Search Results

Search found 13955 results on 559 pages for 'easy angel'.

Page 517/559 | < Previous Page | 513 514 515 516 517 518 519 520 521 522 523 524  | Next Page >

  • [c++] upload image to imageshack

    - by cinek1lol
    Hi! I would like to send pictures via a program written in C + +. - OK WinExec("C:\\curl\\curl.exe -H Expect: -F \"fileupload=@C:\\curl\\ok.jpg\" -F \"xml=yes\" -# \"http://www.imageshack.us/index.php\" -o data.txt -A \"Mozilla/5.0 (Windows; U; Windows NT 5.1; en-US; rv:1.8.1.1) Gecko/20061204 Firefox/2.0.0.1\" -e \"http://www.imageshack.us\"", NULL); It works, but I would like to send the pictures from pre-loaded carrier to a variable char (you know what I mean? First off, I load the pictures into a variable and then send the variable), cause now I have to specify the path of the picture on a disk. I wanted to write this program in c++ by using the curl library, not through exe. extension. I have also found such a program (which has been modified by me a bit) #include <stdio.h> #include <string.h> #include <iostream> #include <curl/curl.h> #include <curl/types.h> #include <curl/easy.h> int main(int argc, char *argv[]) { CURL *curl; CURLcode res; struct curl_httppost *formpost=NULL; struct curl_httppost *lastptr=NULL; struct curl_slist *headerlist=NULL; static const char buf[] = "Expect:"; curl_global_init(CURL_GLOBAL_ALL); /* Fill in the file upload field */ curl_formadd(&formpost, &lastptr, CURLFORM_COPYNAME, "send", CURLFORM_FILE, "nowy.jpg", CURLFORM_END); curl_formadd(&formpost, &lastptr, CURLFORM_COPYNAME, "nowy.jpg", CURLFORM_COPYCONTENTS, "nowy.jpg", CURLFORM_END); curl_formadd(&formpost, &lastptr, CURLFORM_COPYNAME, "submit", CURLFORM_COPYCONTENTS, "send", CURLFORM_END); curl = curl_easy_init(); headerlist = curl_slist_append(headerlist, buf); if(curl) { curl_easy_setopt(curl, CURLOPT_URL, "http://www.imageshack.us/index.php"); if ( (argc == 2) && (!strcmp(argv[1], "xml=yes")) ) curl_easy_setopt(curl, CURLOPT_HTTPHEADER, headerlist); curl_easy_setopt(curl, CURLOPT_HTTPPOST, formpost); res = curl_easy_perform(curl); curl_easy_cleanup(curl); curl_formfree(formpost); curl_slist_free_all (headerlist); } system("pause"); return 0; }

    Read the article

  • C strange array behaviour

    - by LukeN
    After learning that both strncmp is not what it seems to be and strlcpy not being available on my operating system (Linux), I figured I could try and write it myself. I found a quote from Ulrich Drepper, the libc maintainer, who posted an alternative to strlcpy using mempcpy. I don't have mempcpy either, but it's behaviour was easy to replicate. First of, this is the testcase I have #include <stdio.h> #include <string.h> #define BSIZE 10 void insp(const char* s, int n) { int i; for (i = 0; i < n; i++) printf("%c ", s[i]); printf("\n"); for (i = 0; i < n; i++) printf("%02X ", s[i]); printf("\n"); return; } int copy_string(char *dest, const char *src, int n) { int r = strlen(memcpy(dest, src, n-1)); dest[r] = 0; return r; } int main() { char b[BSIZE]; memset(b, 0, BSIZE); printf("Buffer size is %d", BSIZE); insp(b, BSIZE); printf("\nFirst copy:\n"); copy_string(b, "First", BSIZE); insp(b, BSIZE); printf("b = '%s'\n", b); printf("\nSecond copy:\n"); copy_string(b, "Second", BSIZE); insp(b, BSIZE); printf("b = '%s'\n", b); return 0; } And this is its result: Buffer size is 10 00 00 00 00 00 00 00 00 00 00 First copy: F i r s t b = 46 69 72 73 74 00 62 20 3D 00 b = 'First' Second copy: S e c o n d 53 65 63 6F 6E 64 00 00 01 00 b = 'Second' You can see in the internal representation (the lines insp() created) that there's some noise mixed in, like the printf() format string in the inspection after the first copy, and a foreign 0x01 in the second copy. The strings are copied intact and it correctly handles too long source strings (let's ignore the possible issue with passing 0 as length to copy_string for now, I'll fix that later). But why are there foreign array contents (from the format string) inside my destination? It's as if the destination was actually RESIZED to match the new length.

    Read the article

  • C++ addition overload ambiguity

    - by Nate
    I am coming up against a vexing conundrum in my code base. I can't quite tell why my code generates this error, but (for example) std::string does not. class String { public: String(const char*str); friend String operator+ ( const String& lval, const char *rval ); friend String operator+ ( const char *lval, const String& rval ); String operator+ ( const String& rval ); }; The implementation of these is easy enough to imagine on your own. My driver program contains the following: String result, lval("left side "), rval("of string"); char lv[] = "right side ", rv[] = "of string"; result = lv + rval; printf(result); result = (lval + rv); printf(result); Which generates the following error in gcc 4.1.2: driver.cpp:25: error: ISO C++ says that these are ambiguous, even though the worst conversion for the first is better than the worst conversion for the second: String.h:22: note: candidate 1: String operator+(const String&, const char*) String.h:24: note: candidate 2: String String::operator+(const String&) So far so good, right? Sadly, my String(const char *str) constructor is so handy to have as an implicit constructor, that using the explicit keyword to solve this would just cause a different pile of problems. Moreover... std::string doesn't have to resort to this, and I can't figure out why. For example, in basic_string.h, they are declared as follows: template<typename _CharT, typename _Traits, typename _Alloc> basic_string<_CharT, _Traits, _Alloc> operator+(const basic_string<_CharT, _Traits, _Alloc>& __lhs, const basic_string<_CharT, _Traits, _Alloc>& __rhs) template<typename _CharT, typename _Traits, typename _Alloc> basic_string<_CharT,_Traits,_Alloc> operator+(const _CharT* __lhs, const basic_string<_CharT,_Traits,_Alloc>& __rhs); and so on. The basic_string constructor is not declared explicit. How does this not cause the same error I'm getting, and how can I achieve the same behavior??

