Search Results

Search found 14506 results on 581 pages for 'document scanner'.

Page 494/581 | < Previous Page | 490 491 492 493 494 495 496 497 498 499 500 501 | Next Page >

Latex - Apply an operation to every character in a string

- by hroest

Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

Read the article
Why don't copy this dokument attributes from the source xml file??

- by siegfried storr

Hi anyone, i'm working the first time with xslt and i really don't understand why this xsl don't copy attributes from the source xml. Perhaps someone can give me a hint?? <xsl:stylesheet version="2.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:output omit-xml-declaration="yes" indent="yes"/> <xsl:variable name="rpl" select="document('ParamInvoice.xml')"/> <xsl:template match="/"> <xsl:copy> <xsl:apply-templates select="* | @*"/> </xsl:copy> </xsl:template> <xsl:template match="*"> <xsl:variable name="vInvoiceElement" select="$rpl/StoraInvoice/*[name()=name(current())]"/> <xsl:copy> <xsl:if test="$vInvoiceElement/Attribute"> <xsl:call-template name="AttributeErzeugen"> <xsl:with-param name="pAttr" select="$vInvoiceElement/Attribute"/> </xsl:call-template> </xsl:if> <xsl:apply-templates/> </xsl:copy> </xsl:template> <xsl:template name="AttributeErzeugen"> <xsl:param name="pAttr"/> <xsl:for-each select="$pAttr"> <xsl:attribute name="{@name}"><xsl:value-of select="."/></xsl:attribute> </xsl:for-each> </xsl:template> </xsl:stylesheet>

Read the article
jQuery - Unchecking checkboxes that act like radio buttons

- by Cecil

Hey All, I have the following jQuery code to make my checkboxes act like radio buttons, so that only 1 of the 3 can be checked at a time. <script type="text/javascript" language="javascript"> $(document).ready(function() { $("#testing input:checkbox").change(function(){ var checkname = $(this).attr("name"); $("input:checkbox[name='" + checkname + "']").removeAttr("checked"); this.checked = true; }); }); </script> The checkboxes are layed out like the following: <input type="checkbox" id="testing" name="testing" value="B"> <input type="checkbox" id="testing" name="testing" value="I"> <input type="checkbox" id="testing" name="testing" value="A"> This works exactly how i want it to work, not a problem, except once i click one of the 3, i cant unclick it so that none of them are checked, this is what i want to happen, so along with being only able to click one at a time, im able to uncheck them completely. Any help would be grand :)

Read the article
Testing approach for multi-threaded software

- by Shane MacLaughlin

I have a piece of mature geospatial software that has recently had areas rewritten to take better advantage of the multiple processors available in modern PCs. Specifically, display, GUI, spatial searching, and main processing have all been hived off to seperate threads. The software has a pretty sizeable GUI automation suite for functional regression, and another smaller one for performance regression. While all automated tests are passing, I'm not convinced that they provide nearly enough coverage in terms of finding bugs relating race conditions, deadlocks, and other nasties associated with multi-threading. What techniques would you use to see if such bugs exist? What techniques would you advocate for rooting them out, assuming there are some in there to root out? What I'm doing so far is running the GUI functional automation on the app running under a debugger, such that I can break out of deadlocks and catch crashes, and plan to make a bounds checker build and repeat the tests against that version. I've also carried out a static analysis of the source via PC-Lint with the hope of locating potential dead locks, but not had any worthwhile results. The application is C++, MFC, mulitple document/view, with a number of threads per doc. The locking mechanism I'm using is based on an object that includes a pointer to a CMutex, which is locked in the ctor and freed in the dtor. I use local variables of this object to lock various bits of code as required, and my mutex has a time out that fires my a warning if the timeout is reached. I avoid locking where possible, using resource copies where possible instead. What other tests would you carry out?

Read the article
Browser freezes when try to call a JS function along with submission of a form.

