Search Results

Search found 14506 results on 581 pages for 'document scanner'.

Page 494/581 | < Previous Page | 490 491 492 493 494 495 496 497 498 499 500 501  | Next Page >

• How do I get NHibernate to work with .NET Framework 2.0?

  - by Daniel Dolz

  I can not make NHibernate 2.1 work in machines without framework 3.X (basically, windows 2000 SP4, although it happens with XP too). NHibernate doc do not mention this. Maybe you can help? I NEED to make NHibernate 2.1 work in Windows 2000 PCs, do you think this can be done? PD: DataBase is SQL 2000/2005. Error is: NHibernate.MappingException: Could not compile the mapping document: Datos.NH_VEN_ComprobanteBF.hbm.xml ---> NHibernate.HibernateException: Could not instantiate dialect class NHibernate.Dialect.MsSql2000Dialect ---> System.Reflection.TargetInvocationException: Se produjo una excepción en el destino de la invocación. ---> System.TypeInitializationException: Se produjo una excepción en el inicializador de tipo de 'NHibernate.NHibernateUtil'. ---> System.TypeLoadException: No se puede cargar el tipo 'System.DateTimeOffset' del ensamblado'mscorlib, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089'. en NHibernate.Type.DateTimeOffsetType.get_ReturnedClass() en NHibernate.NHibernateUtil..cctor() --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Dialect.Dialect..ctor() en NHibernate.Dialect.MsSql2000Dialect..ctor() --- Fin del seguimiento de la pila de la excepción interna --- en System.RuntimeTypeHandle.CreateInstance(RuntimeType type, Boolean publicOnly, Boolean noCheck, Boolean& canBeCached, RuntimeMethodHandle& ctor, Boolean& bNeedSecurityCheck) en System.RuntimeType.CreateInstanceSlow(Boolean publicOnly, Boolean fillCache) en System.RuntimeType.CreateInstanceImpl(Boolean publicOnly, Boolean skipVisibilityChecks, Boolean fillCache) en System.Activator.CreateInstance(Type type, Boolean nonPublic) en NHibernate.Bytecode.ActivatorObjectsFactory.CreateInstance(Type type) en NHibernate.Dialect.Dialect.InstantiateDialect(String dialectName) --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Dialect.Dialect.InstantiateDialect(String dialectName) en NHibernate.Dialect.Dialect.GetDialect(IDictionary`2 props) en NHibernate.Cfg.Configuration.AddValidatedDocument(NamedXmlDocument doc) --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Cfg.Configuration.LogAndThrow(Exception exception) en NHibernate.Cfg.Configuration.AddValidatedDocument(NamedXmlDocument doc) en NHibernate.Cfg.Configuration.ProcessMappingsQueue() and continues...

  Read the article

• How do I use HTML5's localStorage in a Google Chrome extension?

  - by davidkennedy85

  I am trying to develop an extension that will work with Awesome New Tab Page. I've followed the author's advice to the letter, but it doesn't seem like any of the script I add to my background page is being executed at all. Here's my background page: <script> var info = { poke: 1, width: 1, height: 1, path: "widget.html" } chrome.extension.onRequestExternal.addListener(function(request, sender, sendResponse) { if (request === "mgmiemnjjchgkmgbeljfocdjjnpjnmcg-poke") { chrome.extension.sendRequest( sender.id, { head: "mgmiemnjjchgkmgbeljfocdjjnpjnmcg-pokeback", body: info, } ); } }); function initSelectedTab() { localStorage.setItem("selectedTab", "Something"); } initSelectedTab(); </script> Here is manifest.json: { "update_url": "http://clients2.google.com/service/update2/crx", "background_page": "background.html", "name": "Test Widget", "description": "Test widget for mgmiemnjjchgkmgbeljfocdjjnpjnmcg.", "icons": { "128": "icon.png" }, "version": "0.0.1" } Here is the relevant part of widget.html: <script> var selectedTab = localStorage.getItem("selectedTab"); document.write(selectedTab); </script> Every time, the browser just displays null. The local storage isn't being set at all, which makes me think the background page is completely disconnected. Do I have something wired up incorrectly?