    Read the article

  • MATLAB plot moving data points in seperate subplots simutaneously

    - by Nate B.
    I wish to visualize the movement of a data point throughout space across a period of time within MATLAB. However, the way I want my figure to display is such that only a single instant is plotted at any given time. That was easy, I simply created a for loop to update my 3D plot display for every set of coordinates (x,y,z) in my data. However, I wish to display 4 different viewing angles of this plot at all times. I am well aware of how to setup subplots within MATLAB, that is not the issue. My issue is getting all 4 of these subplots to execute simultaneously so that all 4 subplots are always displaying the same point in time. I would appreciate if anyone could suggest how to handle this issue. As requested, my code for a figure with a single plot is shown below: datan = DATA; %data in form of x,y,z,a,b,c by column for row# of time points tib=zeros(size(datan,1),12); tib(:,1:3) = datan(:,1:3); tib_ref=tib(1,1:3); for i=1:size(datan,1) tib(i,1:3)=tib(i,1:3)-tib_ref; end angle_to_dircos close all figure('Name','Directions (Individual Cycles)','NumberTitle','off') for cc=1:2 hold off for bb=1:10:size(tib,1); scatter3(tib(bb,1),tib(bb,2),tib(bb,3),'green','filled'); %z and y axes are flipped in polhemus system hold on p0 = [tib(bb,1),tib(bb,2),tib(bb,3)]; p1 = [tib(bb,1)+10*tib(bb,4),tib(bb,2)+10*tib(bb,5),tib(bb,3)+10*tib(bb,6)]; p2 = [tib(bb,1)+10*tib(bb,7),tib(bb,2)+10*tib(bb,8),tib(bb,3)+10*tib(bb,9)]; p3 = [-(tib(bb,1)+100*tib(bb,10)),-(tib(bb,2)+100*tib(bb,11)),-(tib(bb,3)+100*tib(bb,12))]; vectarrow(p0,p1,1,0,0) hold on vectarrow(p0,p2,0,1,0) hold on vectarrow(p0,p3,0,0,1) hold on az = 90; el = 0; view(az, el); xlim([-50,50]); ylim([-50,50]); zlim([-50,50]); xlabel('distance from center in X'); ylabel('distance from center in Y'); zlabel('distance from center in Z'); title('XYZ Scatter Plots of Tracker Position'); hold on plot3(0,0,0,'sk','markerfacecolor',[0,0,0]); p0 = [0,0,0]; p1 = [10,0,0]; p2 = [0,10,0]; p3 = [0,0,100]; vectarrow(p0,p1,1,0,0) hold on vectarrow(p0,p2,0,1,0) hold on vectarrow(p0,p3,1,0,1) drawnow; end end

    Read the article

  • When to call glEnable(GL_FRAMEBUFFER_SRGB)?

    - by Steven Lu
    I have a rendering system where I draw to an FBO with a multisampled renderbuffer, then blit it to another FBO with a texture in order to resolve the samples in order to read off the texture to perform post-processing shading while drawing to the backbuffer (FBO index 0). Now I'd like to get some correct sRGB output... The problem is the behavior of the program is rather inconsistent between when I run it on OS X and Windows and this also changes depending on the machine: On Windows with the Intel HD 3000 it will not apply the sRGB nonlinearity but on my other machine with a Nvidia GTX 670 it does. On the Intel HD 3000 in OS X it will also apply it. So this probably means that I'm not setting my GL_FRAMEBUFFER_SRGB enable state at the right points in the program. However I can't seem to find any tutorials that actually tell me when I ought to enable it, they only ever mention that it's dead easy and comes at no performance cost. I am currently not loading in any textures so I haven't had a need to deal with linearizing their colors yet. To force the program to not simply spit back out the linear color values, what I have tried is simply comment out my glDisable(GL_FRAMEBUFFER_SRGB) line, which effectively means this setting is enabled for the entire pipeline, and I actually redundantly force it back on every frame. I don't know if this is correct or not. It certainly does apply a nonlinearization to the colors but I can't tell if this is getting applied twice (which would be bad). It could apply the gamma as I render to my first FBO. It could do it when I blit the first FBO to the second FBO. Why not? I've gone so far as to take screen shots of my final frame and compare raw pixel color values to the colors I set them to in the program: I set the input color to RGB(1,2,3) and the output is RGB(13,22,28). That seems like quite a lot of color compression at the low end and leads me to question if the gamma is getting applied multiple times. I have just now gone through the sRGB equation and I can verify that the conversion seems to be only applied once as linear 1/255, 2/255, and 3/255 do indeed map to sRGB 13/255, 22/255, and 28/255 using the equation 1.055*C^(1/2.4)+0.055. Given that the expansion is so large for these low color values it really should be obvious if the sRGB color transform is getting applied more than once. So, I still haven't determined what the right thing to do is. does glEnable(GL_FRAMEBUFFER_SRGB) only apply to the final framebuffer values, in which case I can just set this during my GL init routine and forget about it hereafter?

    Read the article

  • How can you prevent both jumpiness, and interrupting tweens with animated Flash buttons?