- by Waseem

I have form in my view like following 1 <div> 2 <% form_tag facebook_user_path do %> 3 <label>Use my photo and name from facebook?</label><br /> 4 <%= check_box_tag 'use_name_and_photo', 'yes', true %> 5 <img src="<%= @user.pic %>" /><% @user.name %> 6 7 <%= submit_tag "Finish", :id => "use_name_and_photo_submit" %> 8 <% end %> 9 </div> I have attached some JS handlers using Jquery to this form. 1 var fb = { 2 extendedPermissions: function () { 3 $("#use_name_and_photo_submit").click(function (event) { 4 FB.Connect.showPermissionDialog("email,read_stream,publish_stream", function (perms) { 5 if (!perms) { 6 alert("You have to grant facebook extended permissions to further browse the application."); 7 } else { 8 $("form").submit(function () { 9 $.post($(this).attr("action"), $(this).serialize(), null, "script"); 10 }); 11 } 12 }); 13 event.preventDefault(); 14 return false; 15 }); 16 } 17 }; 18 19 $(document).ready(function () { 20 fb.extendedPermissions(); 21 }); What I want is that when the user clicks on the "Finish" button, he is prompted for the facebook permissions dialogue and when he gives the permissions, the form is submitted to FacebookUsersController. Right now when I click the "Finish" button, facebook permissions dialogue is initiated but before I am prompted for the actual permission submission window, the browser freezes. Just like I have pressed Esc during the process. In fact status bar of the browser says "Stopped". Any help is highly appreciated.

Read the article
ASP.NET - Webservice not being called from javascript

- by Robert

Ok I'm stumped on this one. I've got a ASMX web service up and running. I can browse to it (~/Webservice.asmx) and see the .NET generated page and test it out.. and it works fine. I've got a page with a Script Manager with the webservice registered... and i can call it in javascript (Webservice.Method(...)) just fine. However, I want to use this Webservice as part of a jQuery Autocomplete box. So I have use the url...? and the Webservice is never being called. Here's the code. [WebService(Namespace = "http://tempuri.org/")] [WebServiceBinding(ConformsTo = WsiProfiles.BasicProfile1_1)] // To allow this Web Service to be called from script, using ASP.NET AJAX, uncomment the following line. [System.Web.Script.Services.ScriptService] public class User : System.Web.Services.WebService { public User () { //Uncomment the following line if using designed components //InitializeComponent(); } [WebMethod] public string Autocomplete(string q) { StringBuilder sb = new StringBuilder(); //doStuff return sb.ToString(); } web.config <system.web> <webServices> <protocols> <add name="HttpGet"/> <add name="HttpPost"/> </protocols> </webServices> And the HTML $(document).ready(function() { User.Autocomplete("rr", function(data) { alert(data); });//this works ("#<%=txtUserNbr.ClientID %>").autocomplete("/User.asmx/Autocomplete"); //doesn't work $.ajax({ url: "/User.asmx/Autocomplete", success: function() { alert(data); }, error: function(e) { alert(e); } }); //just to test... calls "error" function });

