Search Results

Search found 14506 results on 581 pages for 'document scanner'.

Page 494/581 | < Previous Page | 490 491 492 493 494 495 496 497 498 499 500 501  | Next Page >

• How to report progress of a JavaScript function?

  - by LambyPie

  I have a JavaScript function which is quite long and performs a number of tasks, I would like to report progress to the user by updating the contents of a SPAN element with a message as I go. I tried adding document.getElementById('spnProgress').innerText = ... statements throughout the function code. However, whilst the function is executing the UI will not update and so you only ever see the last message written to the SPAN which is not very helpful. My current solution is to break the task up into a number of functions, at the end of each I set the SPAN message and then "trigger" the next one with a window.setTimeout call with a very short delay (say 10ms). This yields control and allows the browser to repaint the SPAN with the updated message before starting the next step. However I find this very messy and difficult to follow the code, I'm thinking there must be a better way. Does anyone have any suggestions? Is there any way to force the SPAN to repaint without having to leave the context of the function? Thanks

  Read the article

• Jquery selectors question

  - by Ben

  Hi all, I am not an expert at jquery but trying to get a menu to work. Basically, I have a menu made of up to 3 levels of nested lists. The first level has a little arrow has a background image that opens or close when opening the first level list. Any other nested lists don't need to have the background image. My script opens the menu when you click on it and is also supposed to switch the first level list from a class "inactive" to a class "active". Here is the script: $(document).ready(function(){ $("#left-navigation-holder ul.level1 li.inactive").toggle(function(){ $(this).addClass("active"); }, function () { $(this).removeClass("active"); }); $("#left-navigation-holder li a").click(function(){ menu = $(this).parent('li').children('ul'); menu.toggle(); }); }); The problem is that the toggle function also happens when clicking on second and third level lists causing the arrows to toggle even if the first level list isn't clicked on. I thought using $("#left-navigation-holder ul.level1 li.inactive").toggle would limit the function to the first level list with a class "inactive". Any help would be really appreciated. Ben

  Read the article

• Issue reading in a cell from Excel with Apache POI

  - by Nick

  I am trying to use Apache POI to read in old (pre-2007 and XLS) Excel files. My program goes to the end of the rows and iterates back up until it finds something that's not either null or empty. Then it iterates back up a few times and grabs those cells. This program works just fine reading in XLSX and XLS files made in Office 2010. I get the following error message: Exception in thread "main" java.lang.NumberFormatException: empty String at sun.misc.FloatingDecimal.readJavaFormatString(Unknown Source) at java.lang.Double.parseDouble(Unknown Source) at the line: num = Double.parseDouble(str); from the code: str = cell.toString(); if (str != "" || str != null) { System.out.println("Cell is a string"); num = Double.parseDouble(str); } else { System.out.println("Cell is numeric."); num = cell.getNumericCellValue(); } where the cell is the last cell in the document that's not empty or null. When I try to print the first cell that's not empty or null, it prints nothing, so I think I'm not accessing it correctly.

  Read the article

• Can someone tell me why this JavaScript code isn't lining up an array in order?

  - by DarkLightA

  Live code: http://jsfiddle.net/fCUZC/ //INPUT ARRAY: var input = [28,32,21,11,8,2,14,32,64]; //VARIABLE DECLARATION. a = highest number so far, b = position of that number entireLoop: for (var i = 1; i<=input.length; i++) { if(input[i] > input[i-1]) { for(var o = i; o>=0; o--) { if(input[i-1] > input[o]) { input.splice(i,0,input[o]); input.splice((o+1),1); continue entireLoop; } else if(input[o] > input[0]) { input.splice(0,0,input[o]); input.splice((o+1),1); continue entireLoop; } } } } document.write(input); I'm trying to order the array from largest to smallest, but there's a 32 stuck somewhere. I know there's the sort method, but I'm a newbie and want to try this for myself.

  Read the article

• Why doesn't Javascript recognize the HTML class attribute?

