Search Results

Search found 858 results on 35 pages for 'tsug ve'.

Page 5/35 | < Previous Page | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >

  • OpenFilesView Displays All Open and Locked Files to Help Resolve In-Use Errors

    - by Jason Fitzpatrick
    Windows: You go to move a file and Windows throws up an “In Use” error. OpenFilesView shows you what application or system process is locking up the files you’re trying to move. Sometimes the culprit is obvious; if you go to move your media folder and you’ve got your media player open watching South Park then shutting down the media player is the obvious solution. Other times the culprit is less obvious; sometimes Windows processes and less-than-obvious applications are accessing your files in ways that aren’t apparent. The screenshot below showcases the “In Use” error: This is where OpenFilesView comes into play. Fire up the application to see a list of all active files on your system. The master list is a bit overwhelming (on our test system there were over 1200 open files) but you use the find command to drill down to specific file or folder names. Once you’ve found the locked file you can close the file handle, kill the process, or bring the process to the front (so you can examine the program, if possible, before terminating it). It’s much more efficient than rebooting in an attempt to shake the In-Use error. OpenFilesView is freeware and works on Windows XP through Windows 7. HTG Explains: Do You Really Need to Defrag Your PC? Use Amazon’s Barcode Scanner to Easily Buy Anything from Your Phone How To Migrate Windows 7 to a Solid State Drive

    Read the article

  • NASA Finds Evidence Of Aliens

    - by Gopinath
    OMG! All those Aliens stuff we saw in movies is not baseless. NASA scientists discovered that we are not all alone in this universe. Many other forms of life is distributed on the planets other than Earth. Aliens are real!! This astonishing claim comes from Dr. Richard Hoover, an astrobiologist at NASA, who says that he found solid evidence of alien life in the form of fossils of bacteria in an extremely rare class of meteorite. In an exclusive interview to FoxNews, the scientist said I interpret it as indicating that life is more broadly distributed than restricted strictly to the planet earth. This field of study has just barely been touched — because quite frankly, a great many scientist would say that this is impossible. The exciting thing is that they are in many cases recognizable and can be associated very closely with the generic species here on earth. There are some that are just very strange and don’t look like anything that I’ve been able to identify, and I’ve shown them to many other experts that have also come up stumped. Read more at  FoxNew: NASA Scientist Claims Evidence of Alien Life on Meteorite cc image flickr/earlg This article titled,NASA Finds Evidence Of Aliens, was originally published at Tech Dreams. Grab our rss feed or fan us on Facebook to get updates from us.

    Read the article

  • Disable the Old Adobe Flash Plugin in Google Chrome

    - by The Geek
    If you’ve just updated to the Dev or Beta release of Google Chrome, you might have noticed that a special version of Adobe Flash is now integrated into the default distribution of Chrome. But what about your old plug-in? As it turns out, the old plug-in is generally still installed… but you can easily disable Chrome plug-ins in the latest version, so let’s get to work. Disable the Extra Flash Plug-in Head over to about:plugins and look through the list—you should notice two Shockwave Flash plugins. The first one should be in your Google Chrome installation folder, and has the filename gcswf32.dll. This is the NEW one, so don’t disable it! If you keep scrollling down, you’ll see the old one, with the file name NPSWF32.dll. This is the OLD plugin, and you can safely disable it. Of course, if you only use Chrome you could just completely uninstall Adobe Flash from your system by heading into Control Panel’s Uninstall Programs screen, and then finding and uninstalling Adobe Flash Player Plugin. The ActiveX version is for Internet Explorer. We’ve not done any testing to see if the old Flash plugin is even still active or not, but may as well disable it just to be sure, right? Similar Articles Productive Geek Tips How To Disable Individual Plug-ins in Google ChromeSearch for Install Packages from the Ubuntu Command LineStop YouTube Videos from Automatically Playing in ChromeHow To Disable Javascript in Adobe Reader and Patch the Latest Massive Security HoleStupid Geek Tricks: Compare Your Browser’s Memory Usage with Google Chrome TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips DVDFab 6 Revo Uninstaller Pro Registry Mechanic 9 for Windows PC Tools Internet Security Suite 2010 Outlook Connector Upgrade Error Gadfly is a cool Twitter/Silverlight app Enable DreamScene in Windows 7 Microsoft’s “How Do I ?” Videos Home Networks – How do they look like & the problems they cause Check Your IMAP Mail Offline In Thunderbird

    Read the article

  • The Inebriator: A DIY Arduino-powered Cocktail Machine [Video]

    - by Jason Fitzpatrick
    We’ve seen our fair share of geeky alcohol-related projects over the years but this, this, is something to see. The Inebriator is the slickest automated drink machine we’ve laid eyes on. Before we even start talking specs, check out the video above–don’t forget to first assure your liver that you don’t actually have access to such a magnificent device and it can remain calm. As dazzled as we were? The whole thing is powered by an Arduino Mega 2560, sports a cooler with nitrogen pressurization of drink mix bottles, and relies on a rather ingenious and elegantly simple 12v valve system. It even has an RFID security system to prevent party goers with a few drinks in them from messing up the custom drink menu. Hit up the link below for more information, including photos of the guts and technical specs. The Inebriator [via Hack A Day] Java is Insecure and Awful, It’s Time to Disable It, and Here’s How What Are the Windows A: and B: Drives Used For? HTG Explains: What is DNS?

    Read the article

  • Want an iPad? How-To Geek is Giving One Away!