Read the article
Syntax for documenting JSON structure

- by Roman A. Taycher

So I'm trying to document the format of the json returned by an api I am writing against and I'd like to know if there is any popular format for the documentation of json structure. Note I'm not trying to to test or validate anything, I'm just using this for documentation. Also some ways to add comments to non-constants(items always returned w/ the same value) would be nice. This the not totally thought out scheme I'm currently using: Plain names refer to identifiers or types. Some types have type-comment Strings that appear to be constant(always returned for that type of request) strings are "str" Constant Numbers would be just the number Constant null is null Booleans are true/false for constant booleans or Boolean otherwise [a,b,c] are lists with 3 items a,b,c [... ...] is a list of repeating elements of some types/constants/patterns {a:A,b:B,c:c} and {... ...} is the same for a dictionary. example: story := [header,footer] header := {"data":realHeader,"kind":"Listing"} realHeader := {"after": null, "before": null, "children": [{"data": realRealHeader, "kind": "t3"}], "modhash": ""} footer := {"data":AlmostComments,"kind":"Listing"} AlmostComments := {"data": {"after": null, "before": null, "children": comments, "modhash": ""}, "kind": "t1"} comments := [...{"data":comment, "kind":"t1"}...] realRealHeader := {"author": string, "clicked": boolean, "created": int, "created_utc": int, "domain": "code.reddit.com", "downs": int, "hidden": boolean, "id": string-id, "is_self": boolean, "levenshtein": null, "likes": null, "media": null, "media_embed": { }, "name": string-id, "num_comments": int, "over_18": false, "permalink": string-urlLinkToStoryStartingFrom/r, "saved": false, "score": int, "selftext": string, "selftext_html": string-html, "subreddit": string-subredditname, "subreddit_id": string-id, "thumbnail": "", "title": string, "ups": int, "url": "http://code.reddit.com/" } comments := { "author": string, "body": string-body_html-wout-html, "body_html": string-html-formated, "created": int, "created_utc": int, "downs": int, "id": string-id, "levenshtein": null, "likes": null, "link_id": string-id, "name": string-id", "parent_id": string-id, "replies": AlmostComments or null, "subreddit": string-subredditname, "subreddit_id": string-id, "ups": int }

Read the article
Add xml-stylesheet and get standalone = yes.

- by tumba25

The code at the bottom is what I have. I removed the creation of all tags. At the top in the xml file I get.<?xml version="1.0" encoding="UTF-8" standalone="no"?> Note that standalone is no, even thou I have it set to yes. The first question: How do I get standalone = yes? I would like to add <?xml-stylesheet type="text/xsl" href="my.stylesheet.xsl"?> at line two in the xml file. Second question: How do I do that? Some useful links? Anything? DocumentBuilderFactory dbfac = DocumentBuilderFactory.newInstance(); DocumentBuilder docBuilder = dbfac.newDocumentBuilder(); Document doc = docBuilder.newDocument(); <cut> TransformerFactory transfac = TransformerFactory.newInstance(); transfac.setAttribute("indent-number", new Integer(2)); Transformer trans = transfac.newTransformer(); trans.setOutputProperty(OutputKeys.OMIT_XML_DECLARATION, "no"); trans.setOutputProperty(OutputKeys.STANDALONE, "yes"); trans.setOutputProperty(OutputKeys.INDENT, "yes"); trans.setOutputProperty(OutputKeys.CDATA_SECTION_ELEMENTS, "name"); FileOutputStream fout = new FileOutputStream(filepath); BufferedOutputStream bout= new BufferedOutputStream(fout); trans.transform(new DOMSource(doc), new StreamResult(new OutputStreamWriter(bout, "utf-8")));

Read the article
How to select LI except first and second ?

- by Wazdesign

Here is the structure of the content, I want to select all LI except the first two (ie no-link) jQuery(document).ready(function(){ var nosubnav = jQuery('.first-level li:not(:has(ul))'); var nosubnavsize = jQuery('.first-level li:not(:has(ul))').size(); jQuery(nosubnav).css('border' , '1px solid red'); alert('List item which does not have submenu '+nosubnavsize); }); div class="navigation-container"> <ul class="first-level"> <li><a href="#">No Link</a></li> <li><a href="#">No Link</a></li> <li><a href="#">Link 1</a></li> <li><a href="#">Link 2</a> <ul> <li><a href="#">Link2.1</a></li> <li><a href="#">Link2.2</a> <ul> <li><a href="#">Link 2.2.1</a></li> </ul> </li> </ul> </li> <li><a href="#">Link </a></li> </ul> </div> related Question : http://stackoverflow.com/questions/2771801/how-to-count-li-which-does-not-have-ul