  - by Cornflake

  Can anyone help me with a Javascript question, please? Why does the following code display only message boxes with the word "null" in them? And I think there are not enough of them either. <html> <head> <script type="text/javascript"> function showElementClasses(node) { var els = node.getElementsByTagName("*"); for(var i=0,j=els.length; i<j; i++) alert(els[i].getAttribute("class")); alert("Class: " + els[i].className); } showElementClasses(document); </script> </head> <body class="bla"> <div class="myclass" style="width: 500; height: 400" id="map"></div> </body> </html>

  Read the article

• Google Maps API v3 not working

  - by user1496322

  I've been banging my head on the wall after going through the documentation on this several times! I can't seem to get past the API error to get the map to appear on my site. I am getting the following error message from the web page where I want the map to be displayed: ~~~~~~~~~~~ Google has disabled use of the Maps API for this application. The provided key is not a valid Google API Key, or it is not authorized for the Google Maps Javascript API v3 on this site. If you are the owner of this application, you can learn about obtaining a valid key here: https://developers.google.com/maps/documentation/javascript/tutorial#Obtaining_Key ~~~~~~~~~~~ I have (several times now) gone into my account and 1) enabled the Maps v3 API service. 2) Generated a new API key. and 3) added my allowed referrers to the key. (both www.domain.com and domain.com URLs) I have the following added to the head of the web page: < script src="http://maps.googleapis.com/maps/api/js?sensor=false&key=MY_API_KEY_HERE" type="text/JavaScript" language="JavaScript" And... I have the following javascript function that executes when a link is clicked on the page: alert("viewMap()"); var map = new GMap3(document.getElementById("map_canvas")); var geocoder = new GClientGeocoder(); var address = "1600 Amphitheatre Parkway, Mountain View"; alert("Calling getLatLng ..."); geocoder.getLatLng(address, function(point) { var latitude = point.y; var longitude = point.x; // do something with the lat lng alert("Lat:"+latitude+" - Lng:"+longitude); }); The initial 'viewMap' alert is displayed and then is followed by the 'Google has disbled use...' error message. The error console is also showing 'GMap3 is not defined'. Can anyone please assist with showing me the errors of my ways?!?!? Thank you in advance for any help you can provide. -Dennis

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• pdf external streams in Max OS X Preview

  - by olpa

  According to the specification, a part of a PDF document can reside in an external file. An example for an image: 2 0 obj << /Type /XObject /Subtype /Image /Width 117 /Height 117 /BitsPerComponent 8 /Length 0 /ColorSpace /DeviceRGB /FFilter /DCTDecode /F (pinguine.jpg) >> stream endstream endobj I found that this functionality does work in Adobe Acrobat 5.0 for Windows (sample PDF with the image), also I managed to view this file in Adobe Acrobat Reader 8.1.3 for Mac OS X after I found the setting "Allow external content". Unfortunately, it seems that non-Adobe tools ignore the external stream feature. I hope I'm wrong, therefore ask the question: How to enable external streams in Mac OS X? (I think that all the system Mac OS X tools use the same library, therefore say "Mac OS X" instead of "Preview".) Or maybe there could be a programming hook to emulate external streams? My task is: store a big set of images (total ˜300Mb) outside of a small PDF (˜1Mb). At some moment, I want to filter PDF through a quartz filter and get a PDF with the images embedded. Any suggestions are welcome.

  Read the article

• Indexing and Searching Over Word Level Annotation Layers in Lucene

  - by dmcer

  I have a data set with multiple layers of annotation over the underlying text, such as part-of-tags, chunks from a shallow parser, name entities, and others from various natural language processing (NLP) tools. For a sentence like The man went to the store, the annotations might look like: Word POS Chunk NER ==== === ===== ======== The DT NP Person man NN NP Person went VBD VP - to TO PP - the DT NP Location store NN NP Location I'd like to index a bunch of documents with annotations like these using Lucene and then perform searches across the different layers. An example of a simple query would be to retrieve all documents where Washington is tagged as a person. While I'm not absolutely committed to the notation, syntactically end-users might enter the query as follows: Query: Word=Washington,NER=Person I'd also like to do more complex queries involving the sequential order of annotations across different layers, e.g. find all the documents where there's a word tagged person followed by the words arrived at followed by a word tagged location. Such a query might look like: Query: "NER=Person Word=arrived Word=at NER=Location" What's a good way to go about approaching this with Lucene? Is there anyway to index and search over document fields that contain structured tokens?