    - by The Geek
    That’s right. All you have to do to enter is become a fan of our Facebook page, and we’ll pick a random fan to win the prize. Once we’ve got 10,000 fans, we’ll change the prize from an iPod Touch to an iPad 16GB (typo in the image above). Everybody who is already a fan is already automatically entered in the contest!  (there’s no country restriction). So to make sure we upgrade the prize, make sure to share the How-To Geek Facebook Fan page with your friends that might be interested (don’t mindlessly spam everybody, of course). We’ve already got the iPad sitting here. Win an iPad on the How-To Geek Facebook Fan Page Similar Articles Productive Geek Tips Why Wait? Amazing New Add-on Turns Your iPhone into an iPad! [Comic]Win a Free iPod Touch in the How-To Geek Facebook Giveaway!Geek Software: Use DeliCount to Get Site-wide del.icio.us Bookmark CountsFix for Problems with How-To Geek Sidebar GadgetSet Gmail as Default Mail Client in Ubuntu TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips DVDFab 6 Revo Uninstaller Pro Registry Mechanic 9 for Windows PC Tools Internet Security Suite 2010 Will it Blend? iPad Edition Penolo Lets You Share Sketches On Twitter Visit Woolyss.com for Old School Games, Music and Videos Add a Custom Title in IE using Spybot or Spyware Blaster When You Need to Hail a Taxi in NYC Live Map of Marine Traffic

    Read the article

  • Convert a Row to a Column (or Backwards) in Google Docs Spreadsheets

    - by The Geek
    If you have to deal with a lot of spreadsheets, you’re probably really bored right now. You also might be wondering how to turn a row into a column, or a column into a row. Here’s how to do it with Google Docs Spreadsheets. If you’re an Excel user, you’re also in luck, because we’ve already shown you how to turn a row into a column, or vice-versa. It won’t make you any less bored though. Convert a Row to a Column (or backwards) The first thing you’ll need is a column or a row of information that you want to convert into the opposite. For our example, we’ve got this set of data that we created by using the Auto Fill options in Google Docs. Now in another cell, you’ll need to use the TRANSPOSE function, which you can use by simply typing in the following: =TRANSPOSE( And then selecting the cells with the mouse, or manually typing in the range of cells you want to copy. The final function in this example was: =TRANSPOSE(A1:A11) Finish it off with the final ) character to complete the function, hit the Enter key, and there we are… the column was transposed over to the right. You can use the same thing to turn columns into rows, or rows into columns—just change the range you are looking for. Similar Articles Productive Geek Tips How To Use AutoFill on a Google Docs Spreadsheet [Quick Tips]Integrate Google Docs with Outlook the Easy WayHow To Export Documents from Google Docs to Your ComputerConvert a Row to a Column in Excel the Easy WayScroll Backwards From the Ubuntu Server Command Line TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips DVDFab 6 Revo Uninstaller Pro Registry Mechanic 9 for Windows PC Tools Internet Security Suite 2010 Check Your IMAP Mail Offline In Thunderbird Follow Finder Finds You Twitter Users To Follow Combine MP3 Files Easily QuicklyCode Provides Cheatsheets & Other Programming Stuff Download Free MP3s from Amazon Awe inspiring, inter-galactic theme (Win 7)

    Read the article

  • SQL Developer: BLOBs and the External Editor

    - by thatjeffsmith
    We already know how easy it is to view images and plain text with the BLOB editor, yes? But what if I have in my column a bunch of PDFs stored? I want to see that stuff without having to save the file, finding it, and then opening it. Why can’t I just automatically open it directly from the database? Well, it seems you can. Here’s how. External Editors Step 1: Make sure you have the file types and associated editors defined in the preferences. External editors available from the BLOB viewer Based on what’s going on in your OS, you’ll have several of these already defined. If not, it’s pretty simple to add them manually. Now, assuming you’ve got some fun data loaded up, let’s try it out. A PDF As you can see in the screenshot above, PDF is mapped to Adobe Reader. I just happen to have a PDF loaded into a BLOB, let’s send it to the external editor. Click on the hyperlinked text to load the PDF straight to Adobe Here’s it working in action (click on the image to see the animation): If it’s a big file, you will see a dialog where we’re downloading the data. Now if I were to edit said document and save it back to the database via the ‘Load’ mechanism, then we’ve come full circle.

    Read the article

  • Plastic Clamshell Packaging Voted Worse Design Ever

    - by Jason Fitzpatrick
    We’ve all been there: frustrated and trying free a new purchase from it’s plastic clamshell jail. You’re not alone, the packaging design has been voted the worst in history. In a poll at Quora, users voted on the absolute worst piece of design work they’d encountered. Overwhelmingly, they voted the annoying-to-open clamshell design to the top. The author of the top comment/entry, Anita Shillhorn writes: “Design should help solve problems” — clamshells are supposed to make it harder to steal small products and easier for employees to arrange on display — but this packaging, she says, makes new ones, such as time wasted, frustration, and the little nicks and scrapes people incur as they just try to get their damn lightbulb out. This is a product designed for the manufacturers and the retailers, not the end users. There is even a Wikipedia page devoted to “wrap rage,” “the common name for heightened levels of anger and frustration resulting from the inability to open hard-to-remove packaging.” Hit up the link below for more entries in their worst-design poll. Before you go, if you’ve got a great tip for getting goods out of the plastic shell they ship in, make sure to share it in the comments. What Is The Worst Piece of Design Ever Done? [via The Atlantic] HTG Explains: What Is RSS and How Can I Benefit From Using It? HTG Explains: Why You Only Have to Wipe a Disk Once to Erase It HTG Explains: Learn How Websites Are Tracking You Online

    Read the article

  • How to See Your Current Wi-Fi Connection Speed in Mac OS X

    - by The Geek
    Ever since I’ve been using my new MacBook Air, I’ve been befuddled by how to do some of the simplest tasks in Mac OS X that I would normally do from my Windows laptop—like show the connection speed for the current Wi-Fi network. So am I using Wireless-N or not? Normally, on my Windows 7 laptop, all I’d have to do is hover over the icon, or pop up the list—you can even go into the network details and see just about every piece of data about the network, all from the system tray. Here’s how to see your current connection information on your Mac Latest Features How-To Geek ETC The Complete List of iPad Tips, Tricks, and Tutorials The 50 Best Registry Hacks that Make Windows Better The How-To Geek Holiday Gift Guide (Geeky Stuff We Like) LCD? LED? Plasma? The How-To Geek Guide to HDTV Technology The How-To Geek Guide to Learning Photoshop, Part 8: Filters Improve Digital Photography by Calibrating Your Monitor Free Shipping Day is Friday, December 17, 2010 – National Free Shipping Day Find an Applicable Quote for Any Programming Situation Winter Theme for Windows 7 from Microsoft Score Free In-Flight Wi-Fi Courtesy of Google Chrome Peaceful Winter Road at Sunset Wallpaper Everything You Ever Wanted to Know About Why Pac-Man’s Ghosts Move the Way They Do

    Read the article

  • PASS Location fixed for the next 2 years - Are they listening?