  Read the article

• undefined method `key?' for nil:NilClass when using MongoMapper

  - by Radek Slupik

  I set up a new Rails application by following these instructions. I generated a new controller and added resources :tickets to the routes file. Hexapoda::Application.routes.draw do resources :tickets end This is the controller (`/app/controllers/tickets_controller.rb'). class TicketsController < ApplicationController def index @tickets = Ticket.all end end I then added a new model Ticket in /app/models/ticket.rb. class Ticket include MongoMapper::Document key :summary, String, :required => true end Here's the view (/app/views/index.html.erb): <h1>Tickets#index</h1> <p>Find me in app/views/tickets/index.html.erb</p> Now when I go to /tickets in my browser, I get an error message. NoMethodError in TicketsController#index undefined method `key?' for nil:NilClass I have no idea what's going on. What could be the problem? I'm using Rails 3.2.5 and MongoMapper 0.11.1.

  Read the article

• Can someone tell me why this JavaScript code isn't lining up an array in order?

  - by DarkLightA

  Live code: http://jsfiddle.net/fCUZC/ //INPUT ARRAY: var input = [28,32,21,11,8,2,14,32,64]; //VARIABLE DECLARATION. a = highest number so far, b = position of that number entireLoop: for (var i = 1; i<=input.length; i++) { if(input[i] > input[i-1]) { for(var o = i; o>=0; o--) { if(input[i-1] > input[o]) { input.splice(i,0,input[o]); input.splice((o+1),1); continue entireLoop; } else if(input[o] > input[0]) { input.splice(0,0,input[o]); input.splice((o+1),1); continue entireLoop; } } } } document.write(input); I'm trying to order the array from largest to smallest, but there's a 32 stuck somewhere. I know there's the sort method, but I'm a newbie and want to try this for myself.

  Read the article

• Which pdf elements could cause crashes?

  - by Felixyz

  This is a very general question but it's based on a specific problem. I've created a pdf reader app for the iPad and it works fine except for certain pdf pages which always crash the app. We now found out that the very same pages cause Safari to crash as well, so as I had started to suspect the problem is somewhere in Apple's pdf rendering code. From what I have been able to see, the crashing pages cause the rendering libraries to start allocating memory like mad until the app is killed. I have nothing else to help me pinpoint what triggers this process. It doesn't necessarily happen with the largest documents, or the ones with the most shapes. In fact, we haven't found any parameter that helps us predict which pages will crash and which not. Now we just discovered that running the pages through a consumer program that lets you merge docs gets rid of the problem, but I haven't been able to detect which attribute or element it is that is the key. Changing documents by hand is also not an option for us in the long run. We need to run an automated process on our server. I'm hoping someone with deeper knowledge about the pdf file format would be able to point me in a reasonable direction to look for document features that could cause this kind of behavior. All I've found so far is something about JBIG2 images, and I don't think we have any of those.

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• Syntax for documenting JSON structure