    - by Kevin Suttle
    This is something I've never been able to figure out. You've got a button offscreen you want to animate in. We'll call it 'btn.' You've got a hit area that serves as the proximity sensor to trigger btn's animation. We'll call it 'hitZone' (as to not cause confusion with the hitArea property of display objects). Both btn and hitZone are MovieClips. The listeners go something like this. import com.greensock.*; import com.greensock.easing.*; import flash.events.MouseEvent; var endPoint:Number = 31; hitZone.addEventListener(MouseEvent.ROLL_OVER, onHitZoneOver); hitZone.addEventListener(MouseEvent.ROLL_OUT, onHitZoneOut); hitZone.addEventListener(MouseEvent.CLICK, onHitZoneClick); btn.addEventListener(MouseEvent.ROLL_OVER, onBtnOver); btn.addEventListener(MouseEvent.ROLL_OUT, onBtnOut); btn.addEventListener(MouseEvent.CLICK, onBtnClick); btn.mouseChildren = false; function onHitZoneOver(e:MouseEvent):void { TweenLite.to(btn, 0.75, {x:endPoint, ease:Expo.easeOut}); trace("over hitZone"); } function onHitZoneOut(e:MouseEvent):void { TweenLite.to(btn, 0.75, {x:-1, ease:Expo.easeOut}); trace("out hitZone"); } function onBtnOver(e:MouseEvent):void { hitZone.mouseEnabled = false; hitZone.removeEventListener(MouseEvent.ROLL_OVER, onHitZoneOver); hitZone.removeEventListener(MouseEvent.ROLL_OUT, onHitZoneOut); trace("over BTN"); // This line is the only thing keeping the btn animation from being fired continuously // causing jumpiness. However, calling this allows the animation to be interrupted // at any point. TweenLite.killTweensOf(btn); } function onBtnOut(e:MouseEvent):void { hitZone.mouseEnabled = true; hitZone.addEventListener(MouseEvent.ROLL_OVER, onHitZoneOver); hitZone.addEventListener(MouseEvent.ROLL_OUT, onHitZoneOut); trace("out BTN"); } function onBtnClick(e:MouseEvent):void { trace("click BTN"); } function onHitZoneClick(e:MouseEvent):void { trace("click hitZone"); } The issue is when your mouse is over both the hitZone and btn. The button continuously jumps unless you call TweenLite.killAllTweensOf(). This fixes the jumpiness, but it introduces a new problem. Now, it's very easy to interrupt the animation of the btn at any point, stopping it before it's totally visible on the stage. I've seen similar posts, but even they suffer from the same issue. Perhaps it's a problem with how Flash detects edges, because I've never once seen a workaround for this.

    Read the article

  • How can I send multiple types of objects across Protobuf?

    - by cyclotis04
    I'm implementing a client-server application, and am looking into various ways to serialize and transmit data. I began working with Xml Serializers, which worked rather well, but generate data slowly, and make large objects, especially when they need to be sent over the net. So I started looking into Protobuf, and protobuf-net. My problem lies in the fact that protobuf doesn't sent type information with it. With Xml Serializers, I was able to build a wrapper which would send and receive any various (serializable) object over the same stream, since object serialized into Xml contain the type name of the object. ObjectSocket socket = new ObjectSocket(); socket.AddTypeHandler(typeof(string)); // Tells the socket the types socket.AddTypeHandler(typeof(int)); // of objects we will want socket.AddTypeHandler(typeof(bool)); // to send and receive. socket.AddTypeHandler(typeof(Person)); // When it gets data, it looks for socket.AddTypeHandler(typeof(Address)); // these types in the Xml, then uses // the appropriate serializer. socket.Connect(_host, _port); socket.Send(new Person() { ... }); socket.Send(new Address() { ... }); ... Object o = socket.Read(); Type oType = o.GetType(); if (oType == typeof(Person)) HandlePerson(o as Person); else if (oType == typeof(Address)) HandleAddress(o as Address); ... I've considered a few solutions to this, including creating a master "state" type class, which is the only type of object sent over my socket. This moves away from the functionality I've worked out with Xml Serializers, though, so I'd like to avoid that direction. The second option would be to wrap protobuf objects in some type of wrapper, which defines the type of object. (This wrapper would also include information such as packet ID, and destination.) It seems silly to use protobuf-net to serialize an object, then stick that stream between Xml tags, but I've considered it. Is there an easy way to get this functionality out of protobuf or protobuf-net? I've come up with a third solution, and posted it below, but if you have a better one, please post it too!

    Read the article

  • How to get the top keys from a hash by value

    - by Kirs Kringle
    I have a hash that I sorted by values greatest to least. How would I go about getting the top 5? There was a post on here that talked about getting only one value. What is the easiest way to get a key with the highest value from a hash in Perl? I understand that so would lets say getting those values add them to an array and delete the element in the hash and then do the process again? Seems like there should be an easier way to do this then that though. My hash is called %words. use strict; use warnings; use Tk; #Learn to install here: http://factscruncher.blogspot.com/2012/01/easy-way-to-install-tk- on-strawberry.html #Reading in the text file my $file0 = Tk::MainWindow->new->Tk::getOpenFile; open( my $filehandle0, '<', $file0 ) || die "Could not open $file0\n"; my @words; while ( my $line = <$filehandle0> ) { chomp $line; my @word = split( /\s+/, lc($line)); push( @words, @word ); } for (@words) { s/[\,|\.|\!|\?|\:|\;|\"]//g; } #Counting words that repeat; put in hash my %words_count; $words_count{$_}++ for @words; #Reading in the stopwords file my $file1 = "stoplist.txt"; open( my $filehandle1, '<', $file1 ) or die "Could not open $file1\n"; my @stopwords; while ( my $line = <$filehandle1> ) { chomp $line; my @linearray = split( " ", $line ); push( @stopwords, @linearray ); } for my $w ( my @stopwords ) { s/\b\Q$w\E\B//ig; } #Comparing the array to Hash and deleteing stopwords my %words = %words_count; for my $stopwords ( @stopwords ) { delete $words{ $stopwords }; } #Sorting Hash Table my @keys = sort { $words{$b} <=> $words{$a} or "\L$a" cmp "\L$b" } keys %words; #Starting Statistical Work my $value_count = 0; my $key_count = 0; #Printing Hash Table $key_count = keys %words; foreach my $key (@keys) { $value_count = $words{$key} + $value_count; printf "%-20s %6d\n", $key, $words{$key}; } my $value_average = $value_count / $key_count; #my @topwords; #foreach my $key (@keys){ #if($words{$key} > $value_average){ # @topwords = keys %words; # } #} print "\n", "The number of values: ", $value_count, "\n"; print "The number of elements: ", $key_count, "\n"; print "The Average: ", $value_average, "\n\n";

    Read the article

  • How do I use data from the main window in a sub-window?