Read the article
Returning an integer from a select box - JavaScript

- by Ross

Very simply, I want to be able to access the year from the select box as an integer. In my test, my alertbox is telling me the value is undefined. <form name="form1" method="post" action=""> <label>birth year <select name="birth year" id="dueYear"> <OPTION VALUE='' SELECTED>--Year--</OPTION> <OPTION VALUE='2011'>2011</OPTION> <OPTION VALUE='2010'>2010</OPTION> <OPTION VALUE='2009'>2009</OPTION></SELECT> </select> </label> </form> <script type="text/javascript"> var dueDateYear = parseInt(document.getElementById("dueYear")); </script> <button onclick="alert(dueDateYear)">Click Me!</button> All I want it to do, is tell me the year I have selected -- any help would be appreciated, I am a newbie :(

Read the article
Opening a xul file in response to a toolbar extension button click

- by Graham

I'm currently building my first Firefox extension, and am having a little difficulty with one piece of functionality. I'd like to open a new browser tab in response to a button click on the toolbar. The new tab should contain the contents of a webpage, together with some extra buttons. At the moment I've created a separate xul file for the contents of the new tab: <?xml version="1.0"?> <?xml-stylesheet href="chrome://global/skin/" type="text/css"?> <window id="myapp-report-window" title="Example 4.5.1" xmlns:html="http://www.w3.org/1999/xhtml" xmlns="http://www.mozilla.org/keymaster/gatekeeper/there.is.only.xul"> <script type="application/x-javascript" src="chrome://myapp/content/main.js" /> <toolbox> <toolbar id="nav-toolbar"> <toolbarbutton label="This-is-going-to-do-some-stuff"/> </toolbar> </toolbox> <iframe id="myapp-report-frame" flex="1"/> <script type="text/javascript"> function loadPage(url){ document.getElementById('myapp-report-frame').setAttribute('src',url); } </script> </window> This xul file is launched via this javascript, referenced from the main myapptoolbar.xul: gBrowser.selectedTab = gBrowser.addTab('chrome://myapp/content/report.xul'); var newTabBrowser = gBrowser.getBrowserForTab(gBrowser.selectedTab); newTabBrowser.addEventListener("load", function(){ loadPage('http://www.somedynamicallysetwebsite.com'); }, true); The problem that I'm having is that the loadPage function is not being found, so the src attribute of the iframe is never set. I'm sure it's some silly scoping problem, but I'm very new to firefox extensions (day 2!) so any help would be much appreciated. Thanks for looking! Graham

Read the article
Jquery Returning values to original

- by Cam

So my script works perfectly, but here is the issue, I have buttons (Sprite action here) that are 40px height, but the top 20 only shows perfectly. When you click the button ie img the bottom 20px show perfecto! but... Issue, i included in my script a way to return all others to there default (only one should be selected) now, how can I fix this issue that I seem unable to correct as I can select multiple of them ** USERS can switch ** The last part of the script that is the issue. Thanks $(document).ready(function() { $('.form_sub').hide(); $('.theader').addClass('active'); $('.theader_t').click(function() { $('.form_header').show(); $('.form_sub').hide(); $('.theader').addClass('active'); $('.sub_theader').removeClass('active'); }); $('.sub_theader_t').click(function() { $('.form_header').hide(); $('.form_sub').show(); $('.theader').removeClass('active'); $('.sub_theader').addClass('active'); }); $('.top_head_img').click(function() { $(this).css({ position: 'relative', bottom: '20px' }).siblings().css( 'bottom', '0' ); }); }); <ul class="top_head"> <li> <a href="javascript:void(0)" onClick="selectPic5('top');"><img src="custom/images/top2.jpg" alt="Left" border="0" class="top_head_img"/></a> </li> <li> <a href="javascript:void(0)" onClick="selectPic5('center');"><img src="custom/images/mid2.jpg" alt="Center" border="0" class="top_head_img"/></a> </li> <li> <a href="javascript:void(0)" onClick="selectPic5('bottom');"><img src="custom/images/bot2.jpg" alt="Right" border="0" class="top_head_img"/></a> </li> </ul>