  Read the article

• Loading default value in a dropdown and calling onchange event

  - by J. Davidson

  Hi i have following dropdown <div class="fcolumn"> <label class="text" for="o_Id">Months:</label> <select class="textMonths" id="o_Id" name="periodName" > <option value="000">Select Period--</option> </select> </div> In the following jquery, first it loads fnLoadP() in a drop down list. Than as a default I am loading one of the values in drop down which is '10'. It loads too as default value. But it should be executing $("#o_Id").change.. which it doesn't. $(document).ready(function () { var sProfileUserId = null; $("#o_Id").change(function () { //---- }); fnLoadP(); $("select[name='pName']").val('10'); }); }); Basically my goal is. After dropdown values are loaded, to load '10' as default value and call onchange event in the dom. Please let me know how to fix it.

  Read the article

• Choosing a W3C valid DOCTYPE and charset combination?

  - by George Carter

  I have a homepage with the following: <DOCTYPE html> <meta http-equiv="Content-Type" content="text/html; charset=utf-8"> My choice of the DOCTYPE "html" is based on a recommendation for html pages using jQuery. My choice of charset=utf=8 is based on a recommendation to make my pages readable on most browsers. But these choices may be wrong. When I run this page thru the W3C HTML validator, I get messages you see below. Any way I can eliminate the 2 errors? ! Using experimental feature: HTML5 Conformance Checker. The validator checked your document with an experimental feature: HTML5 Conformance Checker. This feature has been made available for your convenience, but be aware that it may be unreliable, or not perfectly up to date with the latest development of some cutting-edge technologies. If you find any issue with this feature, please report them. Thank you. Validation Output: 2 Errors 1. Error Line 18, Column 70: Changing character encoding utf-8 and reparsing. …ntent-Type" content="text/html; charset=utf-8"> 2. Error Line 18, Column 70: Changing encoding at this point would need non-streamable behavior. …ntent-Type" content="text/html; charset=utf-8">

  Read the article

• jQuery selector for option tag value attribute returns null

  - by Ben

  Hello, I am trying to change the selected option in a select dropdown box with jQuery. I have it set so that it finds the hash tag at the end of the URL and based on that hash tag it changes the selected option in the select box. Most of my code is functional, it successfully finds the hash tag and executes the if statement that corresponds with it. However, when it goes to execute the "then" section of the statement when it goes to the selector for the option (which uses an attribute selector based on the value attribute of the option tag) it returns null. If figured this out with firebug, in the console it says that the selector is null. Here is my code: $(document).ready(function() { var $hash = window.location.hash if($hash == "#htmlcss") { $('option[value="HTML/CSS Coding"]').attr("selected","selected") } if($hash == "#php") { $('option[value="PHP Coding"]').attr("selected","selected") } if($hash == "#jscript") { $('option[value="Javascript and jQuery Coding"]').attr("selected","selected") } if($hash == "#improv") { $('option[value="General Website Improvements"]').attr("selected","selected") } if($hash == "#towp") { $('option[value="Website Conversion to Wordpress"]').attr("selected","selected") } if($hash == "#wptheme") { $('option[value="Wordpress Theme Design"]').attr("selected","selected") } if($hash == "#complete") { $('option[value="Complete Website Creation"]').attr("selected","selected") } if($hash == "#server") { $('option[value="Web Server Configuration"]').attr("selected","selected") } }); So to clarify, when I enter in a url that ends in the #php hash tag, for example, the desired action does not occur which would change the "PHP Coding" option to the selected one by using the "selected" html attribute however the selector for the particular option tag returns null. Is there a problem with my syntax or is my code not functioning in the way that I think it should? Thanks very much.