    - by simonsabin
    I've just received the PASS connector newsletter with details of the decision of where to locate the next summits. To me it shows you how you can spin statistics they way you want to. I am very suprised by the numbers 81% said that they would like an east coast event. The spin is that "When we look at responses from only 2008 and 2009 Summit attendees (our most successful ones by far), the number who want a future Summit outside of Seattle drops to 69%." Wow the number drops thats bad. We must stay in Seattle then. My take however is that 69% of those willing to travel to Seattle want an event NOT in Seattle. Doesn't that suggest that people would like an event not in Seattle. I appreciate the comment about the launch years however 2012 isn't going to be a launch year because they need to get SQL out of the door before then to meet the 3 year software assurance cycle. So sticking 2012 in Seattle is IMHO a bad decision. It might keep the cost down for the PASS org, Microsoft and the attendees that live near Seattle but does it keep the cost down for the rest of the SQL Community? They do mention a possibility of an event on the East Coast and I do hope that its not just lip service. Flights for me to the East coast look ~30% cheaper than to Seattle and I've never been to the East Coast. Come on PASS show you are listening to the community.

    Read the article

  • Why unhandled exceptions are useful

    - by Simon Cooper
    It’s the bane of most programmers’ lives – an unhandled exception causes your application or webapp to crash, an ugly dialog gets displayed to the user, and they come complaining to you. Then, somehow, you need to figure out what went wrong. Hopefully, you’ve got a log file, or some other way of reporting unhandled exceptions (obligatory employer plug: SmartAssembly reports an application’s unhandled exceptions straight to you, along with the entire state of the stack and variables at that point). If not, you have to try and replicate it yourself, or do some psychic debugging to try and figure out what’s wrong. However, it’s good that the program crashed. Or, more precisely, it is correct behaviour. An unhandled exception in your application means that, somewhere in your code, there is an assumption that you made that is actually invalid. Coding assumptions Let me explain a bit more. Every method, every line of code you write, depends on implicit assumptions that you have made. Take this following simple method, that copies a collection to an array and includes an item if it isn’t in the collection already, using a supplied IEqualityComparer: public static T[] ToArrayWithItem( ICollection<T> coll, T obj, IEqualityComparer<T> comparer) { // check if the object is in collection already // using the supplied comparer foreach (var item in coll) { if (comparer.Equals(item, obj)) { // it's in the collection already // simply copy the collection to an array // and return it T[] array = new T[coll.Count]; coll.CopyTo(array, 0); return array; } } // not in the collection // copy coll to an array, and add obj to it // then return it T[] array = new T[coll.Count+1]; coll.CopyTo(array, 0); array[array.Length-1] = obj; return array; } What’s all the assumptions made by this fairly simple bit of code? coll is never null comparer is never null coll.CopyTo(array, 0) will copy all the items in the collection into the array, in the order defined for the collection, starting at the first item in the array. The enumerator for coll returns all the items in the collection, in the order defined for the collection comparer.Equals returns true if the items are equal (for whatever definition of ‘equal’ the comparer uses), false otherwise comparer.Equals, coll.CopyTo, and the coll enumerator will never throw an exception or hang for any possible input and any possible values of T coll will have less than 4 billion items in it (this is a built-in limit of the CLR) array won’t be more than 2GB, both on 32 and 64-bit systems, for any possible values of T (again, a limit of the CLR) There are no threads that will modify coll while this method is running and, more esoterically: The C# compiler will compile this code to IL according to the C# specification The CLR and JIT compiler will produce machine code to execute the IL on the user’s computer The computer will execute the machine code correctly That’s a lot of assumptions. Now, it could be that all these assumptions are valid for the situations this method is called. But if this does crash out with an exception, or crash later on, then that shows one of the assumptions has been invalidated somehow. An unhandled exception shows that your code is running in a situation which you did not anticipate, and there is something about how your code runs that you do not understand. Debugging the problem is the process of learning more about the new situation and how your code interacts with it. When you understand the problem, the solution is (usually) obvious. The solution may be a one-line fix, the rewrite of a method or class, or a large-scale refactoring of the codebase, but whatever it is, the fix for the crash will incorporate the new information you’ve gained about your own code, along with the modified assumptions. When code is running with an assumption or invariant it depended on broken, then the result is ‘undefined behaviour’. Anything can happen, up to and including formatting the entire disk or making the user’s computer sentient and start doing a good impression of Skynet. You might think that those can’t happen, but at Halting problem levels of generality, as soon as an assumption the code depended on is broken, the program can do anything. That is why it’s important to fail-fast and stop the program as soon as an invariant is broken, to minimise the damage that is done. What does this mean in practice? To start with, document and check your assumptions. As with most things, there is a level of judgement required. How you check and document your assumptions depends on how the code is used (that’s some more assumptions you’ve made), how likely it is a method will be passed invalid arguments or called in an invalid state, how likely it is the assumptions will be broken, how expensive it is to check the assumptions, and how bad things are likely to get if the assumptions are broken. Now, some assumptions you can assume unless proven otherwise. You can safely assume the C# compiler, CLR, and computer all run the method correctly, unless you have evidence of a compiler, CLR or processor bug. You can also assume that interface implementations work the way you expect them to; implementing an interface is more than simply declaring methods with certain signatures in your type. The behaviour of those methods, and how they work, is part of the interface contract as well. For example, for members of a public API, it is very important to document your assumptions and check your state before running the bulk of the method, throwing ArgumentException, ArgumentNullException, InvalidOperationException, or another exception type as appropriate if the input or state is wrong. For internal and private methods, it is less important. If a private method expects collection items in a certain order, then you don’t necessarily need to explicitly check it in code, but you can add comments or documentation specifying what state you expect the collection to be in at a certain point. That way, anyone debugging your code can immediately see what’s wrong if this does ever become an issue. You can also use DEBUG preprocessor blocks and Debug.Assert to document and check your assumptions without incurring a performance hit in release builds. On my coding soapbox… A few pet peeves of mine around assumptions. Firstly, catch-all try blocks: try { ... } catch { } A catch-all hides exceptions generated by broken assumptions, and lets the program carry on in an unknown state. Later, an exception is likely to be generated due to further broken assumptions due to the unknown state, causing difficulties when debugging as the catch-all has hidden the original problem. It’s much better to let the program crash straight away, so you know where the problem is. You should only use a catch-all if you are sure that any exception generated in the try block is safe to ignore. That’s a pretty big ask! Secondly, using as when you should be casting. Doing this: (obj as IFoo).Method(); or this: IFoo foo = obj as IFoo; ... foo.Method(); when you should be doing this: ((IFoo)obj).Method(); or this: IFoo foo = (IFoo)obj; ... foo.Method(); There’s an assumption here that obj will always implement IFoo. If it doesn’t, then by using as instead of a cast you’ve turned an obvious InvalidCastException at the point of the cast that will probably tell you what type obj actually is, into a non-obvious NullReferenceException at some later point that gives you no information at all. If you believe obj is always an IFoo, then say so in code! Let it fail-fast if not, then it’s far easier to figure out what’s wrong. Thirdly, document your assumptions. If an algorithm depends on a non-trivial relationship between several objects or variables, then say so. A single-line comment will do. Don’t leave it up to whoever’s debugging your code after you to figure it out. Conclusion It’s better to crash out and fail-fast when an assumption is broken. If it doesn’t, then there’s likely to be further crashes along the way that hide the original problem. Or, even worse, your program will be running in an undefined state, where anything can happen. Unhandled exceptions aren’t good per-se, but they give you some very useful information about your code that you didn’t know before. And that can only be a good thing.