    - by eagle
    I've just started working on a photo viewer type desktop AIR app with Flex. From the main window I can launch sub-windows, but in these sub-windows I can't seem to access the data I collected in the main window. How can I access this data? Or, how can I send this data to the sub-window on creation? It doesn't need to be dynamically linked. myMain.mxml <?xml version="1.0" encoding="utf-8"?> <s:WindowedApplication xmlns:fx="http://ns.adobe.com/mxml/2009" xmlns:s="library://ns.adobe.com/flex/spark" xmlns:mx="library://ns.adobe.com/flex/mx" width="260" height="200" title="myMain"> <fx:Declarations> </fx:Declarations> <fx:Script> <![CDATA[ public function openWin():void { new myWindow().open(); } public var myData:Array = new Array('The Eiffel Tower','Paris','John Doe'); ]]> </fx:Script> <s:Button x="10" y="10" width="240" label="open a sub-window" click="openWin();"/> </s:WindowedApplication> myWindow.mxml <?xml version="1.0" encoding="utf-8"?> <mx:Window name="myWindow" title="myWindow" xmlns:mx="http://www.adobe.com/2006/mxml" layout="absolute" width="640" height="360"> <mx:Script> <![CDATA[ ]]> </mx:Script> <mx:Label id="comment" x="10" y="10" text=""/> <mx:Label id="location" x="10" y="30" text=""/> <mx:Label id="author" x="10" y="50" text=""/> </mx:Window> I realize this might be a very easy question but I have searched the web, read and watched tutorials on random AIR subjects for a few days and couldn't find it. The risk of looking like a fool is worth it now, I want to get on with my first app!

    Read the article

  • Getresponse not working after authentication

    - by Hazler
    For starters, here's my code: // Create a request using a URL that can receive a post. WebRequest request = WebRequest.Create("http://mydomain.com/cms/csharptest.php"); request.Credentials = new NetworkCredential("myUser", "myPass"); // Set the Method property of the request to POST. request.Method = "POST"; // Create POST data and convert it to a byte array. string postData = "name=PersonName&age=25"; byte[] byteArray = Encoding.UTF8.GetBytes(postData); // Set the ContentType property of the WebRequest. request.ContentType = "application/x-www-form-urlencoded"; // Set the ContentLength property of the WebRequest. request.ContentLength = byteArray.Length; // Get the request stream. Stream dataStream = request.GetRequestStream(); // Write the data to the request stream. dataStream.Write(byteArray, 0, byteArray.Length); // Close the Stream object. dataStream.Close(); // Get the response. HttpWebResponse response = (HttpWebResponse)request.GetResponse(); // Display the status. Console.WriteLine((response).StatusDescription); // Get the stream containing content returned by the server. dataStream = response.GetResponseStream(); // Open the stream using a StreamReader for easy access. StreamReader reader = new StreamReader(dataStream); // Read the content. string responseFromServer = reader.ReadToEnd(); // Display the content. Console.WriteLine(responseFromServer); // Clean up the streams. reader.Close(); dataStream.Close(); response.Close(); The directory cms/ requires authentication, but if I try running this same code somewhere, where authentication isn't needed, it works fine. The error (System.Net.WebException: The remote server returned an error: (403) Forbidden) occurs at HttpWebResponse response = (HttpWebResponse)request.GetResponse(); I have managed in reading data after authenticating, but not if I also send POST data. What's wrong with this?

    Read the article

  • Do You Really Know Your Programming Languages?

    - by Kristopher Johnson
    I am often amazed at how little some of my colleagues know or care about their craft. Something that constantly frustrates me is that people don't want to learn any more than they need to about the programming languages they use every day. Many programmers seem content to learn some pidgin sub-dialect, and stick with that. If they see a keyword or construct that they aren't familiar with, they'll complain that the code is "tricky." What would you think of a civil engineer who shied away from calculus because it had "all those tricky math symbols?" I'm not suggesting that we all need to become "language lawyers." But if you make your living as a programmer, and claim to be a competent user of language X, then I think at a minimum you should know the following: Do you know the keywords of the language and what they do? What are the valid syntactic forms? How are memory, files, and other operating system resources managed? Where is the official language specification and library reference for the language? The last one is the one that really gets me. Many programmers seem to have no idea that there is a "specification" or "standard" for any particular language. I still talk to people who think that Microsoft invented C++, and that if a program doesn't compile under VC6, it's not a valid C++ program. Programmers these days have it easy when it comes to obtaining specs. Newer languages like C#, Java, Python, Ruby, etc. all have their documentation available for free from the vendors' web sites. Older languages and platforms often have standards controlled by standards bodies that demand payment for specs, but even that shouldn't be a deterrent: the C++ standard is available from ISO for $30 (and why am I the only person I know who has a copy?). Programming is hard enough even when you do know the language. If you don't, I don't see how you have a chance. What do the rest of you think? Am I right, or should we all be content with the typical level of programming language expertise? Update: Several great comments here. Thanks. A couple of people hit on something that I didn't think about: What really irks me is not the lack of knowledge, but the lack of curiosity and willingness to learn. It seems some people don't have any time to hone their craft, but they have plenty of time to write lots of bad code. And I don't expect people to be able to recite a list of keywords or EBNF expressions, but I do expect that when they see some code, they should have some inkling of what it does. Few people have complete knowledge of every dark corner of their language or platform, but everyone should at least know enough that when they see something unfamiliar, they will know how to get whatever additional information they need to understand it.