  Read the article

• Jquery Returning values to original

  - by Cam

  So my script works perfectly, but here is the issue, I have buttons (Sprite action here) that are 40px height, but the top 20 only shows perfectly. When you click the button ie img the bottom 20px show perfecto! but... Issue, i included in my script a way to return all others to there default (only one should be selected) now, how can I fix this issue that I seem unable to correct as I can select multiple of them ** USERS can switch ** The last part of the script that is the issue. Thanks $(document).ready(function() { $('.form_sub').hide(); $('.theader').addClass('active'); $('.theader_t').click(function() { $('.form_header').show(); $('.form_sub').hide(); $('.theader').addClass('active'); $('.sub_theader').removeClass('active'); }); $('.sub_theader_t').click(function() { $('.form_header').hide(); $('.form_sub').show(); $('.theader').removeClass('active'); $('.sub_theader').addClass('active'); }); $('.top_head_img').click(function() { $(this).css({ position: 'relative', bottom: '20px' }).siblings().css( 'bottom', '0' ); }); }); <ul class="top_head"> <li> <a href="javascript:void(0)" onClick="selectPic5('top');"><img src="custom/images/top2.jpg" alt="Left" border="0" class="top_head_img"/></a> </li> <li> <a href="javascript:void(0)" onClick="selectPic5('center');"><img src="custom/images/mid2.jpg" alt="Center" border="0" class="top_head_img"/></a> </li> <li> <a href="javascript:void(0)" onClick="selectPic5('bottom');"><img src="custom/images/bot2.jpg" alt="Right" border="0" class="top_head_img"/></a> </li> </ul>

  Read the article

• macro collapse all in solution visual studio 2010

  - by rod

  Hi All, I found the CollapseAll macro online that has worked for me in vs2005 and vs2008. However, this half way works in vs2010. It looks like it only collapses the top nodes and not any subnodes that may be expanded? any ideas? Thanks, rod. Sub CollapseAll() ' Get the the Solution Explorer tree Dim UIHSolutionExplorer As UIHierarchy UIHSolutionExplorer = DTE.Windows.Item(Constants.vsext_wk_SProjectWindow).Object() ' Check if there is any open solution If (UIHSolutionExplorer.UIHierarchyItems.Count = 0) Then ' MsgBox("Nothing to collapse. You must have an open solution.") Return End If ' Get the top node (the name of the solution) Dim UIHSolutionRootNode As UIHierarchyItem UIHSolutionRootNode = UIHSolutionExplorer.UIHierarchyItems.Item(1) UIHSolutionRootNode.DTE.SuppressUI = True ' Collapse each project node Dim UIHItem As UIHierarchyItem For Each UIHItem In UIHSolutionRootNode.UIHierarchyItems 'UIHItem.UIHierarchyItems.Expanded = False If UIHItem.UIHierarchyItems.Expanded Then Collapse(UIHItem) End If Next ' Select the solution node, or else when you click ' on the solution window ' scrollbar, it will synchronize the open document ' with the tree and pop ' out the corresponding node which is probably not what you want. UIHSolutionRootNode.Select(vsUISelectionType.vsUISelectionTypeSelect) UIHSolutionRootNode.DTE.SuppressUI = False End Sub Private Sub Collapse(ByVal item As UIHierarchyItem) For Each eitem As UIHierarchyItem In item.UIHierarchyItems If eitem.UIHierarchyItems.Expanded AndAlso eitem.UIHierarchyItems.Count > 0 Then Collapse(eitem) End If Next item.UIHierarchyItems.Expanded = False End Sub End Module