  - by Roman A. Taycher

  So I'm trying to document the format of the json returned by an api I am writing against and I'd like to know if there is any popular format for the documentation of json structure. Note I'm not trying to to test or validate anything, I'm just using this for documentation. Also some ways to add comments to non-constants(items always returned w/ the same value) would be nice. This the not totally thought out scheme I'm currently using: Plain names refer to identifiers or types. Some types have type-comment Strings that appear to be constant(always returned for that type of request) strings are "str" Constant Numbers would be just the number Constant null is null Booleans are true/false for constant booleans or Boolean otherwise [a,b,c] are lists with 3 items a,b,c [... ...] is a list of repeating elements of some types/constants/patterns {a:A,b:B,c:c} and {... ...} is the same for a dictionary. example: story := [header,footer] header := {"data":realHeader,"kind":"Listing"} realHeader := {"after": null, "before": null, "children": [{"data": realRealHeader, "kind": "t3"}], "modhash": ""} footer := {"data":AlmostComments,"kind":"Listing"} AlmostComments := {"data": {"after": null, "before": null, "children": comments, "modhash": ""}, "kind": "t1"} comments := [...{"data":comment, "kind":"t1"}...] realRealHeader := {"author": string, "clicked": boolean, "created": int, "created_utc": int, "domain": "code.reddit.com", "downs": int, "hidden": boolean, "id": string-id, "is_self": boolean, "levenshtein": null, "likes": null, "media": null, "media_embed": { }, "name": string-id, "num_comments": int, "over_18": false, "permalink": string-urlLinkToStoryStartingFrom/r, "saved": false, "score": int, "selftext": string, "selftext_html": string-html, "subreddit": string-subredditname, "subreddit_id": string-id, "thumbnail": "", "title": string, "ups": int, "url": "http://code.reddit.com/" } comments := { "author": string, "body": string-body_html-wout-html, "body_html": string-html-formated, "created": int, "created_utc": int, "downs": int, "id": string-id, "levenshtein": null, "likes": null, "link_id": string-id, "name": string-id", "parent_id": string-id, "replies": AlmostComments or null, "subreddit": string-subredditname, "subreddit_id": string-id, "ups": int }

  Read the article

• jQuery - Unchecking checkboxes that act like radio buttons

  - by Cecil

  Hey All, I have the following jQuery code to make my checkboxes act like radio buttons, so that only 1 of the 3 can be checked at a time. <script type="text/javascript" language="javascript"> $(document).ready(function() { $("#testing input:checkbox").change(function(){ var checkname = $(this).attr("name"); $("input:checkbox[name='" + checkname + "']").removeAttr("checked"); this.checked = true; }); }); </script> The checkboxes are layed out like the following: <input type="checkbox" id="testing" name="testing" value="B"> <input type="checkbox" id="testing" name="testing" value="I"> <input type="checkbox" id="testing" name="testing" value="A"> This works exactly how i want it to work, not a problem, except once i click one of the 3, i cant unclick it so that none of them are checked, this is what i want to happen, so along with being only able to click one at a time, im able to uncheck them completely. Any help would be grand :)

  Read the article

• Syntax Error? When parsing XML value

  - by Ace Munim

  I don't know if I'm having a syntax error but the compiler is giving me TypeError: 'undefined' is not an object (evaluating 'xmlDoc.getElementsByTagName("icon")[i].childNodes') Its me giving me this problem when im parsing the XML from my server, my actual javascript code is like this var xmlDoc = Obj.responseXML; var count = 0; if(xmlDoc){ while(count <= xmlDoc.getElementsByTagName("item").length){ document.getElementById("flow").innerHTML += "<div class='item'><img class='content' src='" + xmlDoc.getElementsByTagName("icon")[i].childNodes[0].nodeValue.replace(/\s+$/g,' ') +"' /></div>"; count++; } }else{ alert("Unable to parse!"); } and my XML goes like this. <feed> <item> <title>Given Title</title> <icon> http://i178.photobucket.com/albums/w255/ace003_album/Logo-ETC-RGB-e1353503652739.jpg </icon> </item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> </feed> i just want to parse the image link and to show it.

  Read the article

• Browser freezes when try to call a JS function along with submission of a form.