Read the article
Problem uploading app to google app engine

- by Oberon

I'm having problems uploading an app to the google-app-engine from my work place. I believe the problem is related to proxy, because I do not see the same problem when following the same procedure from home. (I do not specify HTTP_PROXY from home). These are the commands I run: HTTP_PROXY=http://proxy.<thehostname>.com:8080 HTTP_PROXY=https://proxy.<thehostname>.com:8080 appcfg.py --insecure update myappfolder When running the commands I get prompted for email and password, as expected, but after that it immediately exits with this errormessage: Error 302: --- begin server output --- <HTML> <HEAD> <TITLE>Moved Temporarily</TITLE> </HEAD> <BODY BGCOLOR="#FFFFFF" TEXT="#000000"> <H1>Moved Temporarily</H1> The document has moved <A HREF="https://www.google.com/accounts/ClientLogin">here</A>. </BODY> </HTML> --- end server output --- Note: I added the --insecure option because else it gave a warning of missing ssl module. Any idea how to solve or workaround this problem?

Read the article
add dynamic field near his parent field?

- by Kaps Hasija

hi in my web page i am using Add Dynamic Field Functionality by using jquery. I am adding new div bu clicking on Existing div Like <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> by clicking on parent div i am creating new daynamic div <div class="divA">DivA2 </div> its coming end of the all div's like that <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> <div class="divA">DivA2 </div> But i need along with his parent div Like that <div class="divA">divA1 </div> <div class="divA">DivA2 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> any idea Thanks. This is My Jquery Code newTextBoxDiv = $(document.createElement('div')) .attr("id", text).attr("class", 'test0 ' + text); newTextBoxDiv.html('<div style=" width:150px; class="DivA" float: left"> </div>'); } newTextBoxDiv.appendTo("#contents"); contents is id of main div

Read the article
Generate custom RSS/Atom feed with SyndicationFeedFormatter made from XML

- by Sentax

I have followed this article and implemented my service and I can open the web browser and see the test data being published. I would like to create a custom formatted response, as for my needs this will not be published to the internet and it's an isolated feed that other devices on the local network could read to get the data I'm publishing. I'd like to create an XML document and publish it instead of using the SyndicationItem that is being used in the article to display title, author, description, etc. Would like to create something simple to be published: <MyData> <ID>33883</ID> <Title>The Name</Title> <Artist>The Artist</Artist> </MyData> I know how to create that in an XMLWriter, but how to publish in a SyndicationFeedFormatter that is the return type for the function in the article? I have seen the XmlSyndicationContent class but haven't seen any practical examples that would accomplish what I want to do.

Read the article
Why aren't these Canvases rendering?

- by bpapa

I'm creating a web app that allows users to enter a number of colors, by specifying RGB values. Upon submission, the user will see a canvas with a solid rectangle drawn in the color chosen. On this page, I have 7 canvases. The first one draws just fine, but none of the rest show up. The browser is Safari. Here's the relevant code: First, the script element in the header, which defines the function I use to draw to the canvas. <script language="JavaScript" TYPE="text/javascript"> </script> Next, the HTML source, where I have my canvas tags and some embedded Javascript to call my drawCanvas function <canvas id="canvas0" width="100" height="100"> </canvas> <script language="JavaScript" TYPE="text/javascript"> </script> . . //more source . <canvas id="canvas1" width="100" height="100"> </canvas> <script language="JavaScript" TYPE="text/javascript"> </script> Also provided is a screenshot. As you can see, the "red" canvas comes up just fine, but the second one, which should be green, doesn't show up at all. Any ideas?