  Read the article

• ASP.NET - Webservice not being called from javascript

  - by Robert

  Ok I'm stumped on this one. I've got a ASMX web service up and running. I can browse to it (~/Webservice.asmx) and see the .NET generated page and test it out.. and it works fine. I've got a page with a Script Manager with the webservice registered... and i can call it in javascript (Webservice.Method(...)) just fine. However, I want to use this Webservice as part of a jQuery Autocomplete box. So I have use the url...? and the Webservice is never being called. Here's the code. [WebService(Namespace = "http://tempuri.org/")] [WebServiceBinding(ConformsTo = WsiProfiles.BasicProfile1_1)] // To allow this Web Service to be called from script, using ASP.NET AJAX, uncomment the following line. [System.Web.Script.Services.ScriptService] public class User : System.Web.Services.WebService { public User () { //Uncomment the following line if using designed components //InitializeComponent(); } [WebMethod] public string Autocomplete(string q) { StringBuilder sb = new StringBuilder(); //doStuff return sb.ToString(); } web.config <system.web> <webServices> <protocols> <add name="HttpGet"/> <add name="HttpPost"/> </protocols> </webServices> And the HTML $(document).ready(function() { User.Autocomplete("rr", function(data) { alert(data); });//this works ("#<%=txtUserNbr.ClientID %>").autocomplete("/User.asmx/Autocomplete"); //doesn't work $.ajax({ url: "/User.asmx/Autocomplete", success: function() { alert(data); }, error: function(e) { alert(e); } }); //just to test... calls "error" function });

  Read the article

• Capture and handling the tab/Textchanged event in a textbox in asp.net MVC

  - by Icerman

  I have the following code th handle a user name validation on the server side. But the event seems not firing since break points in js or C# code didn't hit. Can anyone point out where I did wrong? Here is the user control which has a user name textbox: <%: Html.TextBox("UserName", Model.Username, new { maxlength = "40", size = "20", tabindex = "1", @onchange = "CheckAvailability()" })% CheckAvailability() is defined in the User.Validation.js and included in the above user control: $(document).ready(function () { function CheckAvailability() { $.post("/Home/Survey/CheckAvailability", { Username: $("#UserName").val() }, function (data) { var myObject = eval('(' + data + ')'); var newid = myObject; if (newid == 0) { $("#usernamelookupresult").html("<font color='green'>Available :-D</font>") } else { $("#usernamelookupresult").html("<font color='red'>Taken :-(</font>") } }); } }); Here is the survey controller function which will have server side validation: [HttpPost] public ActionResult CheckAvailability(string Username) { int Taken = 0; // This is where you add your database lookup if (Username == "abc") { Taken = 1; } return Json(Taken); }

  Read the article

• Add xml-stylesheet and get standalone = yes.

  - by tumba25

  The code at the bottom is what I have. I removed the creation of all tags. At the top in the xml file I get.<?xml version="1.0" encoding="UTF-8" standalone="no"?> Note that standalone is no, even thou I have it set to yes. The first question: How do I get standalone = yes? I would like to add <?xml-stylesheet type="text/xsl" href="my.stylesheet.xsl"?> at line two in the xml file. Second question: How do I do that? Some useful links? Anything? DocumentBuilderFactory dbfac = DocumentBuilderFactory.newInstance(); DocumentBuilder docBuilder = dbfac.newDocumentBuilder(); Document doc = docBuilder.newDocument(); <cut> TransformerFactory transfac = TransformerFactory.newInstance(); transfac.setAttribute("indent-number", new Integer(2)); Transformer trans = transfac.newTransformer(); trans.setOutputProperty(OutputKeys.OMIT_XML_DECLARATION, "no"); trans.setOutputProperty(OutputKeys.STANDALONE, "yes"); trans.setOutputProperty(OutputKeys.INDENT, "yes"); trans.setOutputProperty(OutputKeys.CDATA_SECTION_ELEMENTS, "name"); FileOutputStream fout = new FileOutputStream(filepath); BufferedOutputStream bout= new BufferedOutputStream(fout); trans.transform(new DOMSource(doc), new StreamResult(new OutputStreamWriter(bout, "utf-8")));

