b871484d3af90c89f37">next_page</a>  <input name="mp" type="hidden" value="3" /> <input type="text" name="page" size="2" style='-wap-input-format: "*N"' /> <input type="submit" value="jump" /> 1/3 </div> </form> how to extract the "1/3" from the file? It is a part of html,I intend to make it clear. When I use beautifulsoup, I'm new to beautifulsoup,and I have look the document,but still confused. how to extract"1/3" from the html file? total_urls_num = soup.find(re.compile('.*/d\//d.*')) doesn't work As JBernardo said,\d should be a number,When I change to .*\d/\d.*,it doesn't work too. my code: from BeautifulSoup import BeautifulSoup import re with open("html.txt","r") as f: response = f.read() print response soup = BeautifulSoup(response) delete_urls = soup.findAll('a', href=re.compile('follow\?page')) #works print delete_urls #total_urls_num = soup.find(re.compile('.*\d/\d.*')) total_urls_num = soup.find('input',style='submit') #can't work print total_urls_num

Read the article
[jquery] multiple resizables acting strange

- by Noweem

Hi there everyone, I'm trying to place multiple resizable and draggable div's on one page that move (vertically) inside their own parent div. you can take a look at http://bit.ly/bCutBE However, these div's act really strange when I want to resize them, especially from the north side, they kind of move out of the screen very fast, while they shouldn't be able to get outside the parent div. I only want the div to be able to move and resize vertically inside it's parent, the dragging-part works pretty good, but the resize part give this problem. I can't really describe it better than this, but take a look for yourself and it will be clear immediately when you try to resize one of the coloured div's: move it a little downwards and try to resize it from the north side. the problem seems to be caused by the containment: 'parent', line of the resizable. when I delete this line it works fine, but then the coloured blocks don't stay in their parent, and I want them to stay inside their parent. I hope someone can help me with this... the jquery code I used: $(document).ready(function(){ $(".move") .draggable({ containment: 'parent', grid: [50,50], axis: 'y' }) .resizable({ containment: 'parent', grid: [50,50], handles: 'n, s', minHeight: 50 }); });

Read the article
Why would this Lua optimization hack help?

- by Ian Boyd

i'm looking over a document that describes various techniques to improve performance of Lua script code, and i'm shocked that such tricks would be required. (Although i'm quoting Lua, i've seen similar hacks in Javascript). Why would this optimization be required: For instance, the code for i = 1, 1000000 do local x = math.sin(i) end runs 30% slower than this one: local sin = math.sin for i = 1, 1000000 do local x = sin(i) end They're re-declaring sin function locally. Why would this be helpful? It's the job of the compiler to do that anyway. Why is the programmer having to do the compiler's job? i've seen similar things in Javascript; and so obviously there must be a very good reason why the interpreting compiler isn't doing its job. What is it? i see it repeatedly in the Lua environment i'm fiddling in; people redeclaring variables as local: local strfind = strfind local strlen = strlen local gsub = gsub local pairs = pairs local ipairs = ipairs local type = type local tinsert = tinsert local tremove = tremove local unpack = unpack local max = max local min = min local floor = floor local ceil = ceil local loadstring = loadstring local tostring = tostring local setmetatable = setmetatable local getmetatable = getmetatable local format = format local sin = math.sin What is going on here that people have to do the work of the compiler? Is the compiler confused by how to find format? Why is this an issue that a programmer has to deal with? Why would this not have been taken care of in 1993? i also seem to have hit a logical paradox: Optimizatin should not be done without profiling Lua has no ability to be profiled Lua should not be optimized

Read the article
Handling Types Defined in Plug-ins That Are No Longer Available

- by Chris

I am developing a .NET framework application that allows users to maintain and save "projects". A project can consist of components whose types are defined in the assemblies of the framework itself and/or in third-party assemblies that will be made available to the framework via a yet-to-be-built plug-in architecture. When a project is saved, it is simply binary-serialised to file. Projects are portable, so multiple users can load the same project into their own instances of the framework (just as different users may open the same MSWord document in their own local copies of MSWord). What's more, the plug-ins available to one user's framework might not be available to that of another. I need some way of ensuring that when a user attempts to open (i.e. deserialise) a project that includes a type whose defining assembly cannot be found (either because of a framework version incompatibility or the absence of a plug-in), the project still opens but the offending type is somehow substituted or omitted. Trouble is, the research I've done to date does not even hint at a suitable approach. Any ideas would be much appreciated, thanks.

Read the article
Why this class assignment is not working in IE

- by user550750

I've wrote this peice of code, this works fine in FF and Chrome but not in IE. Why is it? <html> <header> <style type="text/css"> .red{ color: red; } .green{ color: green; } .yellow{ color: yellow; } </style> </header> <body> <div id="mydiv" style="height: 50px">Some contents</div> <div> <input type="radio" value="1" name="change" onclick="onClick(this)">Red</input> <input type="radio" value="2" name="change" onclick="onClick(this)">Green</input> <input type="radio" value="3" name="change" onclick="onClick(this)">Yellow</input> </div> <script type="text/javascript"> function onClick(el){ var className = ""; if(el.value == 1){ className = "red"; }else if(el.value == 2){ className = "green"; }else if(el.value == 3){ className = "yellow"; } document.getElementById("mydiv").setAttribute("class", className); } </script> </body> </html>

Read the article
PHP with Javascript: Email confirmation script not working

- by Josh K

Hey Heres what i got: echo "<script type=\"text/javascript\"> function finishForm() { var answer = confirm('Are you sure these are the teams you want to enter with?'); if (answer) { if(document.getElementByID(emailconfirm).value == ".$_SESSION[Email].") { form.action=\"esubmit.php\"; form.submit(); } else { alert('E-mail address do not match'); return false; } } } function restartForm() { var answer = confirm('Are you sure you want to start over?'); if (answer) { form.action=\"e1.php\"; form.submit(); } } </script>"; I have a regular button calling this function. emailconfirm is a text input. I want to confirm that they have chosen the right teams, then check if the email in the session and the email confirmation text match. If they do match Then i want to submit the form. If they dont match, I want to alert the user they dont match, and just return to page so user can check emails and then resubmit. This script is in my header. EDIT: Haha sorry i submitted one before and it didnt go through, forgot to add my problem!! When you click the button it comes up with the confirmation, clicking either yes or no doesnt do anything. The alert doesnt pop up if they dont match and if they do match it doesnt submit. Also it might be good to note I had it without the email confirmation if statement and it worked fine (going to the submit page)

Read the article
jeditable table cell

- by user666262

Hi all, I am having an issue when using jeditable to edit a cell in a table. The project is the MVC 2 web application and the table has been put on the standard about page. How do i tell the script to call a specific method in the controller ? because it is currently just loading the entire page into the cell. This is the javascript: $(document).ready(function () { $('.editable').editable('http://localhost:2196/Home/About', { type: 'text', cancel: 'Cancel', event: 'dblclick', submit: 'OK', tooltip: 'double Click to edit...' }); }); This is the table : <% foreach (DataTableEditable.Models.Company item in (IEnumerable<DataTableEditable.Models.Company>)Model) {%> <tr id="<%= Html.Encode(item.ID) %>"> <td class="editable"><%= Html.Encode(item.Name) %> </td> <td><%= Html.Encode(item.Address) %> </td> <td><%= Html.Encode(item.Town) %> </td> </tr> <% }%> Thanks lots John

Read the article

< Previous Page | 487 488 489 490 491 492 493 494 495 496 497 498 | Next Page >