    Read the article

  • The Complete List of iPad Tips, Tricks, and Tutorials

    - by The Geek
    The Apple iPad is an amazing tablet, and to help you get the most out of it, we’ve put together a comprehensive list of every tip, trick, and tutorial for you. Read on for more. Note: This article was originally published earlier this year, but we’ve updated it with a real lot more content since then, so we’re republishing it for you. We’ll be keeping this page updated as we find more great articles, so you should bookmark this page for future reference Latest Features How-To Geek ETC The Complete List of iPad Tips, Tricks, and Tutorials The 50 Best Registry Hacks that Make Windows Better The How-To Geek Holiday Gift Guide (Geeky Stuff We Like) LCD? LED? Plasma? The How-To Geek Guide to HDTV Technology The How-To Geek Guide to Learning Photoshop, Part 8: Filters Improve Digital Photography by Calibrating Your Monitor The Brothers Mario – Epic Gangland Style Mario Brothers Movie Trailer [Video] Score Awesome Games on the Cheap with the Humble Indie Bundle Add a Colorful Christmas Theme to Your Windows 7 Desktop This Windows Hack Changes the Blue Screen of Death to Red Edit Images Quickly in Firefox with Pixlr Grabber Zoho Writer, Sheet, and Show Now Available in Chrome Web Store

    Read the article

  • CyanogenMod Updates; Rolls out Android 2.3 to the Less Fortunate

    - by ETC
    If you’re one of the less fortunate (namely those forgotten by their carrier when it comes to phone OS upgrade time) you’ve got a friend in Cyanogen. They’ve rolled out a new Release Candidate update that includes Android 2.3 and a host of performance tweaks. First thing to note is that this is an RC and if you upgrade from CyanogenMod 6 to CyanogenMod 7 RC you’ll be trading a little bit of stability and a few features that haven’t made the jump from 6 to 7 in return for the newest features of Android 2.3. If you’re not comfortable with that wait for CyanogenMod 7 to update to a final release. For the intrepid, hit up the link below to read more and grab a copy. CyanogenMod-7 Release Candidates! [Cyanogen via Download Squad] Latest Features How-To Geek ETC Ask How-To Geek: How Can I Monitor My Bandwidth Usage? Internet Explorer 9 RC Now Available: Here’s the Most Interesting New Stuff Here’s a Super Simple Trick to Defeating Fake Anti-Virus Malware How to Change the Default Application for Android Tasks Stop Believing TV’s Lies: The Real Truth About "Enhancing" Images The How-To Geek Valentine’s Day Gift Guide CyanogenMod Updates; Rolls out Android 2.3 to the Less Fortunate MyPaint is an Open-Source Graphics App for Digital Painters Can the Birds and Pigs Really Be Friends in the End? [Angry Birds Video] Add the 2D Version of the New Unity Interface to Ubuntu 10.10 and 11.04 MightyMintyBoost Is a 3-in-1 Gadget Charger Watson Ties Against Human Jeopardy Opponents

    Read the article

  • How to suppress or disable the shutdown option from indicator menu or shutdown dialog?

    - by user73093
    My goal is to allow user only to restart the system, and deny any shutdown (suspend, hibernate). I am running unity-2d. I 've managed to deny suspend and hibernate with polkit policy files like explained in How to disable shutdown/reboot/suspend/hibernate? I observed that is has somehow disable shutdown abilities, but hasn't removed "shutdown" entry from the indicator panel menu neither as well as the "shutdown..." button from the shutdown dialog. Pressing shutdown button at this point restarts lightdm, returning to the login screen. My goal is to remove any "shutdown" action and button. So, I 've added an ovveride file in /usr/share/glib-2.0/schemas that contains some rules: [com.canonical.indicator.session] suppress-shutdown-menuitem = true (all suppress-*-menuitem has "false" value by default in the schema) Compiling, restarting X, now there is an entry "close session..." in the indicator panel menu...: it's not what I want. at this point, if I set another entry suppress-logout-menuitem to true I got no entry in the indicator panel menu. Trying like this all combination doesn't give the opportunity to remove "shutdown" references/buttons without removing restart option. All I want is to remove any reference to "shutdown" but keep a "restart" option somewhere in the indicator menu... Thanks !