  Read the article

• Loading a CSV file using jQuery GET returns the header but no data

  - by Cees Meijer

  When reading a CSV file from a server using the jQuery 'GET' function I do not get any data. When I look at the code using FireBug I can see the GET request is sent and the return value is '200 OK'. Also I see that the header is returned correctly so the request is definitely made, and data is returned. This is also what I see in Wireshark. Here I see the complete contents of the CSV file is returned as a standard HTTP response. But the actual data is not there in my script. Firebug shows an empty response and the 'success' function is never called. What could be wrong ? <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN" "http://www.w3.org/TR/html4/loose.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title>New Web Project</title> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <script src="jquery.js" type="text/javascript" charset="utf-8"></script> <script type="text/javascript"> var csvData; $(document).ready(function() { $("#btnGET").click(function() { csvData = $.ajax({ type: "GET", url: "http://www.mywebsite.com/data/sample_file.csv", dataType: "text/csv", success: function () { alert("done!"+ csvData.getAllResponseHeaders()) } }); }); }) </script> </head> <body> <h1>New Web Project Page</h1> <button id="btnGET">GET Data</button> </body> </html>

  Read the article

• Select ID in table ...

  - by Kris-I

  Hello, I have this code <% foreach (var item in Model.List) { %> <tr> <td><%: item.LastName %></td> <td><%: item.FirstName %></td> <td><%: item.IsEnable %></td> <td><a href="#" class="CustomerEdit">Edit</a></td> <td><a href="#" class="CustomerDetail">Detail</a></td> <td><a href="#" class="CustomerDelete">Delete</a></td> </tr> <% } %> <script language="javascript" type="text/javascript"> $(document).ready(function () { $(".CustomerEdit").click(function () { alert("blabla"); //need id here }); }); </script> It's not in the code but I have an "Item.Id", it's not place anywhere because I don't know where place it ;-). I'd like when I click on the "Edit" hyperlink get the id (item.Id) of the current line. Any idea ? Thanks,

  Read the article

• how do I call a javacript function every 60 seconds?

  - by William

  So I'm trying to work on a Canvas demo, and I want this square to move from one side to the other, but I can't figure out how to call javascript in a way that repeats every 60 seconds. Here's what I got so far: <!DOCTYPE html> <html lang="en"> <head> <title>Canvas test</title> <meta charset="utf-8" /> <link href="/bms/style.css" rel="stylesheet" /> <style> body { text-align: center; background-color: #000000;} canvas{ background-color: #ffffff;} </style> <script type="text/javascript"> var x = 50; var y = 250; function update(){ draw(); x = x + 5; } function draw(){ var canvas = document.getElementById('screen1'); if (canvas.getContext){ var ctx = canvas.getContext('2d'); ctx.fillStyle = 'rgb(236,138,68)'; ctx.fillRect(x,y,24,24); } } </script> </head> <body onLoad="setTimeout(update(), 0);"> <canvas id="screen1" width="500" height="500"></canvas> </body> </html>

  Read the article

• Event type property lost in IE-8

  - by Channel72

  I've noticed a strange Javascript error which only seems to happen on Internet Explorer 8. Basically, on IE-8 if you have an event handler function which captures the event object in a closure, the event "type" property seems to become invalidated from within the closure. Here's a simple code snippet which reproduces the error: <html> <head> <script type = "text/javascript"> function handleClickEvent(ev) { ev = (ev || window.event); alert(ev.type); window.setTimeout(function() { alert(ev.type); // Causes error on IE-8 }, 20); } function foo() { var query = document.getElementById("query"); query.onclick = handleClickEvent; } </script> </head> <body> <input id = "query" type = "submit"> <script type = "text/javascript"> foo(); </script> </body> </html> So basically, what happens here is that within the handleClickEvent function, we have the event object ev. We call alert(ev.type) and we see the event type is "click". So far, so good. But then when we capture the event object in a closure, and then call alert(ev.type) again from within the closure, now all of a sudden Internet Explorer 8 errors, saying "Member not found" because of the expression ev.type. It seems as though the type property of the event object is mysteriously gone after we capture the event object in a closure. I tested this code snippet on Firefox, Safari and Chrome, and none of them report an error condition. But in IE-8, the event object seems to become somehow invalidated after it's captured in the closure. Question: Why is this happening in IE-8, and is there any workaround?