    Read the article

  • Google Code + SVN or GitHub + Git

    - by Nazgulled
    Let me start by telling you that I never used anything besides SVN and I'm also a Windows user. I have a couple of simple projects that are open-source, others are on there way when I'm happy enough to release their source code but either way, I was thinking of using Google Code and SVN to share the source code of my projects instead of providing a link to the source on my website. This as always been a pain cause I had to update the binaries and the code every time I released a new version. This would also help me out to have a backup of my code some where instead of just my local machine (I used to have a local Subversion server running). What I want from a service like this is very simple... I just want a place to store my source code that people can download if they want, allows me to control revisions and provide a simple and easy issue system so people can submit bugs and stuff like that. I guess both of them have this. But I don't want to host any binaries in their websites, I want this to be hosted on my website so I can control download statistics with my own scripts, I also don't have the need for wiki pages as I prefer to have all the documentation in my own website. Does anyone of this services provide a way to "disable" features like wiki and downloads and don't show them at all for my project(s)? Now, I'm sure there are lots of pros and cons about using Google Code with SVN and GitHub with Git (of course) but here's what it's important for me on each one and why I like them: Google Code: As with any Google page, the complexity is almost non-existent Everyone (or almost) as a Google account and this is nice if people want to report problems using the issues system GitHub: May (or may not) be a little more complex (not a problem for me though) than Google's pages but... ...has a much prettier interface than Google's service It needs people to be registered on GitHub to post about issues I like the fact that with Git, you have your own revisions locally (can I use TortoiseGit for this or?) Basically that's it, not much I know... What other, most common, pros and cons can you tell me about each site/software? Keep in mind that my projects are simple, I'm probably the only one who will ever develop these projects on these repositories (or maybe not, for now I will)

    Read the article

  • drupal (CMS) or codeigniter (MVC) for creating a new web application?

    - by ajsie
    im going to create a new web application that is very customized. it will contain images, that are fully searchable - in a very, very customized way. when you click on the pictures you can add comments and so on. it requires users to be registered, but the registration/login process will be highly customized too. at the moment im using CodeIgniter for this. But i've read a lot of posts about CMS like Drupal and it sounds like i could let it handle basic stuff, maybe design and other front end work. i have no experience with CMS, in fact, i just started to use a MVC framework like CI and was impressed of how much easier it gets to start developing. so i wonder, if i'm going to create this kind of application, could i use drupal and then add the usual stuff, as i was going to do with CodeIgniter, like controllers, views, models, config files, my own libraries and so on? how does it work on a system like Drupal. how do you code PHP with it as with any MVC framework. it sounds like it has a lot of modules, i just wonder, if i can use it as a MVC framework but have the benefit of having all these basic stuff and design ready to use? cause then it sounds like the best "library" to provide for a web application from scratch. or is it difficult to create a customized app with it? i guess it has modules like images and users, but then how could i customize these so that every image has tags on it and country information, or have every user subscribing to changes to an image, that email will be sent to users and so on? cause i guess its easy to install a module. the question is, how do i customize it. maybe i don't need all that table columns. maybe i want to add/remove business logic. what are the pros and cons with using Drupal for this? is it even the right way to go? can you make a Stackoverflow with Drupal? Facebook? Twitter? Youtube? assuming that you know php of course. share your thoughts cause im totally new on creating a web application! thanks

    Read the article

  • passing pipe to threads

    - by alaamh
    I see it's easy to open pipe between two process using fork, but how we can passing open pipe to threads. Assume we need to pass out of PROGRAM A to PROGRAM B "may by more than one thread", PROGRAM B send his output to PROGRAM C #include <stdio.h> #include <stdlib.h> #include <pthread.h> struct targ_s { int fd_reader; }; void *thread1(void *arg) { struct targ_s *targ = (struct targ_s*) arg; int status, fd[2]; pid_t pid; pipe(fd); pid = fork(); if (pid == 0) { dup2(STDIN_FILENO, targ->fd_reader); close(fd[0]); dup2(fd[1], STDOUT_FILENO); close(fd[1]); execvp ("PROGRAM B", NULL); exit(1); } else { close(fd[1]); dup2(fd[0], STDIN_FILENO); close(fd[0]); execl("PROGRAM C", NULL); wait(&status); return NULL; } } int main(void) { FILE *fpipe; char *command = "PROGRAM A"; char buffer[1024]; if (!(fpipe = (FILE*) popen(command, "r"))) { perror("Problems with pipe"); exit(1); } char* outfile = "out.dat"; FILE* f = fopen (outfile, "wb"); int fd = fileno( f ); struct targ_s targ; targ.fd_reader = fd; pthread_t thid; if (pthread_create(&thid, NULL, thread1, &targ) != 0) { perror("pthread_create() error"); exit(1); } int len; while (read(fpipe, buffer, sizeof (buffer)) != 0) { len = strlen(buffer); write(fd, buffer, len); } pclose(fpipe); return (0); }

    Read the article

  • Delphi Unit local variables - how to make each instance unique?