    Read the article

  • Intel N10 graphics

    - by Rapsag1980
    Español: Buen día. Instalé en una notebook ubuntu 12.04 pero me da el problema que solamente me da dos resoluciones de pantallas 800x600 y 1024x768... En la primera se ve muy grotesca la pantalla y en la segunda se ve bien, pero falta un pedazo de pantalla arriba y abajo... He tratado de buscar información sobre el tema pero parece uno de esos "bugs" que no han conseguido ser erradicados... Intenté hacer el Xorg.conf y esas cosas y nomas no se puede... Recurro a su sapiencia y experiencia en este tipo de problemas... La mini es una Lanix Neuron lt, procesador intel atom n450 y la tarjeta Intel corporation N10 family integrated graphics controller.... Inglés: Good day. I installed ubuntu 12.04 on a notebook but I get the problem that only gives me two screen resolutions of 800x600 and 1024x768 ... The first screen looks very grotesque and the second looks good, but missing a piece of screen up and down ... I tried to find information on the subject but it seems one of those "bugs" that have failed to be eradicated ... I tried to do the Xorg.conf nomas and stuff and you can not ... I appeal to your wisdom and experience in this kind of problem ... The mini is a Neuron Lanix lt, Intel Atom N450 processor and the Intel integrated graphics family corporation N10 controller ....

    Read the article

  • How to Use Vim-Style Keyboard Shortcuts for OS X Tab Navigation

    - by The Geek
    After switching to OS X when I got a new MacBook Air, one of the first things I needed to duplicate was my extremely customized AutoHotkey setup — the most important of which is using the J and K keys to navigate throughout tabbed windows easily. Yeah, I’m a Vim user. I’ve never been a fan of having to use CTRL + TAB to switch from one tab to the next — to start with, you have to move your hands from the home row, and it’s awkward, and why should I have to do that just because somebody decided that keyboard shortcut before tabs became popular? If you think about it, if tabbed browsers were popular back when keyboard shortcuts were being invented, they would have definitely reserved some of the good shortcuts for switching tabs. On Windows, I’ve always used an AutoHotkey script to make things the way I wanted it:  ALT + J and ALT + K for selecting previous and next tabs. Once you get used to it, it’s extremely awesome, and so much faster than using CTRL + TAB. Of course, I also hacked CTRL + T and CTRL + W into ALT + T and ALT + W so I could open new tabs and close them without moving my hands from the home row. Over on OS X, it turns out that it’s incredibly simple and easy to use CMD + J and CMD + K for next/previous tab navigation, and it works in most applications that support tabs, like Terminal, Safari, or Google Chrome.    

    Read the article

  • How to Use Windows’ Advanced Search Features: Everything You Need to Know

    - by Chris Hoffman
    You should never have to hunt down a lost file on modern versions of Windows — just perform a quick search. You don’t even have to wait for a cartoon dog to find your files, like on Windows XP. The Windows search indexer is constantly running in the background to make quick local searches possible. This enables the kind of powerful search features you’d use on Google or Bing — but for your local files. Controlling the Indexer By default, the Windows search indexer watches everything under your user folder — that’s C:\Users\NAME. It reads all these files, creating an index of their names, contents, and other metadata. Whenever they change, it notices and updates its index. The index allows you to quickly find a file based on the data in the index. For example, if you want to find files that contain the word “beluga,” you can perform a search for “beluga” and you’ll get a very quick response as Windows looks up the word in its search index. If Windows didn’t use an index, you’d have to sit and wait as Windows opened every file on your hard drive, looked to see if the file contained the word “beluga,” and moved on. Most people shouldn’t have to modify this indexing behavior. However, if you store your important files in other folders — maybe you store your important data a separate partition or drive, such as at D:\Data — you may want to add these folders to your index. You can also choose which types of files you want to index, force Windows to rebuild the index entirely, pause the indexing process so it won’t use any system resources, or move the index to another location to save space on your system drive. To open the Indexing Options window, tap the Windows key on your keyboard, type “index”, and click the Indexing Options shortcut that appears. Use the Modify button to control the folders that Windows indexes or the Advanced button to control other options. To prevent Windows from indexing entirely, click the Modify button and uncheck all the included locations. You could also disable the search indexer entirely from the Programs and Features window. Searching for Files You can search for files right from your Start menu on Windows 7 or Start screen on Windows 8. Just tap the Windows key and perform a search. If you wanted to find files related to Windows, you could perform a search for “Windows.” Windows would show you files that are named Windows or contain the word Windows. From here, you can just click a file to open it. On Windows 7, files are mixed with other types of search results. On Windows 8 or 8.1, you can choose to search only for files. If you want to perform a search without leaving the desktop in Windows 8.1, press Windows Key + S to open a search sidebar. You can also initiate searches directly from Windows Explorer — that’s File Explorer on Windows 8. Just use the search box at the top-right of the window. Windows will search the location you’ve browsed to. For example, if you’re looking for a file related to Windows and know it’s somewhere in your Documents library, open the Documents library and search for Windows. Using Advanced Search Operators On Windows 7, you’ll notice that you can add “search filters” form the search box, allowing you to search by size, date modified, file type, authors, and other metadata. On Windows 8, these options are available from the Search Tools tab on the ribbon. These filters allow you to narrow your search results. If you’re a geek, you can use Windows’ Advanced Query Syntax to perform advanced searches from anywhere, including the Start menu or Start screen. Want to search for “windows,” but only bring up documents that don’t mention Microsoft? Search for “windows -microsoft”. Want to search for all pictures of penguins on your computer, whether they’re PNGs, JPEGs, or any other type of picture file? Search for “penguin kind:picture”. We’ve looked at Windows’ advanced search operators before, so check out our in-depth guide for more information. The Advanced Query Syntax gives you access to options that aren’t available in the graphical interface. Creating Saved Searches Windows allows you to take searches you’ve made and save them as a file. You can then quickly perform the search later by double-clicking the file. The file functions almost like a virtual folder that contains the files you specify. For example, let’s say you wanted to create a saved search that shows you all the new files created in your indexed folders within the last week. You could perform a search for “datecreated:this week”, then click the Save search button on the toolbar or ribbon. You’d have a new virtual folder you could quickly check to see your recent files. One of the best things about Windows search is that it’s available entirely from the keyboard. Just press the Windows key, start typing the name of the file or program you want to open, and press Enter to quickly open it. Windows 8 made this much more obnoxious with its non-unified search, but unified search is finally returning with Windows 8.1.     