  Read the article

• Problem uploading app to google app engine

  - by Oberon

  I'm having problems uploading an app to the google-app-engine from my work place. I believe the problem is related to proxy, because I do not see the same problem when following the same procedure from home. (I do not specify HTTP_PROXY from home). These are the commands I run: HTTP_PROXY=http://proxy.<thehostname>.com:8080 HTTP_PROXY=https://proxy.<thehostname>.com:8080 appcfg.py --insecure update myappfolder When running the commands I get prompted for email and password, as expected, but after that it immediately exits with this errormessage: Error 302: --- begin server output --- <HTML> <HEAD> <TITLE>Moved Temporarily</TITLE> </HEAD> <BODY BGCOLOR="#FFFFFF" TEXT="#000000"> <H1>Moved Temporarily</H1> The document has moved <A HREF="https://www.google.com/accounts/ClientLogin">here</A>. </BODY> </HTML> --- end server output --- Note: I added the --insecure option because else it gave a warning of missing ssl module. Any idea how to solve or workaround this problem?

  Read the article

• Execute javascript in PHP

  - by Andreas Bonini

  I'm generating your typical Web 2.0 HTML page with PHP: it contains a lot of <script> tags and javascript code that will substantially change the DOM after the load event. Is there a way to get the final HTML code directly from PHP, without opening the page with any browser? For example, let's say the HTML for the page is (it's just an example): <html> <head> <script>...the jquery library code...</script> <script>$(document).ready(function() { $("body").append("<p>Hi!</p>");</script> </head> <body> </body> </html> This HTML is saved in the $html PHP variable. Now, I want to pass that variable to some function that will return $result = <html>....<body><p>Hi!</p></body></html>. Is this possible?

  Read the article

• JQuery fadeIn fadeOut loop issue

  - by Tarun

  I am trying to create a jQuery fadeIn fadeout effect for my page content using the code below. $(document).ready(function (){ $("#main").click(function(){ $("#content").fadeOut(800, function(){ $("#content").load("main.html", function(){ $("#content").fadeIn(800); }); }); }); $("#gallery").click(function(){ $("#content").fadeOut(800, function(){ $("#content").load("gallery.html", function(){ $("#content").fadeIn(800); }); }); }); }); So whenever a user clicks on either the main link or gallery link, the old content fades out and new content fades in. The problem I am facing is that for every link I have to repeat the same code again and again. So I tried to use a loop to simplify this but it doesn't work. Here is my code: var p = ["#main","#gallery", "#contact"]; var q = ["main.html", "gallery.html", "contact.html"]; for (i=0;i<=(p.length-1);i++){ $(p[i]).click(function(){ $("#content").fadeOut(500, function(){ $("#content").load(q[i], function(){ $("#content").fadeIn(500); }); }); }); } It works fine when I write repeat the scripts for each link but it doesn't work when I combine them in a loop. I only get the FadeOut effect and nothing happens after that. This might be a very simple issue or may be something deep into jQuery. Any hint or help is greatly appreciated. TK

  Read the article

• Calling jQuery method from onClick attribute in HTML

  - by Russell

  I am relatively new to implementing JQuery throughout an entire system, and I am enjoying the opportunity. I have come across one issue I would love to find the correct resolve for. Here is a simple case example of what I want to do: I have a button on a page, and on the click event I want to call a jquery function I have defined. Here is the code I have used to define my method (Page.js): (function($) { $.fn.MessageBox = function(msg) { alert(msg); }; }); And here is my HTML page: <HTML> <head> <script type="text/javascript" src="C:\Sandpit\jQueryTest\jquery-1.3.2.js"></script> <script language="javascript" src="Page.js"></script> </head> <body> <div class="Title">Welcome!</div> <input type="button" value="ahaha" onclick="$().MessageBox('msg');" /> </body> </HTML> (The above code displays the button, but clicking does nothing.) I am aware I could add the click event in the document ready event, however it seems more maintainable to put events in the HTML element instead. However I have not found a way to do this. Is there a way to call a jquery function on a button element (or any input element)? Or is there a better way to do this? Thanks

  Read the article

< Previous Page | 490 491 492 493 494 495 496 497 498 499 500 501  | Next Page >