  - by Waseem

  I have form in my view like following 1 <div> 2 <% form_tag facebook_user_path do %> 3 <label>Use my photo and name from facebook?</label><br /> 4 <%= check_box_tag 'use_name_and_photo', 'yes', true %> 5 <img src="<%= @user.pic %>" /><% @user.name %> 6 7 <%= submit_tag "Finish", :id => "use_name_and_photo_submit" %> 8 <% end %> 9 </div> I have attached some JS handlers using Jquery to this form. 1 var fb = { 2 extendedPermissions: function () { 3 $("#use_name_and_photo_submit").click(function (event) { 4 FB.Connect.showPermissionDialog("email,read_stream,publish_stream", function (perms) { 5 if (!perms) { 6 alert("You have to grant facebook extended permissions to further browse the application."); 7 } else { 8 $("form").submit(function () { 9 $.post($(this).attr("action"), $(this).serialize(), null, "script"); 10 }); 11 } 12 }); 13 event.preventDefault(); 14 return false; 15 }); 16 } 17 }; 18 19 $(document).ready(function () { 20 fb.extendedPermissions(); 21 }); What I want is that when the user clicks on the "Finish" button, he is prompted for the facebook permissions dialogue and when he gives the permissions, the form is submitted to FacebookUsersController. Right now when I click the "Finish" button, facebook permissions dialogue is initiated but before I am prompted for the actual permission submission window, the browser freezes. Just like I have pressed Esc during the process. In fact status bar of the browser says "Stopped". Any help is highly appreciated.

  Read the article

• How to select LI except first and second ?

  - by Wazdesign

  Here is the structure of the content, I want to select all LI except the first two (ie no-link) jQuery(document).ready(function(){ var nosubnav = jQuery('.first-level li:not(:has(ul))'); var nosubnavsize = jQuery('.first-level li:not(:has(ul))').size(); jQuery(nosubnav).css('border' , '1px solid red'); alert('List item which does not have submenu '+nosubnavsize); }); div class="navigation-container"> <ul class="first-level"> <li><a href="#">No Link</a></li> <li><a href="#">No Link</a></li> <li><a href="#">Link 1</a></li> <li><a href="#">Link 2</a> <ul> <li><a href="#">Link2.1</a></li> <li><a href="#">Link2.2</a> <ul> <li><a href="#">Link 2.2.1</a></li> </ul> </li> </ul> </li> <li><a href="#">Link </a></li> </ul> </div> related Question : http://stackoverflow.com/questions/2771801/how-to-count-li-which-does-not-have-ul

  Read the article

• Embedding XSL Stylesheet into XML

  - by user700996

  I have the following XML: <?xml version="1.0" encoding="ISO-8859-1"?> <?xml-stylesheet type="text/xsl" href="http://www.fakedomain.com/sally.xsl"?> And the following content in sally.xsl: <?xml version="1.0" encoding="ISO-8859-1"?> <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:template match="/"> <html> <body> <xsl:for-each select="documentcollection/document"> <p> <xsl:for-each select="rss/channel/item"> <xsl:value-of select="title"/><br /> <xsl:value-of select="description"/><br /> <xsl:value-of select="link"/><br /> </xsl:for-each> </p> </xsl:for-each> </body> </html> </xsl:template> </xsl:stylesheet> However, the browser displays the XML as though the XSL line is not present. Do you know why the browser is ignoring the XSL stylesheet? Is the style sheet wrong? Thanks

  Read the article

• curl post picture multipart/form-data, php cURL need help!

  - by user331071

  I'm trying to upload a picture to a specific website using php cURL but I don't really understand what parameters do I need to send because the data looks a bit weird . Here is what i got with the http analyzer Type : multipart/form-data; boundary=---------------------------182983931283 -----------------------------182983931283 Content-Disposition: form-data; name="file"; filename="Blue hills.jpg" Content-Type: image/jpeg Here appears the souce of the image itself like "ÿØÿàÿØÿàÿØÿàÿØÿàÿØÿàÿØÿà" -----------------------------182983931283 Content-Disposition: form-data; name="action" images -----------------------------182983931283 Content-Disposition: form-data; name="anonymous_email" Y -----------------------------182983931283 Content-Disposition: form-data; name="site_id" 1 -----------------------------182983931283 and so on other parameters. The issue that I have is that I don't understand what is the boundary, where do I get it from (because it doesn't appear in the html document that generates the POST and how should I make the post . If you would give me a simple example to post the above parameters to http://example.com I will definitely get the trick . Currently I'm using the following function to make the post : function processPicturesPage($title, $price, $numbedrooms, $description) { //Set the login parameters and initiate the Login process $fields = array( "changedImages" = "", "site_id" = "1", "posting_id" = "", "current_live_date" = "", "images_loaded" = "", "image_actions" = "", "title" = $title, ); foreach($fields as $key=$value) { $fields_string .= $key.'='.$value.'&'; } rtrim($fields_string,'&'); $URL = "http://www.example.com/cgi-bin/add_posting.pl"; return $this-processCurlrequest($URL, count($fields), $fields_string); } and in the processCurlrequest I have the curl options (cookies etc) and url .