    Read the article

  • iPhone keyboard doesn't appear when entering a UITextField

    - by Norm
    This has to be some kind of newbie blunder that I just can’t see, and I’d be grateful for hints as to what to check or where to look. I've followed an iPhone tutorial that has a UITextField, making sure I connected the IBOutlet for the text field, and it seems to compile properly (no errors or warnings). But when I run it under the simulator, and click in the field, I don’t get the keyboard, so I can’t enter anything into the field. I’ve tried searching the site for similar questions, and all I’ve found is a few questions where the developer is trying to set up some complex UI with multiple controllers, and one that seemed to be the same issue, but the original poster simply said that he solved it by starting a new project and porting the code over. I’d like to find an actual solution, so I don’t have to try randomly rebuilding projects when this issue comes up again. Thanks!

    Read the article

  • asp.net search application index update help

    - by srinivasan
    hi im developing a simple search application( ASP.Net VB.Net) the index table is actually a hash table ll be stored in my file system. the search page ll open this in read mode n copy this to a hash table object n perform search. other update n delete functions will open this in write mode n update it. what should i ve to do to make this app correct that there shud not be any execption when multiple user accessing these things at the same time. wat do i ve to do to make this robust and error free. i want multiple users to access search page without any problem n the index updation also in a parallel manner thanks srinivasan

    Read the article

  • How do I use texture-mapping in a simple ray tracer?

    - by fastrack20
    I am attempting to add features to a ray tracer in C++. Namely, I am trying to add texture mapping to the spheres. For simplicity, I am using an array to store the texture data. I obtained the texture data by using a hex editor and copying the correct byte values into an array in my code. This was just for my testing purposes. When the values of this array correspond to an image that is simply red, it appears to work close to what is expected except there is no shading. The bottom right of the image shows what a correct sphere should look like. This sphere's colour using one set colour, not a texture map. Another problem is that when the texture map is of something other than just one colour pixels, it turns white. My test image is a picture of water, and when it maps, it shows only one ring of bluish pixels surrounding the white colour. When this is done, it simply appears as this: Here are a few code snippets: Color getColor(const Object *object,const Ray *ray, float *t) { if (object->materialType == TEXTDIF || object->materialType == TEXTMATTE) { float distance = *t; Point pnt = ray->origin + ray->direction * distance; Point oc = object->center; Vector ve = Point(oc.x,oc.y,oc.z+1) - oc; Normalize(&ve); Vector vn = Point(oc.x,oc.y+1,oc.z) - oc; Normalize(&vn); Vector vp = pnt - oc; Normalize(&vp); double phi = acos(-vn.dot(vp)); float v = phi / M_PI; float u; float num1 = (float)acos(vp.dot(ve)); float num = (num1 /(float) sin(phi)); float theta = num /(float) (2 * M_PI); if (theta < 0 || theta == NAN) {theta = 0;} if (vn.cross(ve).dot(vp) > 0) { u = theta; } else { u = 1 - theta; } int x = (u * IMAGE_WIDTH) -1; int y = (v * IMAGE_WIDTH) -1; int p = (y * IMAGE_WIDTH + x)*3; return Color(TEXT_DATA[p+2],TEXT_DATA[p+1],TEXT_DATA[p]); } else { return object->color; } }; I call the colour code here in Trace: if (object->materialType == MATTE) return getColor(object, ray, &t); Ray shadowRay; int isInShadow = 0; shadowRay.origin.x = pHit.x + nHit.x * bias; shadowRay.origin.y = pHit.y + nHit.y * bias; shadowRay.origin.z = pHit.z + nHit.z * bias; shadowRay.direction = light->object->center - pHit; float len = shadowRay.direction.length(); Normalize(&shadowRay.direction); float LdotN = shadowRay.direction.dot(nHit); if (LdotN < 0) return 0; Color lightColor = light->object->color; for (int k = 0; k < numObjects; k++) { if (Intersect(objects[k], &shadowRay, &t) && !objects[k]->isLight) { if (objects[k]->materialType == GLASS) lightColor *= getColor(objects[k], &shadowRay, &t); // attenuate light color by glass color else isInShadow = 1; break; } } lightColor *= 1.f/(len*len); return (isInShadow) ? 0 : getColor(object, &shadowRay, &t) * lightColor * LdotN; } I left out the rest of the code as to not bog down the post, but it can be seen here. Any help is greatly appreciated. The only portion not included in the code, is where I define the texture data, which as I said, is simply taken straight from a bitmap file of the above image. Thanks.

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Samba with Active Directory - shares are readonly, NT_STATUS_MEDIA_WRITE_PROTECTED