    - by Justin
    Ok, this, I'm sure is something simple that is easy to do. The problem : I've inherited scary spaghetti code and am slowly trying to better it when new features need adding - generally when a refactor makes adding the new feature neater. I've got a bunch of code I'm packing into a single unit which, in different places in the application, controls the same physical thing in the outside world. The control appears in several places in the application and operates slightly differently in each instance. What I've done is to create a unit with all of the features I need which I can simply drop, as a frame, into each form that requires it. Each form then uses the unit's interface methods to customise the behaviour for each instance. The problem within the problem : In the unit in question (the frame) I have a variable declared in the IMPLEMENTATION section - local to the unit. I also have a procedure, declared in the TYPE section which takes an argument and assigns that argument to the local variable in question - each form passes a unique variable to each instance of the frame/unit. What I want it to do is for each instance of the frame to keep its own version of that variable, different from the others, and use that to define how it operates. What seems to be happening, however, is that all instances are using the same value, even if I explicitly pass each instance a different variable. ie: Unit FlexibleUnit; interface uses //the uses stuff type TFlexibleUnit=class(TFrame) //declarations including procedure makeThisInstanceX(passMeTheVar:integer); private // public // end; implementation uses //the uses var myLocalVar; procedure makeThisInstanceX(passMeTheVar:integer); begin myLocalVar:=passMeTheVar; end; //other procedures using myLocalVar //etc to the end; Now somewhere in another Form I've dropped this Frame onto the Design pane, sometimes two of these frames on one Form, and have it declared in the proper places, etc. Each is unique in that : ThisFlexibleUnit : TFlexibleUnit; ThatFlexibleUnit : TFlexibleUnit; and when I do a: ThisFlexibleUnit.makeThisInstanceX(var1); //want to behave in way "var1" ThatFlexibleUnit.makeThisInstanceX(var2); //want to behave in way "var2" it seems that they both share the same variable "myLocalVar". Am I doing this wrong, in principle? If this is the correct method then it's a matter of debugging what I have (which is too huge to post) but if this is not correct in principle then is there a way to do what I am suggesting? Thanks in advance, Stack Overflow - you guys (and gals!) are legendary.

    Read the article

  • How to use Mozilla ActiveX Control without registry

    - by Andrew McKinlay
    I've been using the IE Browser component that is part of Windows. But I'm running into problems with security settings. For example, users get security warnings on pages with Javascript. So I'm looking at using the Mozilla ActiveX control instead. It's especially nice because it has a compatible interface. It works well if I let it install the control in the registry. But my users don't always have administrator rights to install things in the registry. So I'm trying to figure out how to use the control without registry changes. I'm using DllGetClassObject to get the class factory (IID_ICLASSFACTORY) and then CoRegisterClassObject to register it. All the API calls appear to succeed. And when I create an AtlAxWin window with the CLSID, it also appears to work. But when I try to call Navigate on the AtlAxGetControl it doesn't work - the interface doesn't have Navigate. I would show the code but it's in an obscure language (Suneido) so it wouldn't mean much. An example in C or C++ would be easy for me to translate. Or an example in another dynamic language like Python or Ruby might be helpful. Obviously I'm doing something wrong. Maybe I'm passing the wrong thing to CoRegisterClassObject? The MSDN documentation isn't very clear on what to pass and I haven't found any good examples. Or if there is another approach, I'm ok with that too. Note: I'm using the AtlAxWin window class so I'm not directly creating the control and can't use this approach. Another option is registry free com with a manifest. But again, I couldn't find a good example, especially since I'm not using Visual Studio. I tried to use the MT manifest tool, but couldn't figure it out. I don't think I can use DLL redirection since that doesn't get around the registry issue AFAIK. Another possibility is using WebKit but it seems even harder to use.

    Read the article

  • Get UITableView to scroll to the selected UITextField and Avoid Being Hidden by Keyboard

    - by Lauren Quantrell
    I have a UITextField in a table view on a UIViewController (not a UITableViewController). If the table view is on a UITableViewController, the table will automatically scroll to the textField being edited to prevent it from being hidden by the keyboard. But on a UIViewController it does not. I have tried for a couple of days reading through multiple ways to try to accomplish this and I cannot get it to work. The closest thing that actually scrolls is: -(void) textFieldDidBeginEditing:(UITextField *)textField { // SUPPOSEDLY Scroll to the current text field CGRect textFieldRect = [textField frame]; [self.wordsTableView scrollRectToVisible:textFieldRect animated:YES]; } However this only scrolls the table to the topmost row. What seems like an easy task has been a couple of days of frustration. I am using the following to construct the tableView cells: - (UITableViewCell *)tableView:(UITableView *)aTableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { NSString *identifier = [NSString stringWithFormat: @"%d:%d", [indexPath indexAtPosition: 0], [indexPath indexAtPosition:1]]; UITableViewCell *cell = [aTableView dequeueReusableCellWithIdentifier:identifier]; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithStyle:UITableViewCellStyleDefault reuseIdentifier:identifier] autorelease]; cell.accessoryType = UITableViewCellAccessoryNone; UITextField *theTextField = [[UITextField alloc] initWithFrame:CGRectMake(180, 10, 130, 25)]; theTextField.adjustsFontSizeToFitWidth = YES; theTextField.textColor = [UIColor redColor]; theTextField.text = [textFieldArray objectAtIndex:indexPath.row]; theTextField.keyboardType = UIKeyboardTypeDefault; theTextField.returnKeyType = UIReturnKeyDone; theTextField.font = [UIFont boldSystemFontOfSize:14]; theTextField.backgroundColor = [UIColor whiteColor]; theTextField.autocorrectionType = UITextAutocorrectionTypeNo; theTextField.autocapitalizationType = UITextAutocapitalizationTypeNone; theTextField.clearsOnBeginEditing = NO; theTextField.textAlignment = UITextAlignmentLeft; //theTextField.tag = 0; theTextField.tag=indexPath.row; theTextField.delegate = self; theTextField.clearButtonMode = UITextFieldViewModeWhileEditing; [theTextField setEnabled: YES]; [cell addSubview:theTextField]; [theTextField release]; } return cell; } I suspect I can get the tableView to scroll properly if I can somehow pass the indexPath.row in the textFieldDidBeginEditing method? Any help is appreciated.

    Read the article

  • c++ class member functions instatiated by traits

    - by Jive Dadson
    I am reluctant to say I can't figure this out, but I can't figure this out. I've googled and searched stackoverflow, and come up empty. The abstract, and possibly overly vague form of the question is, how can I use the traits-pattern to instantiate non-virtual member functions? The question came up while modernizing a set of multivariate function optimizers that I wrote more than 10 years ago. The optimizers all operate by selecting a straight-line path through the parameter space away from the current best point (the "update"), then finding a better point on that line (the "line search"), then testing for the "done" condition, and if not done, iterating. There are different methods for doing the update, the line-search, and conceivably for the done test, and other things. Mix and match. Different update formulae require different state-variable data. For example, the LMQN update requires a vector, and the BFGS update requires a matrix. If evaluating gradients is cheap, the line-search should do so. If not, it should use function evaluations only. Some methods require more accurate line-searches than others. Those are just some examples. The original version instantiates several of the combinations by means of virtual functions. Some traits are selected by setting mode bits that are tested at runtime. Yuck. It would be trivial to define the traits with #define's and the member functions with #ifdef's and macros. But that's so twenty years ago. It bugs me that I cannot figure out a whiz-bang modern way. If there were only one trait that varied, I could use the curiously recurring template pattern. But I see no way to extend that to arbitrary combinations of traits. I tried doing it using boost::enable_if, etc.. The specialized state info was easy. I managed to get the functions done, but only by resorting to non-friend external functions that have the this-pointer as a parameter. I never even figured out how to make the functions friends, much less member functions. The compiler (vc++ 2008) always complained that things didn't match. I would yell, "SFINAE, you moron!" but the moron is probably me. Perhaps tag-dispatch is the key. I haven't gotten very deeply into that. Surely it's possible, right? If so, what is best practice?

    Read the article

  • WPF: Improving Performance for Running on Older PCs

    - by Phil Sandler
    So, I'm building a WPF app and did a test deployment today, and found that it performed pretty poorly. I was surprised, as we are really not doing much in the way of visual effects or animations. I deployed on two machines: the fastest and the slowest that will need to run the application (the slowest PC has an Intel Celeron 1.80GHz with 2GB RAM). The application ran pretty well on the faster machine, but was choppy on the slower machine. And when I say "choppy", I mean the cursor jumped even just passing it over any open window of the app that had focus. I opened the Task Manager Performance window, and could see that the CPU usage jumped whenever the app had focus and the cursor was moving over it. If I gave focus to another (e.g. Excel), the CPU usage went back down after a second. This happened on both machines, but the choppiness was only noticeable on the slower machine. I had very limited time to tinker on the deployment machines, so didn't do a lot of detailed testing. The app runs fine on my development machine, but I also see the CPU spiking up to 10% there, just running the cursor over the window. I downloaded the WPF performance tool from MS and have been tinkering with it (on my dev machine). The docs say this about the "Frame Rate" metric in the Perforator tool: For applications without animation, this value should be near 0. The app is not doing any heavy animation, but the frame rate stays near 50 when the cursor is over any window. The screens I tested on have column headers in a grid that "highlight" and buttons that change color and appearance when scrolled over. Even moving the mouse on blank areas of the windows cause the same Frame rate and CPU usage (doesn't seem to be related to these minor animations). (Also, I am unable to figure out how to get anything but the two default tools--Perforator and Visual Profiler--installed into the WPF performance tool. That is probably a separate question). I also have Redgate's profiling tool, but I'm not sure if that can shed any light on rendering performance. So, I realize this is not an easy thing to troubleshoot without specifics or sample code (which I can't post). My questions are: What are some general things to look for (or avoid) in the code to improve performance? What steps can I take using the WPF performance tool to narrow down the problem? Is the PC spec listed above (Intel Celeron 1.80GHz with 2GB RAM) too slow to be running even vanilla WPF applications?

    Read the article

  • how to remove empty tags in input xml

    - by SGB
    My java module gets a huge input xml from a mainframe. Unfortunately, the mainframe is unable to skip optional elements when it is not a leaf node, with the result that I get a LOT of empty tags in my input : So, <pre><code><SSN>111111111</SSN> <Employment> <Current> <Address> <line1/> <line2/> <line3/> <city/> <state/> <country/> </Address> <Phone> <phonenumber/> <countryCode/> </Phone> </Current> <Previous> <Address> <line1/> <line2/> <line3/> <city/> <state/> <country/> </Address> <Phone> <phonenumber/> <countryCode/> </Phone> </Previous> </Employment> <MaritalStatus>Single</MaritalStatus> </code></pre> should be <SSN>111111111</SSN> <MaritalStatus>Single</MaritalStatus> I use jaxb to unmarshall the input xml string that the mainframe sends it. Is there a clean/ easy way to remove all the empty group tags, or do I have to do this manuall in the code for each element. I have over 35 elements in my input xml, so I would love to it if jaxb itself had a way of doing this automatically? Thanks, SGB

    Read the article

  • What makes great software?

    - by VirtuosiMedia
    From the perspective of an end user, what makes a software great rather than just good or functional? What are some fundamental principles that can shift the way a software is used and perceived? What are some of the little finishing touches that help put an application over the top? I'm in the later stages of developing a web app and I'm looking for ideas or concepts that I may have missed. If you have specific examples of software or apps that you absolutely love, please share the reasons or features that make it special. Keep in mind that I'm looking for examples that directly affect the end user, but not necessarily just UI suggestions. Here are some of the principles and little touches I'm trying to use: Keep the UI as simple as possible. Remove absolutely everything that isn't necessary. Use progressive disclosure when more information can be needed sometimes but isn't needed all the time. Provide inline help and useful error messages. Verbs on buttons wherever possible. Make anything that's clickable obvious. Fast, responsive UI. Accessibility (this is a work in progress). Reusable UI patterns. Once a user learns a skill, they will be able to use it in multiple places. Intelligent default settings. Auto-focusing forms when filling out the form is the primary action to be taken on the page. Clear metaphors (like tabs) and headings indicating location within the app. Automating repetitive tasks (with the ability to disable the automation). Use standardized or accepted metaphors for icons (like an "x" for delete). Larger text sizes for improved readability. High contrast so that each section is distinct. Making sure that it's obvious on every page what the user is supposed to do by establishing a clear information hierarchy and drawing the eye to the call to action. Most deletions can be undone. Discoverability - Make it easy to learn how to do new tasks. Group similar elements together.

    Read the article

  • Creating multiple heads in remote repository

    - by Jab
    We are looking to move our team (~10 developers) from SVN to mercurial. We are trying to figure out how to manage our workflow. In particular, we are trying to see if creating remote heads is the right solution. We currently have a very large repository with multiple, related projects. They share a lot of code, but pieces of the project are deployed by different teams (3 teams) independent of other portions of the code-base. So each team is working on concurrent large features. The way we currently handles this in SVN are branches. Team1 has a branch for Feature1, same deal for the other teams. When Team1 finishes their change, it gets merged into the trunk and deployed out. The other teams follow suite when their project is complete, merging of course. So my initial thought are using Named Branches for these situations. Team1 makes a Feature1 branch off of the default branch in Hg. Now, here is the question. Should the team PUSH that branch, in it's current/half-state to the repository. This will create a second head in the core repo. My initial reaction was "NO!" as it seems like a bad idea. Handling multiple heads on our repository just sounds awful, but there are some advantages... First, the teams want to setup Continuous Integration to build this branch during their development cycle(months long). This will only work if the CI can pull this branch from the repo. This is something we do now with SVN, copy a CI build and change the branch. Easy. Second, it makes it easier for any team member to jump onto the branch and start working. Without pushing to the core repo, they would have to receive a push from a developer on that team with the changeset information. It is also possible to lose local commits to hardware failure. The chances increase a lot if it's a branch by a single developer who has followed the "don't push until finished" approach. And lastly is just for ease of use. The developers can easily just commit and push on their branch at any time without consequence(as they do today, in their SVN branches). Is there a better way to handle this scenario that I may be missing? I just want a veteran's opinion before moving forward with the strategy. For bug fixes we like the general workflow of mecurial, anonymous branches that only consist of 1-2 commits. The simplicity is great for those cases. By the way, I've read this , great article which seems to favor Named branches.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • What database table structure should I use for versions, codebases, deployables?

    - by Zac Thompson
    I'm having doubts about my table structure, and I wonder if there is a better approach. I've got a little database for version control repositories (e.g. SVN), the packages (e.g. Linux RPMs) built therefrom, and the versions (e.g. 1.2.3-4) thereof. A given repository might produce no packages, or several, but if there are more than one for a given repository then a particular version for that repository will indicate a single "tag" of the codebase. A particular version "string" might be used to tag a version of the source code in more than one repository, but there may be no relationship between "1.0" for two different repos. So if packages P and Q both come from repo R, then P 1.0 and Q 1.0 are both built from the 1.0 tag of repo R. But if package X comes from repo Y, then X 1.0 has no relationship to P 1.0. In my (simplified) model, I have the following tables (the x_id columns are auto-incrementing surrogate keys; you can pretend I'm using a different primary key if you wish, it's not really important): repository - repository_id - repository_name (unique) ... version - version_id - version_string (unique for a particular repository) - repository_id ... package - package_id - package_name (unique) - repository_id ... This makes it easy for me to see, for example, what are valid versions of a given package: I can join with the version table using the repository_id. However, suppose I would like to add some information to this database, e.g., to indicate which package versions have been approved for release. I certainly need a new table: package_version - version_id - package_id - package_version_released ... Again, the nature of the keys that I use are not really important to my problem, and you can imagine that the data column is "promotion_level" or something if that helps. My doubts arise when I realize that there's really a very close relationship between the version_id and the package_id in my new table ... they must share the same repository_id. Only a small subset of package/version combinations are valid. So I should have some kind of constraint on those columns, enforcing that ... ... I don't know, it just feels off, somehow. Like I'm including somehow more information than I really need? I don't know how to explain my hesitance here. I can't figure out which (if any) normal form I'm violating, but I also can't find an example of a schema with this sort of structure ... not being a DBA by profession I'm not sure where to look. So I'm asking: am I just being overly sensitive?

    Read the article

  • What is the best practice to segment c#.net projects based on a single base project

    - by Anthony
    Honestly, I can't word my question any better without describing it. I have a base project (with all its glory, dlls, resources etc) which is a CMS. I need to use this project as a base for othe custom bake projects. This base project is to be maintained and updated among all custom bake projects. I use subversion (Collabnet and Tortise SVN) I have two questions: 1 - Can I use subversion to share the base project among other projects What I mean here is can I "Checkout" the base project into another "Checked Out" project and have both update and commit seperatley. So, to paint a picture, let's say I am working on a custom project and I modify the core/base prject in some way (which I know will suit the others) can I then commit those changes and upon doing so when I update the base project in the other "Checked out" resources will it pull the changes? In short, I would like not to have to manually deploy updated core files whenever I make changes into each seperate project. 2 - If I create a custom file (let's say an webcontrol or aspx page etc) can I have it compile seperatley from the base project Another tricky one to explain. When I publish my web application it creates DLLs based on the namespaces of projects attached to it. So I may have a number of DLLs including the "Website's" namespace DLL, which could simply be website. I want to be able to make a seperate, custom, control which does not compile into those DLLs as the custom files should not rely on those DLLS to run. Is it as simple to set a seperate namespace for those files like CustomFiles.ProjectName for example? Think of the whole idea as adding modules to the .NET project, I don't want the module's code in any of the core DLLs but I do need for module to be able to access the core dlls. (There is no need for the core project to access the module code as it should be one way only in theory, though I reckon it woould not be possible anyway without using JSON/SOAP or something like that, maybe I am wrong.) I want to create a pluggable environment much like that of Joomla/Wordpress as since PHP generally doesn't have to be compiled first I see this is the reason why all this is possible/easy. The idea is to allow pluggable themes, modules etc etc. (I haven't tried simply adding .NET themes after compile/publish but I am assuming this is possible anyway? OR does the compiler need to reference items in the files?)

    Read the article

< Previous Page | 513 514 515 516 517 518 519 520 521 522 523 524  | Next Page >