  Read the article

• Jquery Returning values to original

  - by Cam

  So my script works perfectly, but here is the issue, I have buttons (Sprite action here) that are 40px height, but the top 20 only shows perfectly. When you click the button ie img the bottom 20px show perfecto! but... Issue, i included in my script a way to return all others to there default (only one should be selected) now, how can I fix this issue that I seem unable to correct as I can select multiple of them ** USERS can switch ** The last part of the script that is the issue. Thanks $(document).ready(function() { $('.form_sub').hide(); $('.theader').addClass('active'); $('.theader_t').click(function() { $('.form_header').show(); $('.form_sub').hide(); $('.theader').addClass('active'); $('.sub_theader').removeClass('active'); }); $('.sub_theader_t').click(function() { $('.form_header').hide(); $('.form_sub').show(); $('.theader').removeClass('active'); $('.sub_theader').addClass('active'); }); $('.top_head_img').click(function() { $(this).css({ position: 'relative', bottom: '20px' }).siblings().css( 'bottom', '0' ); }); }); <ul class="top_head"> <li> <a href="javascript:void(0)" onClick="selectPic5('top');"><img src="custom/images/top2.jpg" alt="Left" border="0" class="top_head_img"/></a> </li> <li> <a href="javascript:void(0)" onClick="selectPic5('center');"><img src="custom/images/mid2.jpg" alt="Center" border="0" class="top_head_img"/></a> </li> <li> <a href="javascript:void(0)" onClick="selectPic5('bottom');"><img src="custom/images/bot2.jpg" alt="Right" border="0" class="top_head_img"/></a> </li> </ul>

  Read the article

• Problem uploading app to google app engine

  - by Oberon

  I'm having problems uploading an app to the google-app-engine from my work place. I believe the problem is related to proxy, because I do not see the same problem when following the same procedure from home. (I do not specify HTTP_PROXY from home). These are the commands I run: HTTP_PROXY=http://proxy.<thehostname>.com:8080 HTTP_PROXY=https://proxy.<thehostname>.com:8080 appcfg.py --insecure update myappfolder When running the commands I get prompted for email and password, as expected, but after that it immediately exits with this errormessage: Error 302: --- begin server output --- <HTML> <HEAD> <TITLE>Moved Temporarily</TITLE> </HEAD> <BODY BGCOLOR="#FFFFFF" TEXT="#000000"> <H1>Moved Temporarily</H1> The document has moved <A HREF="https://www.google.com/accounts/ClientLogin">here</A>. </BODY> </HTML> --- end server output --- Note: I added the --insecure option because else it gave a warning of missing ssl module. Any idea how to solve or workaround this problem?

  Read the article

• Event type property lost in IE-8

  - by Channel72

  I've noticed a strange Javascript error which only seems to happen on Internet Explorer 8. Basically, on IE-8 if you have an event handler function which captures the event object in a closure, the event "type" property seems to become invalidated from within the closure. Here's a simple code snippet which reproduces the error: <html> <head> <script type = "text/javascript"> function handleClickEvent(ev) { ev = (ev || window.event); alert(ev.type); window.setTimeout(function() { alert(ev.type); // Causes error on IE-8 }, 20); } function foo() { var query = document.getElementById("query"); query.onclick = handleClickEvent; } </script> </head> <body> <input id = "query" type = "submit"> <script type = "text/javascript"> foo(); </script> </body> </html> So basically, what happens here is that within the handleClickEvent function, we have the event object ev. We call alert(ev.type) and we see the event type is "click". So far, so good. But then when we capture the event object in a closure, and then call alert(ev.type) again from within the closure, now all of a sudden Internet Explorer 8 errors, saying "Member not found" because of the expression ev.type. It seems as though the type property of the event object is mysteriously gone after we capture the event object in a closure. I tested this code snippet on Firefox, Safari and Chrome, and none of them report an error condition. But in IE-8, the event object seems to become somehow invalidated after it's captured in the closure. Question: Why is this happening in IE-8, and is there any workaround?