    - by froh42
    I've set a samba server that seems to work, all shares are seemingly exported as readonly, however. The machine is called "lx". When I'm on lx I can run the following command: froh@lx:~$ smbclient //lx/export -UAdministrator Enter Administrator's password: Domain=[CUSTOMER] OS=[Unix] Server=[Samba 3.5.4] smb: \> mkdir wrzlbrmpf NT_STATUS_MEDIA_WRITE_PROTECTED making remote directory \wrzlbrmpf smb: \> ls . D 0 Fri Dec 3 19:04:20 2010 .. D 0 Sun Nov 28 01:32:37 2010 zork D 0 Fri Dec 3 18:53:33 2010 bar D 0 Sun Nov 28 23:52:43 2010 ork 1 Fri Dec 3 18:53:02 2010 foo 1 Sun Nov 28 23:52:41 2010 gaga D 0 Fri Dec 3 19:04:20 2010 How can I troubleshoot this? What I did: First I set up a fresh install of Ubuntu 10.10 x64. Second I got kerberos working with the following krb5.conf file: [libdefaults] ticket_lifetime = 24000 clock_skew = 300 default_realm = CUSTOMER.LOCAL [realms] CUSTOMER.LOCAL = { kdc = SB4.customer.local:88 admin_server = SB4.customer.local:464 default_domain = CUSTOMER.LOCAL } [domain_realm] .customer.local = CUSTOMER.LOCAL customer.local = CUSTOMER.LOCAL #[login] # krb4_convert = true # krb4_get_tickets = false I also added winbind to group, passwd and shadow in nsswitch.conf. Seemingly Kerberos works: root@lx:~# net ads testjoin Join is OK root@lx:~# wbinfo -a 'Administrator%MYSECRETPASSWORD' plaintext password authentication succeeded challenge/response password authentication succeeded wbinfo -u and wbinfo -g also spit out a list of users and a list of groups respectiveley. I noted that domain accounts did NOT include a domain and they are in german (as on the SBS 2003 that is the domain server). So I get a "Domänenbenutzer" in wbinfo -u's output not a "CUSTOMER+Domain User" or something similar. I'm not sure anymore what I did to the PAM configuration, but here is what I currently have: root@lx:/etc/pam.d# cat samba @include common-auth @include common-account @include common-session-noninteractive root@lx:/etc/pam.d# grep -ve '^#' common-auth auth [success=3 default=ignore] pam_krb5.so minimum_uid=1000 auth [success=2 default=ignore] pam_unix.so nullok_secure try_first_pass auth [success=1 default=ignore] pam_winbind.so krb5_auth krb5_ccache_type=FILE cached_login try_first_pass auth requisite pam_deny.so auth required pam_permit.so root@lx:/etc/pam.d# grep -ve '^#' common-account account [success=2 new_authtok_reqd=done default=ignore] pam_unix.so account [success=1 new_authtok_reqd=done default=ignore] pam_winbind.so account requisite pam_deny.so account required pam_permit.so account required pam_krb5.so minimum_uid=1000 root@lx:/etc/pam.d# grep -ve '^#' common-session-noninteractive session [default=1] pam_permit.so session requisite pam_deny.so session required pam_permit.so session optional pam_krb5.so minimum_uid=1000 session required pam_unix.so session optional pam_winbind.so At some point I joined the linux box into the AD domain. After (manually) creating a home directory on the linux box I can log in using the Adminstrator user with the password taken from AD. Now I run samba with the following setup: [global] netbios name = LX realm = CUSTOMER.LOCAL workgroup = CUSTOMER security = ADS encrypt passwords = yes password server = 192.168.20.244 #IP des Domain Controllers os level = 0 socket options = TCP_NODELAY SO_RCVBUF=16384 SO_SNDBUF=16384 idmap uid = 10000-20000 idmap gid = 10000-20000 winbind enum users = Yes winbind enum groups = Yes preferred master = no winbind separator = + dns proxy = no wins proxy = no # client NTLMv2 auth = Yes log level = 2 logfile = /var/log/samba/log.smbd.%U template homedir = /home/%U template shell = /bin/bash [export] path = /mnt/sdc1/export read only = No public = Yes Currently I don't care whether export is exported to everyone or just one user, I want to see somebody WRITING to that directory before I start fiddling with the authentication settings. (Who may access it). As mentioned, accessing the share from smbclient results in this NT_STATUS_MEDIA_WRITE_PROTECTED . Accessing it from windows shows ACLs that look correct (The user may write) - but it does not work, I can only read files not write. The directory to be exported looks like this: root@lx:/etc/pam.d# ls -ld /mnt/ drwxr-xr-x 5 root root 4096 2010-11-28 01:29 /mnt/ root@lx:/etc/pam.d# ls -ld /mnt/sdc1/ drwxr-xr-x 4 froh froh 4096 2010-11-28 01:32 /mnt/sdc1/ root@lx:/etc/pam.d# ls -ld /mnt/sdc1/export/ drwxrwxrwx+ 5 administrator domänen-admins 4096 2010-12-03 19:04 /mnt/sdc1/export/ root@lx:/etc/pam.d# getfacl /mnt/ getfacl: Entferne führende '/' von absoluten Pfadnamen # file: mnt/ # owner: root # group: root user::rwx group::r-x other::r-x root@lx:/etc/pam.d# getfacl /mnt/sdc1/ getfacl: Entferne führende '/' von absoluten Pfadnamen # file: mnt/sdc1/ # owner: froh # group: froh user::rwx group::r-x other::r-x root@lx:/etc/pam.d# getfacl /mnt/sdc1/export/ getfacl: Entferne führende '/' von absoluten Pfadnamen # file: mnt/sdc1/export/ # owner: administrator # group: domänen-admins user::rwx group::rwx group:domänen-admins:rwx mask::rwx other::rwx default:user::rwx default:group::rwx default:group:domänen-admins:rwx default:mask::rwx default:other::rwx My, oh my what am I overlooking? What am I to blind to see?

    Read the article

  • Samba with Active Directory - shares are readonly, NT_STATUS_MEDIA_WRITE_PROTECTED