Read the article
Embedding XSL Stylesheet into XML

- by user700996

I have the following XML: <?xml version="1.0" encoding="ISO-8859-1"?> <?xml-stylesheet type="text/xsl" href="http://www.fakedomain.com/sally.xsl"?> And the following content in sally.xsl: <?xml version="1.0" encoding="ISO-8859-1"?> <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:template match="/"> <html> <body> <xsl:for-each select="documentcollection/document"> <p> <xsl:for-each select="rss/channel/item"> <xsl:value-of select="title"/><br /> <xsl:value-of select="description"/><br /> <xsl:value-of select="link"/><br /> </xsl:for-each> </p> </xsl:for-each> </body> </html> </xsl:template> </xsl:stylesheet> However, the browser displays the XML as though the XSL line is not present. Do you know why the browser is ignoring the XSL stylesheet? Is the style sheet wrong? Thanks

Read the article
Passing jquery JSON from Codeigniter controller to view

- by dede

I've been struggling to make it work, but cannot pass the inserted data from the controler to the view in CI using JSON. The input value from the form is successfully inserted into the database, but cannot make it appear in the view. This is my view file ajax_view.php: <script type="text/javascript" src="<?php echo base_url(); ?>js/jquery-1.4.2.min.js"></script> $(document).ready(function(){ $("#submit").click(function(){ var inp = $('#inp').val(); $.post("ajax/ajax_input", { 'send' : inp }, function(data){ alert(data.input_text); }, "json"); }); }); </script> </head> <body> <form id="form1" method="post" action=""> <label for="inp">Text</label> <input type="text" name="inp" id="inp" /> <label for="submit"></label> <input type="submit" name="submit" id="submit" value="Submit" /> And this is the ajax_input method of the ajax.php controller: <?php // Initializing controller ..... // ............................. //ajax method function ajax_input(){ $var_1 = trim($this->input->post('send')); $array = array('input_text' => $var_1); echo json_encode($array); $this->db->insert('ajax',$array); } Trying to debug it with Firebug, it gives me that data.input_text is empty. What am I doing wrong? EDIT: I'm using XAMPP on Win, so is it posible that json configuration is the problem?

Read the article
Making a Javascript game, Having a little problem with scrolling.

- by RobertWHurst

I have a #wrapper div and a #grid div nested inside. currently I can scroll around with this function below. getCursorPos : function(){ // set the empty cursor object var cursor = {}; //get the offset from the left of the grid container var grid //offset loop $(function getCursorPos(){ grid = $('#grid').offset(); setTimeout(getCursorPos, game.loopSpeed); }); //continuosly get the position var that = this; $(document).mousemove(function(e){ //if game mode is menu exit if(game.mode === 'menu'){ return; } // NOTE: this looks a litle over done but don't remove anything // its like this because javascript uses floating points // and so in order to line up to the nearest hunderedth I // had to make the cursor and div position intergers by // muliplying by ten. one the two are added I reduced them // and rounded them. that.x = Math.round(((e.pageX * 10) - (grid.left * 10)) / 10); that.y = Math.round(((e.pageY * 10) - (grid.top * 10)) / 10); }); }, the problem is that the mouse coordinates only update when the mouse moves. is there any way to get the coordinates with out moving the mouse?

Read the article
Can't get jQuery to wokr with Prototype - tried everything....

- by thinkfuture

Ok so here is the situation. Been pulling my hair out on this one. I'm a noob at this. Only been using rails for about 6 weeks. I'm using the standard setup package, and my code leverages prototype helpers heavily. Like I said, noob ;) So I'm trying to put in some jQuery effects, like PrettyPhoto. But what happens is that when the page is first loaded, PrettyPhoto works great. However, once someone uses a Prototype helper, like a link created with link_to_remote, Prettyphoto stops working. I've tried jRails, all of the fixes proposed on the JQuery site to stop conflicts... http://docs.jquery.com/Using_jQuery_with_Other_Libraries ...even done some crazy things likes renaming all of the $ in prototype.js to $$$ to no avail. Either the prototype helpers break, or jQuery breaks. Seems nothing I do can get these to work together. Any ideas? Here is part of my application.html.erb <%= javascript_include_tag 'application' %> <%= javascript_include_tag 'tooltip' %> <%= javascript_include_tag 'jquery' %> <%= javascript_include_tag 'jquery-ui' %> <%= javascript_include_tag "jquery.prettyPhoto" %> <%= javascript_include_tag 'prototype' %> <%= javascript_include_tag 'scriptalicious' %> </head> <body> <script type="text/javascript" charset="utf-8"> jQuery(document).ready( function() { jQuery("a[rel^='prettyPhoto']").prettyPhoto(); }); </script> If I put prototype before jquery, the prototype helpers don't work If I put the noconflict clause in, neither works. Thanks in advance! Chris

Read the article
Google Charts - Adding Tooltip to Colorized Column Chart

- by David K

I created a column chart with google charts that has a different color assigned to each column using the following posting: Assign different color to each bar in a google chart But now I'm trying to figure out how to customize the tooltips for each column to also include the number of users in addition to the percent, so "raw_data[i][1]" I would like it to look like "70% (80 Users)" I understand that there is "data.addColumn({type:'number',role:'tooltip'});" but I'm having trouble understanding how to implement it for this use-case. function drawAccountsChart() { var data = new google.visualization.DataTable(); var raw_data = [ ['Parents', 80, 160], ['Students', 94, 128], ['Teachers', 78, 90], ['Admins', 68, 120], ['Staff', 97, 111] ]; data.addColumn('string', 'Columns'); for (var i = 0; i < raw_data.length; ++i) { data.addColumn('number', raw_data[i][0]); } data.addRows(1); for (var i = 0; i < raw_data.length; ++i) { data.setValue(0, i+1, raw_data[i][1]/raw_data[i][2]*100); } var options = { height:220, chartArea: { left:30, width: "70%", height: "70%" }, backgroundColor: { fill:"transparent" }, tooltop:{ textStyle: {fontSize: "12px",}}, vAxis: {minValue: 0} }; var formatter = new google.visualization.NumberFormat({ suffix: '%', fractionDigits: 1 }); formatter.format(data, 1); formatter.format(data, 2); formatter.format(data, 3); formatter.format(data, 4); formatter.format(data, 5); var chart = new google.visualization.ColumnChart(document.getElementById('emailAccountsChart')); chart.draw(data, options); }

Read the article
Trying to fadein divs in a sequence, over time, using JQuery

- by user346602

Hi, I'm trying to figure out how to make 4 images fade in sequentially when the page loads. The following is my (amateurish) code: Here is the HTML: <div id="outercorners"> <img id="corner1" src="images/corner1.gif" width="6" height="6" alt=""/> <img id="corner2" src="images/corner2.gif" width="6" height="6" alt=""/> <img id="corner3" src="images/corner3.gif" width="6" height="6" alt=""/> <img id="corner4" src="images/corner4.gif" width="6" height="6" alt=""/> </div> Here is the JQuery: $(document).ready(function() { $("#corner1").fadeIn("2000", function(){ $("#corner3").fadeIn("4000", function(){ $("#corner2").fadeIn("6000", function(){ $("#corner4").fadeIn("8000", function(){ }); }); }); }); Here is the css: #outercorners { position: fixed; top:186px; left:186px; width:558px; height:372px; } #corner1 { position: fixed; top:186px; left:186px; display: none; } #corner2 { position: fixed; top:186px; left:744px; display: none; } #corner3 { position: fixed; top:558px; left:744px; display: none; } #corner4 { position: fixed; top:558px; left:186px; display: none; } They seem to just wink at me, rather than fade in in the order I've ascribed to them. Should I be using the queue() function? And, if so, how would I implement it in this case? Thank you for any assistance.

Read the article
macro collapse all in solution visual studio 2010

- by rod

Hi All, I found the CollapseAll macro online that has worked for me in vs2005 and vs2008. However, this half way works in vs2010. It looks like it only collapses the top nodes and not any subnodes that may be expanded? any ideas? Thanks, rod. Sub CollapseAll() ' Get the the Solution Explorer tree Dim UIHSolutionExplorer As UIHierarchy UIHSolutionExplorer = DTE.Windows.Item(Constants.vsext_wk_SProjectWindow).Object() ' Check if there is any open solution If (UIHSolutionExplorer.UIHierarchyItems.Count = 0) Then ' MsgBox("Nothing to collapse. You must have an open solution.") Return End If ' Get the top node (the name of the solution) Dim UIHSolutionRootNode As UIHierarchyItem UIHSolutionRootNode = UIHSolutionExplorer.UIHierarchyItems.Item(1) UIHSolutionRootNode.DTE.SuppressUI = True ' Collapse each project node Dim UIHItem As UIHierarchyItem For Each UIHItem In UIHSolutionRootNode.UIHierarchyItems 'UIHItem.UIHierarchyItems.Expanded = False If UIHItem.UIHierarchyItems.Expanded Then Collapse(UIHItem) End If Next ' Select the solution node, or else when you click ' on the solution window ' scrollbar, it will synchronize the open document ' with the tree and pop ' out the corresponding node which is probably not what you want. UIHSolutionRootNode.Select(vsUISelectionType.vsUISelectionTypeSelect) UIHSolutionRootNode.DTE.SuppressUI = False End Sub Private Sub Collapse(ByVal item As UIHierarchyItem) For Each eitem As UIHierarchyItem In item.UIHierarchyItems If eitem.UIHierarchyItems.Expanded AndAlso eitem.UIHierarchyItems.Count > 0 Then Collapse(eitem) End If Next item.UIHierarchyItems.Expanded = False End Sub End Module

Read the article
jQuery/ajax working on IIS5.1 but not IIS6

- by Mikejh99

I'm running a weird issue here. I have code that makes jquery ajax calls to a web service and dynamically adds controls using jquery. Everything works fine on my dev machine running IIS 5.1, but not when deployed to IIS 6. I'm using VS2010/ASP.Net 4.0, C#, jQuery 1.4.2 and jQuery UI 1.8.1. I'm using the same browser for each. It partially works though. The code will add the controls to the page, but they aren't visible until I click them (they aren't visible though). I thought this was a css issue, but the styles are there too. The ajax calls look like this: $.ajax({ url: "/WebServices/AssetManager.asmx/Assets", type: "POST", datatype: "json", async: false, data: "{'q':'" + req.term + "', 'type':'Condition'}", contentType: "application/javascript; charset=utf-8", success: function (data) { res($.map(data.d, function (item) { return { label: item.Name, value: item.Name, id: item.Id, datatype: item.DataType } })) } }) Changing the content-type makes the autocomplete fail. I've quadruple checked and all the paths are correct, there is no document footer enabled in IIS, and I'm not using IIS compression. Any idea why the page will display and work properly in IIS 5 but only partially in IIS 6? (If it failed completely, that'd make more sense!). Is it a jQuery or CSS issue?

Read the article
how do I call a javacript function every 60 seconds?

- by William

So I'm trying to work on a Canvas demo, and I want this square to move from one side to the other, but I can't figure out how to call javascript in a way that repeats every 60 seconds. Here's what I got so far: <!DOCTYPE html> <html lang="en"> <head> <title>Canvas test</title> <meta charset="utf-8" /> <link href="/bms/style.css" rel="stylesheet" /> <style> body { text-align: center; background-color: #000000;} canvas{ background-color: #ffffff;} </style> <script type="text/javascript"> var x = 50; var y = 250; function update(){ draw(); x = x + 5; } function draw(){ var canvas = document.getElementById('screen1'); if (canvas.getContext){ var ctx = canvas.getContext('2d'); ctx.fillStyle = 'rgb(236,138,68)'; ctx.fillRect(x,y,24,24); } } </script> </head> <body onLoad="setTimeout(update(), 0);"> <canvas id="screen1" width="500" height="500"></canvas> </body> </html>

Read the article

< Previous Page | 490 491 492 493 494 495 496 497 498 499 500 501 | Next Page >