  Read the article

• Trying to fadein divs in a sequence, over time, using JQuery

  - by user346602

  Hi, I'm trying to figure out how to make 4 images fade in sequentially when the page loads. The following is my (amateurish) code: Here is the HTML: <div id="outercorners"> <img id="corner1" src="images/corner1.gif" width="6" height="6" alt=""/> <img id="corner2" src="images/corner2.gif" width="6" height="6" alt=""/> <img id="corner3" src="images/corner3.gif" width="6" height="6" alt=""/> <img id="corner4" src="images/corner4.gif" width="6" height="6" alt=""/> </div><!-- end #outercorners--> Here is the JQuery: $(document).ready(function() { $("#corner1").fadeIn("2000", function(){ $("#corner3").fadeIn("4000", function(){ $("#corner2").fadeIn("6000", function(){ $("#corner4").fadeIn("8000", function(){ }); }); }); }); Here is the css: #outercorners { position: fixed; top:186px; left:186px; width:558px; height:372px; } #corner1 { position: fixed; top:186px; left:186px; display: none; } #corner2 { position: fixed; top:186px; left:744px; display: none; } #corner3 { position: fixed; top:558px; left:744px; display: none; } #corner4 { position: fixed; top:558px; left:186px; display: none; } They seem to just wink at me, rather than fade in in the order I've ascribed to them. Should I be using the queue() function? And, if so, how would I implement it in this case? Thank you for any assistance.

  Read the article

• add dynamic field near his parent field?

  - by Kaps Hasija

  hi in my web page i am using Add Dynamic Field Functionality by using jquery. I am adding new div bu clicking on Existing div Like <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> by clicking on parent div i am creating new daynamic div <div class="divA">DivA2 </div> its coming end of the all div's like that <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> <div class="divA">DivA2 </div> But i need along with his parent div Like that <div class="divA">divA1 </div> <div class="divA">DivA2 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> any idea Thanks. This is My Jquery Code newTextBoxDiv = $(document.createElement('div')) .attr("id", text).attr("class", 'test0 ' + text); newTextBoxDiv.html('<div style=" width:150px; class="DivA" float: left"> </div>'); } newTextBoxDiv.appendTo("#contents"); contents is id of main div

  Read the article

• Why aren't these Canvases rendering?

  - by bpapa

  I'm creating a web app that allows users to enter a number of colors, by specifying RGB values. Upon submission, the user will see a canvas with a solid rectangle drawn in the color chosen. On this page, I have 7 canvases. The first one draws just fine, but none of the rest show up. The browser is Safari. Here's the relevant code: First, the script element in the header, which defines the function I use to draw to the canvas. <script language="JavaScript" TYPE="text/javascript"><!-- function drawCanvas(canvasId, red, green, blue) { var theCanvas = document.getElementById("canvas" + canvasId); var context = theCanvas.getContext("2d"); context.clearRect(0,0,100,100); context.setFillColor(red,green,blue,1.0); context.fillRect(0,0,100,100); } // --> </script> Next, the HTML source, where I have my canvas tags and some embedded Javascript to call my drawCanvas function <canvas id="canvas0" width="100" height="100"> </canvas> <script language="JavaScript" TYPE="text/javascript"><!-- drawCanvas(0,250,0,0); // --> </script> . . //more source . <canvas id="canvas1" width="100" height="100"> </canvas> <script language="JavaScript" TYPE="text/javascript"><!-- drawCanvas(1,4,250,6); // --> </script> Also provided is a screenshot. As you can see, the "red" canvas comes up just fine, but the second one, which should be green, doesn't show up at all. Any ideas?

  Read the article

• Why don't copy this dokument attributes from the source xml file??

  - by siegfried storr

  Hi anyone, i'm working the first time with xslt and i really don't understand why this xsl don't copy attributes from the source xml. Perhaps someone can give me a hint?? <xsl:stylesheet version="2.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:output omit-xml-declaration="yes" indent="yes"/> <xsl:variable name="rpl" select="document('ParamInvoice.xml')"/> <xsl:template match="/"> <xsl:copy> <xsl:apply-templates select="* | @*"/> </xsl:copy> </xsl:template> <xsl:template match="*"> <xsl:variable name="vInvoiceElement" select="$rpl/StoraInvoice/*[name()=name(current())]"/> <xsl:copy> <xsl:if test="$vInvoiceElement/Attribute"> <xsl:call-template name="AttributeErzeugen"> <xsl:with-param name="pAttr" select="$vInvoiceElement/Attribute"/> </xsl:call-template> </xsl:if> <xsl:apply-templates/> </xsl:copy> </xsl:template> <xsl:template name="AttributeErzeugen"> <xsl:param name="pAttr"/> <xsl:for-each select="$pAttr"> <xsl:attribute name="{@name}"><xsl:value-of select="."/></xsl:attribute> </xsl:for-each> </xsl:template> </xsl:stylesheet>

  Read the article

• Latex multicols. Can I group content so it won't split over cols and/or suggest colbreaks?

  - by valadil

  Hi. I'm trying to learn LaTeX. I've been googling this one for a couple days, but I don't speak enough LaTeX to be able to search for it effectively and what documentation I have found is either too simple or goes way over my head (http://www.uoregon.edu/~dspivak/files/multicol.pdf) I have a document using the multicol package. (I'm actually using multicols* so that the first col fills before the second begins instead of trying to balance them, but I don't think that's relevant here.) The columns output nicely, but I want to be able to indicate that some content won't be broken up into different columns. For instance, aaaaaaaa bbbbbbb aaaaaaaa bbbbbbb aaaaaaaa ccccccc bbbbbbbb ccccccc That poor attempt at ascii art columns is what's happening. I'd like to indicate that the b block is a whole unit that shouldn't be broken up into different columns. Since it doesn't fit under the a block, the entirety of the b block should be moved to the second column. Should b be wrapped in something? Is there a block/float/section/box/minipage/paragraph structure I can use? Something specific to multicol? Alternatively is there a way that I can suggest a columnbreak? I'm thinking of something like \- that suggests a hyphenated line break if its convenient, but this would go between blocks. Thanks!

  Read the article

• Testing approach for multi-threaded software

  - by Shane MacLaughlin

  I have a piece of mature geospatial software that has recently had areas rewritten to take better advantage of the multiple processors available in modern PCs. Specifically, display, GUI, spatial searching, and main processing have all been hived off to seperate threads. The software has a pretty sizeable GUI automation suite for functional regression, and another smaller one for performance regression. While all automated tests are passing, I'm not convinced that they provide nearly enough coverage in terms of finding bugs relating race conditions, deadlocks, and other nasties associated with multi-threading. What techniques would you use to see if such bugs exist? What techniques would you advocate for rooting them out, assuming there are some in there to root out? What I'm doing so far is running the GUI functional automation on the app running under a debugger, such that I can break out of deadlocks and catch crashes, and plan to make a bounds checker build and repeat the tests against that version. I've also carried out a static analysis of the source via PC-Lint with the hope of locating potential dead locks, but not had any worthwhile results. The application is C++, MFC, mulitple document/view, with a number of threads per doc. The locking mechanism I'm using is based on an object that includes a pointer to a CMutex, which is locked in the ctor and freed in the dtor. I use local variables of this object to lock various bits of code as required, and my mutex has a time out that fires my a warning if the timeout is reached. I avoid locking where possible, using resource copies where possible instead. What other tests would you carry out?

  Read the article

• ASP.NET - Webservice not being called from javascript

  - by Robert

  Ok I'm stumped on this one. I've got a ASMX web service up and running. I can browse to it (~/Webservice.asmx) and see the .NET generated page and test it out.. and it works fine. I've got a page with a Script Manager with the webservice registered... and i can call it in javascript (Webservice.Method(...)) just fine. However, I want to use this Webservice as part of a jQuery Autocomplete box. So I have use the url...? and the Webservice is never being called. Here's the code. [WebService(Namespace = "http://tempuri.org/")] [WebServiceBinding(ConformsTo = WsiProfiles.BasicProfile1_1)] // To allow this Web Service to be called from script, using ASP.NET AJAX, uncomment the following line. [System.Web.Script.Services.ScriptService] public class User : System.Web.Services.WebService { public User () { //Uncomment the following line if using designed components //InitializeComponent(); } [WebMethod] public string Autocomplete(string q) { StringBuilder sb = new StringBuilder(); //doStuff return sb.ToString(); } web.config <system.web> <webServices> <protocols> <add name="HttpGet"/> <add name="HttpPost"/> </protocols> </webServices> And the HTML $(document).ready(function() { User.Autocomplete("rr", function(data) { alert(data); });//this works ("#<%=txtUserNbr.ClientID %>").autocomplete("/User.asmx/Autocomplete"); //doesn't work $.ajax({ url: "/User.asmx/Autocomplete", success: function() { alert(data); }, error: function(e) { alert(e); } }); //just to test... calls "error" function });

  Read the article

• JQuery tablesorter - Second click on column header doesn't resort

  - by Jonathan

  I'm using tablesorter in on a table I added to a view in django's admin (although I'm not sure this is relevant). I'm extending the html's header: {% block extrahead %} <script type="text/javascript" src="http://code.jquery.com/jquery-1.4.2.js"></script> <script type="text/javascript" src="http://mysite.com/media/tablesorter/jquery.tablesorter.js"></script> <script type="text/javascript"> $(document).ready(function() { $("#myTable").tablesorter(); } ); </script> {% endblock %} When I click on a column header, it sorts the table using this column in descending order - that's ok. When I click the same column header a second time - it does not reorder to ascending order. What's wrong with it? the table's html looks like: <table id="myTable" border="1"> <thead> <tr> <th>column_name_1</th> <th>column_name_2</th> <th>column_name_3</th> </tr> </thead> <tbody> {% for item in extra.items %} <tr> <td>{{ item.0|safe }} </td> <td>{{ item.1|safe }} </td> <td>{{ item.2|safe }} </td> </tr> {% endfor %} </tbody> </table>

  Read the article

• Javascript onclick() event bubbling - working or not?

  - by user1071914

  I have a table in which the table row tag is decorated with an onclick() handler. If the row is clicked anywhere, it will load another page. In one of the elements on the row, is an anchor tag which also leads to another page. The desired behavior is that if they click on the link, "delete.html" is loaded. If they click anywhere else in the row, "edit.html" is loaded. The problem is that sometimes (according to users) both the link and the onclick() are fired at once, leading to a problem in the back end code. They swear they are not double-clicking. I don't know enough about Javascript event bubbling, handling and whatever to even know where to start with this bizarre problem, so I'm asking for help. Here's a fragment of the rendered page, showing the row with the embedded link and associated script tag. Any suggestions are welcomed: <tr id="tableRow_3339_0" class="odd"> <td class="l"></td> <td>PENDING</td> <td>Yabba Dabba Doo</td> <td>Fred Flintstone</td> <td> <a href="/delete.html?requestId=3339"> <div class="deleteButtonIcon"></div> </a> </td> <td class="r"></td> </tr> <script type="text/javascript">document.getElementById("tableRow_3339_0").onclick = function(event) { window.location = '//edit.html?requestId=3339'; };</script>

  Read the article

< Previous Page | 490 491 492 493 494 495 496 497 498 499 500 501  | Next Page >