    - by froh42
    I've set a samba server that seems to work, all shares are seemingly exported as readonly, however. The machine is called "lx". When I'm on lx I can run the following command: froh@lx:~$ smbclient //lx/export -UAdministrator Enter Administrator's password: Domain=[CUSTOMER] OS=[Unix] Server=[Samba 3.5.4] smb: \> mkdir wrzlbrmpf NT_STATUS_MEDIA_WRITE_PROTECTED making remote directory \wrzlbrmpf smb: \> ls . D 0 Fri Dec 3 19:04:20 2010 .. D 0 Sun Nov 28 01:32:37 2010 zork D 0 Fri Dec 3 18:53:33 2010 bar D 0 Sun Nov 28 23:52:43 2010 ork 1 Fri Dec 3 18:53:02 2010 foo 1 Sun Nov 28 23:52:41 2010 gaga D 0 Fri Dec 3 19:04:20 2010 How can I troubleshoot this? What I did: First I set up a fresh install of Ubuntu 10.10 x64. Second I got kerberos working with the following krb5.conf file: [libdefaults] ticket_lifetime = 24000 clock_skew = 300 default_realm = CUSTOMER.LOCAL [realms] CUSTOMER.LOCAL = { kdc = SB4.customer.local:88 admin_server = SB4.customer.local:464 default_domain = CUSTOMER.LOCAL } [domain_realm] .customer.local = CUSTOMER.LOCAL customer.local = CUSTOMER.LOCAL #[login] # krb4_convert = true # krb4_get_tickets = false I also added winbind to group, passwd and shadow in nsswitch.conf. Seemingly Kerberos works: root@lx:~# net ads testjoin Join is OK root@lx:~# wbinfo -a 'Administrator%MYSECRETPASSWORD' plaintext password authentication succeeded challenge/response password authentication succeeded wbinfo -u and wbinfo -g also spit out a list of users and a list of groups respectiveley. I noted that domain accounts did NOT include a domain and they are in german (as on the SBS 2003 that is the domain server). So I get a "Domänenbenutzer" in wbinfo -u's output not a "CUSTOMER+Domain User" or something similar. I'm not sure anymore what I did to the PAM configuration, but here is what I currently have: root@lx:/etc/pam.d# cat samba @include common-auth @include common-account @include common-session-noninteractive root@lx:/etc/pam.d# grep -ve '^#' common-auth auth [success=3 default=ignore] pam_krb5.so minimum_uid=1000 auth [success=2 default=ignore] pam_unix.so nullok_secure try_first_pass auth [success=1 default=ignore] pam_winbind.so krb5_auth krb5_ccache_type=FILE cached_login try_first_pass auth requisite pam_deny.so auth required pam_permit.so root@lx:/etc/pam.d# grep -ve '^#' common-account account [success=2 new_authtok_reqd=done default=ignore] pam_unix.so account [success=1 new_authtok_reqd=done default=ignore] pam_winbind.so account requisite pam_deny.so account required pam_permit.so account required pam_krb5.so minimum_uid=1000 root@lx:/etc/pam.d# grep -ve '^#' common-session-noninteractive session [default=1] pam_permit.so session requisite pam_deny.so session required pam_permit.so session optional pam_krb5.so minimum_uid=1000 session required pam_unix.so session optional pam_winbind.so At some point I joined the linux box into the AD domain. After (manually) creating a home directory on the linux box I can log in using the Adminstrator user with the password taken from AD. Now I run samba with the following setup: [global] netbios name = LX realm = CUSTOMER.LOCAL workgroup = CUSTOMER security = ADS encrypt passwords = yes password server = 192.168.20.244 #IP des Domain Controllers os level = 0 socket options = TCP_NODELAY SO_RCVBUF=16384 SO_SNDBUF=16384 idmap uid = 10000-20000 idmap gid = 10000-20000 winbind enum users = Yes winbind enum groups = Yes preferred master = no winbind separator = + dns proxy = no wins proxy = no # client NTLMv2 auth = Yes log level = 2 logfile = /var/log/samba/log.smbd.%U template homedir = /home/%U template shell = /bin/bash [export] path = /mnt/sdc1/export read only = No public = Yes Currently I don't care whether export is exported to everyone or just one user, I want to see somebody WRITING to that directory before I start fiddling with the authentication settings. (Who may access it). As mentioned, accessing the share from smbclient results in this NT_STATUS_MEDIA_WRITE_PROTECTED . Accessing it from windows shows ACLs that look correct (The user may write) - but it does not work, I can only read files not write. The directory to be exported looks like this: root@lx:/etc/pam.d# ls -ld /mnt/ drwxr-xr-x 5 root root 4096 2010-11-28 01:29 /mnt/ root@lx:/etc/pam.d# ls -ld /mnt/sdc1/ drwxr-xr-x 4 froh froh 4096 2010-11-28 01:32 /mnt/sdc1/ root@lx:/etc/pam.d# ls -ld /mnt/sdc1/export/ drwxrwxrwx+ 5 administrator domänen-admins 4096 2010-12-03 19:04 /mnt/sdc1/export/ root@lx:/etc/pam.d# getfacl /mnt/ getfacl: Entferne führende '/' von absoluten Pfadnamen # file: mnt/ # owner: root # group: root user::rwx group::r-x other::r-x root@lx:/etc/pam.d# getfacl /mnt/sdc1/ getfacl: Entferne führende '/' von absoluten Pfadnamen # file: mnt/sdc1/ # owner: froh # group: froh user::rwx group::r-x other::r-x root@lx:/etc/pam.d# getfacl /mnt/sdc1/export/ getfacl: Entferne führende '/' von absoluten Pfadnamen # file: mnt/sdc1/export/ # owner: administrator # group: domänen-admins user::rwx group::rwx group:domänen-admins:rwx mask::rwx other::rwx default:user::rwx default:group::rwx default:group:domänen-admins:rwx default:mask::rwx default:other::rwx My, oh my what am I overlooking? What am I to blind to see?

    Read the article

  • What’s New in The Second Edition of Regular Expressions Cookbook

    - by Jan Goyvaerts
    %COOKBOOKFRAME% The second edition of Regular Expressions Cookbook is a completely revised edition, not just a minor update. All of the content from the first edition has been updated for the latest versions of the regular expression flavors and programming languages we discuss. We’ve corrected all errors that we could find and rewritten many sections that were either unclear or lacking in detail. And lack of detail was not something the first edition was accused of. Expect the second edition to really dot all i’s and cross all t’s. A few sections were removed. In particular, we removed much talk about browser inconsistencies as modern browsers are much more compatible with the official JavaScript standard. There is plenty of new content. The second edition has 101 more pages, bringing the total to 612. It’s almost 20% bigger than the first edition. We’ve added XRegExp as an additional regex flavor to all recipes throughout the book where XRegExp provides a better solution than standard JavaScript. We did keep the standard JavaScript solutions, so you can decide which is better for your needs. The new edition adds 21 recipes, bringing the total to 146. 14 of the new recipes are in the new Source Code and Log Files chapter. These recipes demonstrate techniques that are very useful for manipulating source code in a text editor and for dealing with log files using a grep tool. Chapter 3 which has recipes for programming with regular expressions gets only one new recipe, but it’s a doozy. If anyone has ever flamed you for using a regular expression instead of a parser, you’ll now be able to tell them how you can create your own parser by mixing regular expressions with procedural code. Combined with the recipes from the new Source Code and Log Files chapter, you can create parsers for whatever custom language or file format you like. If you have any interest in regular expressions at all, whether you’re a beginner or already consider yourself an expert, you definitely need a copy of the second edition of Regular Expressions Cookbook if you didn’t already buy the first. If you did buy the first edition, and you often find yourself referring back to it, then the second edition is a very worthwhile upgrade. You can buy the second edition of Regular Expressions Cookbook from Amazon or wherever technical books are sold. Ask for ISBN 1449319432.

    Read the article

< Previous Page | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >