Search Results

Search found 1507 results on 61 pages for 'spaces'.

Page 52/61 | < Previous Page | 48 49 50 51 52 53 54 55 56 57 58 59  | Next Page >

  • How do I tweak columns in a Flat File Destination in SSIS?

    - by theog
    I have an OLE DB Data source and a Flat File Destination in the Data Flow of my SSIS Project. The goal is simply to pump data into a text file, and it does that. Where I'm having problems is with the formatting. I need to be able to rtrim() a couple of columns to remove trailing spaces, and I have a couple more that need their leading zeros preserved. The current process is losing all the leading zeros. The rtrim() can be done by simple truncation and ignoring the truncation errors, but that's very inelegant and error prone. I'd like to find a better way, like actually doing the rtrim() function where needed. Exploring similar SSIS questions & answers on SO, the thing to do seems to be "Use a Script Task", but that's ususally just thrown out there with no details, and it's not at all an intuitive thing to set up. I don't see how to use scripting to do what I need. Do I use a Script Task on the Control Flow, or a Script Component in the Data Flow? Can I do rtrim() and pad strings where needed in a script? Anybody got an example of doing this or similar things? Many thanks in advance.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Combine Search Bar and URL Bar into One (WebView)

    - by Jay Bush
    So I'm in the midst of updating my Web Browser app for iOS devices, from the ground up, and I'm trying to implement some more convenient features. One feature that seems to be really popular now, that I have been getting a lot of requests for, is the combination of a Google Search bar and a URL bar in one, like that of the Chrome application. Below is a screenshot of the Google Chrome app, and as you can see, they've made it so you can either enter in a search query like "apple ipad" and it will return a Google search page of 'Apple iPad', or you can enter in a URL "http://apple.com/ipad/" and it will load that URL. I have looked all over the internet, but all I could find were tutorials on how to Search Google with value of the UITextField. I have a feeling that the best way to do this is to probably make a 'check'. Like if the entered value contains 'http://' 'www.' '.com' or no spaces, then load it as a URL, if not then load it in a Google Search page, and then have the webview load up the Google Search page. If anybody could show me to the right direction, that would be great, or even supplying me with some code would be even greater. :) Thanks! If anyone needs part of the code, just ask.

    Read the article

  • using ini file in vb6, problem with path to file

    - by DrPut
    I have read many articles about how to use an INI file within my VB6 project. I don't have a problem with the methods, my problem is how to make the EXE file find the INI file. I don't want to hard code the path in the program. I simply want the EXE to expect the INI file to be present in the same folder the EXE is executed from. When I run the program from inside VB6 IDE, the INI is found and processed. When I compile the program and run the EXE, nothing is found. My code looks like: gServer = sGetINI(sINIFile, "TOOLBOM", "ServerName", "?") where TOOLBOM is the [Section] and "ServerName" is the key for the value. I obtained the following code for the API: Rem API DECLARATIONS Declare Function GetPrivateProfileString Lib "kernel32" Alias _ "GetPrivateProfileStringA" (ByVal lpApplicationName _ As String, ByVal lpKeyName As Any, ByVal lpDefault _ As String, ByVal lpReturnedString As String, ByVal _ nSize As Long, ByVal lpFileName As String) As Long Declare Function WritePrivateProfileString Lib "kernel32" Alias _ "WritePrivateProfileStringA" (ByVal lpApplicationName _ As String, ByVal lpKeyName As Any, ByVal lpString As Any, _ ByVal lpFileName As String) As Long Public Function sGetINI(sINIFile As String, sSection As String, sKey _ As String, sDefault As String) As String Dim sTemp As String * 256 Dim nLength As Integer sTemp = Space$(256) nLength = GetPrivateProfileString(sSection, sKey, sDefault, sTemp, _ 255, sINIFile) sGetINI = Left$(sTemp, nLength) End Function Public Sub writeINI(sINIFile As String, sSection As String, sKey _ As String, sValue As String) Dim n As Integer Dim sTemp As String sTemp = sValue Rem Replace any CR/LF characters with spaces For n = 1 To Len(sValue) If Mid$(sValue, n, 1) = vbCr Or Mid$(sValue, n, 1) = vbLf _ Then Mid$(sValue, n) = " " Next n n = WritePrivateProfileString(sSection, sKey, sTemp, sINIFile) End Sub

    Read the article

  • How do I get rid of the space between <img> elements in a row in a html page?

    - by Aperture
    I'm displaying 3 <img> in a row like this: <div style="width: 950px"> <img src='/UploadedImages/86.jpg' alt='' style="width: 300px; margin: 0px; padding: 0px; border: 1px solid Black" /> <img src='/UploadedImages/85.jpg' alt='' style="width: 300px; margin: 0px; padding: 0px; border: 1px solid Black" /> <img src='/UploadedImages/84.gif' alt='' style="width: 300px; margin: 0px; padding: 0px; border: 1px solid Black" /> </div> As you can see I have thin black borders around the images. My problem is that there are white spaces about 5px wide between the borders of neighbouring images and I have set the margin to be 0px but it does not work. So what is happening here?

    Read the article

  • A feeling that I'm not that good developer

    - by Karim
    Hi, Im having a strange feeling, but let me first introduce myself as a software developer. I started to program when I was still a kid, I had about 10 or 11 years. I really enjoy my work and never get bored from it. It's amazing how somebody could be paid for what he really likes to do and would be doing it anyway even for free. WHen I first started to program, I was feeling proud of what I was doing, each application I built was for me a success and after 2-3 year I had a feeling that I'm a coding guru. It was a nice feeling ;-) But the more I was in the field, the more types of software I started to develop I was starting to have a feeling that I'm completely wrong in that I'm guru. I felt that I'm not even a mediocre developer. Each new field I start to work on is giving me this feeling. Like when I once developed a device driver for a client, I saw how much I need to learn about device drivers. When I developed a video filter for an application, I saw how much do I still need to learn about DirectShow, Color Spaces, and all the theory behind that. The worst thing was when I started to learn algorithms. It was several years ago. I knew then the basic structures and algorithms like the sorting, some types of trees, some hashtables, strings etc.. and when I really wanted to learn a group of structures I learned about 5-6 new types and saw that in fact even this small group has several hundred subtypes of structures. It's depressing how little time people have in their lives to learn all this stuff. I'm now a software developer with about 10 years of experience and I still feel that I'm not a proficient developer when I think about things that others do in the industry. Is this normal what I'm experiencing or is it a sign of a destructive excessive ambition? Thanks in advance for any comments.

    Read the article

  • How to check for a null object reference when validating forms in MVC

    - by quakkels
    Hello SO, I'm experimenting with validating forms in the asp.net MVC framework. I'm focusing on server side validation for the time being. I've come across an error that I'm not sure how to rectify. System.NullReferenceException: Object reference not set to an instance of an object. The code that throws the error is: [AcceptVerbs(HttpVerbs.Post)] public ActionResult Create([Bind(Exclude="ID")] MembersCreate mc ) { mc.Modules = ModuleListDataContext.GetModuleList(); ViewData.Model = mc; //Validation using ModelState // // //line below errors when form field is empty // if ((string)mc.Member.Username.Trim() == "") ModelState.AddModelError("Member.Username", "Username is required."); if (!ModelState.IsValid) return View(); try { // TODO: Add insert logic here return RedirectToAction("Index","Home"); } catch { return View(); } } When I put spaces in the field it performs exactly as i want, but if I leave the field blank and press submit I get the error. What's the best way to avoid this error and still validate blank form fields? Thanks all -

    Read the article

  • Pull specific information from a long list with Perl

    - by melignus
    The file that I've got to work with here is the result of an LDAP extraction but I need to ultimately get the information formatted over to something that a spreadsheet can use. So, the data is as follows: DataDataDataDataDataDataDataDataDataDataDataDataDataDataDataData DataDataDataDataDataDataDataDataDataDataDataDataDataDataDataData displayName: John Doe name: ##userName DataDataDataDataDataDataDataDataDataDataDataDataDataDataDataData DataDataDataDataDataDataDataDataDataDataDataDataDataDataDataData displayName: Jane Doe name: ##userName DataDataDataDataDataDataDataDataDataDataDataDataDataDataDataData DataDataDataDataDataDataDataDataDataDataDataDataDataDataDataData displayName: Ted Doe name: ##userName The format that I need to export to is: firstName lastName userName firstName lastName userName firstName lastName userName Where the spaces are tabs so I can then impor that file into a database. I have experience doing this in VBScript but I'm trying to switch over to using Perl for as much server administration as possible. I'm not sure on the syntax for what I want which is basically while not endoffile{ detect "displayName: " & $firstName & " " & $lastName detect "name: ##" & $userName write $firstName tab $lastName tab $userName to file } Also if someone could point me to a resource specifically on the text parsing syntax that Perl uses, I'd be very grateful. Most of the resources that I've come across haven't been very helpful.

    Read the article

  • C when to allocate and free memory - before function call, after function call...etc

    - by Keith P
    I am working with my first straight C project, and it has been a while since I worked on C++ for that matter. So the whole memory management is a bit fuzzy. I have a function that I created that will validate some input. In the simple sample below, it just ignores spaces: int validate_input(const char *input_line, char* out_value){ int ret_val = 0; /*false*/ int length = strlen(input_line); cout << "length = " << length << "\n"; out_value =(char*) malloc(sizeof(char) * length + 1); if (0 != length){ int number_found = 0; for (int x = 0; x < length; x++){ if (input_line[x] != ' '){ /*ignore space*/ /*get the character*/ out_value[number_found] = input_line[x]; number_found++; /*increment counter*/ } } out_value[number_found + 1] = '\0'; ret_val = 1; } return ret_val; } Instead of allocating memory inside the function for out_value, should I do it before I call the function and always expect the caller to allocate memory before passing into the function? As a rule of thumb, should any memory allocated inside of a function be always freed before the function returns?

    Read the article

  • Return lines in input code causing gaps/whitespace between elements in output?

    - by Jenny Zhang
    I am trying to put images next to each other on a webpage. Here is my HTML: <img class="pt" src="Yellow Tulip.jpg" title="Yellow Tulip" alt="Yellow Tulip" /> <img class="pt" src="Pink Tulip.jpg" title="Pink Tulip" alt="Pink Tulip" /> <img class="pt" src="Purple Tulip.jpg" title="Purple Tulip" alt="Purple Tulip" /> However, on my webpage, this shows a gap between each image. I've noticed that once I remove the return line that makes the elements separate and readable and instead just put all the elements on one line, the gaps go away. <img class="pt" src="Yellow Tulip.jpg" title="Yellow Tulip" alt="Yellow Tulip" /><img class="pt" src="Pink Tulip.jpg" title="Pink Tulip" alt="Pink Tulip" /><img class="pt" src="Purple Tulip.jpg" title="Purple Tulip" alt="Purple Tulip" /> Is there anyway I can achieve the output of the latter but still have the code/input look like the former? I really like the readability that the return lines (enter spaces) bring to the code, but I don't want the whitespace it creates on the actual page. If someone could explain why this is and/or how to fix it, I'd be really grateful! :)

    Read the article

  • Python/Django Concatenate a string depending on whether that string exists

    - by Douglas Meehan
    I'm creating a property on a Django model called "address". I want address to consist of the concatenation of a number of fields I have on my model. The problem is that not all instances of this model will have values for all of these fields. So, I want to concatenate only those fields that have values. What is the best/most Pythonic way to do this? Here are the relevant fields from the model: house = models.IntegerField('House Number', null=True, blank=True) suf = models.CharField('House Number Suffix', max_length=1, null=True, blank=True) unit = models.CharField('Address Unit', max_length=7, null=True, blank=True) stex = models.IntegerField('Address Extention', null=True, blank=True) stdir = models.CharField('Street Direction', max_length=254, null=True, blank=True) stnam = models.CharField('Street Name', max_length=30, null=True, blank=True) stdes = models.CharField('Street Designation', max_length=3, null=True, blank=True) stdessuf = models.CharField('Street Designation Suffix',max_length=1, null=True, blank=True) I could just do something like this: def _get_address(self): return "%s %s %s %s %s %s %s %s" % (self.house, self.suf, self.unit, self.stex, self.stdir, self.stname, self.stdes, self.stdessuf) but then there would be extra blank spaces in the result. I could do a series of if statements and concatenate within each, but that seems ugly. What's the best way to handle this situation? Thanks.

    Read the article

  • cmd.exe Command Line Parsing of Environment Variables

    - by Artefacto
    I can't figure how to have cmd.exe not interpret something like %PATH% as an environment variable. Given this program: #include<stdio.h> #include<windows.h> int main(int argc, char *argv[]) { int i; printf("cmd line: %s\n", GetCommandLine()); for (i = 0; i < argc; i++) { printf("%d: %s\n", i, argv[i]); } return 0; } I have these different outputs according to the position of the arguments: >args "k\" o" "^%PATH^%" cmd line: args "k\" o" "%PATH%" 0: args 1: k" o 2: %PATH% >args "^%PATH^%" "k\" o" cmd line: args "^%PATH^%" "k\" o" 0: args 1: ^%PATH^% 2: k" o I guess it's because cmd.exe doesn't recognize the escaped \" and sees the escaped double quote as closing the first, leaving in the first case %PATH% unquoted. I say this, because if I don't quote the argument, it always works: >args ^%PATH^% "k\" o" cmd line: args %PATH% "k\" o" 0: args 1: %PATH% 2: k" o but then I can have no spaces...

    Read the article

  • How to change this C++ code to make input work better

    - by Phenom
    cout << "Input street number: "; cin >> streetnum; cout << "Input street name: "; cin >> streetname; cout << "Input resource name: "; cin >> rName; cout << "Input architectural style: "; cin >> aStyle; cout << "Input year built: "; cin >> year; The problem with the above code happens if you enter in spaces between words. For example if I enter "Ampitheater Parkway" for streetname, then it puts "Ampitheater" in streetname, skips the prompt for resource name and enters "Parkway" into the next field. How can I fix this?

    Read the article

  • CSS to specify positions over a scanned document

    - by itsols
    I'm trying to write the CSS rules to position text over a scanned document. Reason: The document is a pre-printed form. I am trying to position the text on-screen so that it relates to the 'spaces' on the actual form. Issue: Although I position the values using centimeters, they don't seem to get aligned with the ones on the actual page. I can see this misalignment since my scanned image is in the background of the page. What I've tried: I used a ruler to physically measure the locations and specify them with CSS. But on-screen, it doesn't tally. I used the scanned image to position the CSS values. Then the printout is not correct. I even scaled the scanned page using Inkscape to the exact dimensions in centimeters and took into account all margins, etc... What I need: I am trying to correctly show the output values on-screen AND have them print in the correct manner as well. I know that using two CSS sheets (one for print) is an option. But I'm developing this program away from where the actual printing is to be done. So is there a convenient way of matching the exact screen locations with those on the actual/final prinout? Thanks!

    Read the article

  • JavaScript Regex: Complicated input validation

    - by ScottSEA
    I'm trying to construct a regex to screen valid part and/or serial numbers in combination, with ranges. A valid part number is a two alpha, three digit pattern or /[A-z]{2}\d{3}/ i.e. aa123 or ZZ443 etc... A valid serial number is a five digit pattern, or /\d{5}/ 13245 or 31234 and so on. That part isn't the problem. I want combinations and ranges to be valid as well: 12345, ab123,ab234-ab245, 12346 - 12349 - the ultimate goal. Ranges and/or series of part and/or serial numbers in any combination. Note that spaces are optional when specifying a range or after a comma in a series. Note that a range of part numbers has the same two letter combination on both sides of the range (i.e. ab123 - ab239) I have been wrestling with this expression for two days now, and haven't come up with anything better than this: /^(?:[A-z]{2}\d{3}[, ]*)|(?:\d{5}[, ]*)|(?:([A-z]{2})\d{3} ?- ?\4\d{3}[, ]*)|(?:\d{5} ?- ?\d{5}[, ]*)$/ ... My Regex-Fu is weak.

    Read the article

  • Resize iframe to show first element works except in IE 7

    - by Rob Fenwick
    I have two iframes on my home page, the script below is in the head of the page that is being displayed in the iframe, there are several divisions on the page in a container div with an id of 'content', I want to size the iframe on the home page so that just the first div is initially seen and to scroll to see the rest. It is working in all browsers that I have tried except IE 7, I don't care too much about earlier browsers. IE 7 is acting like the page being shown is blank and sizing the iframe to 0 height, can someone tell me why IE 7 is having a problem with it, and failing that how can I get IE 7 to ignore the script? function resizeIframe() { //get the firstChild of a container div with the id 'content' var div01 = document.getElementById("content").firstChild; //find the first element ignoring white spaces and returns while(div01.nodeType!=1){ div01 = div01.nextSibling; } // get the height of first element var boxHeight = div01.clientHeight; //set the height of iframe the id of the iframe is 'news' parent.document.getElementById('news').height = boxHeight; } I have the function called in the body tag. If someone could help me I'd very much appreciate it. The page that it is on is at wsuu.org The version with the script is not up but you can get an idea of what I'm trying to do. Rob

    Read the article

  • JSTL <c:out> where the element name contains a space character...

    - by Shane
    I have an array of values being made available, but unfortunately some of the variable names include a space. I cannot work out how to simply output these in the page. I know I'm not explaining this well (I'm the JSP designer, not the Java coder) so hopefully this example will illustrate what I'm trying to do: <c:out value="${x}"/> outputs to the page (artificially wrapped) as: {width=96.0, orderedheight=160.0, instructions=TEST ONLY. This is a test., productId=10132, publication type=ns, name=John} I can output the name by using <c:out value="${x.name}"/> no problems. The issue is when I try to get the "publication type"... because it has a space, I can't seem to get <c:out> to display it. I have tried: <!-- error parsing custom action attribute: --> <c:out value="${x.publication type}"/> <!-- error occurred while evaluating custom action attribute: --> <c:out value="${x.publication+type}"/> <!-- error occurred while parsing custom action attribute: --> <c:out value="${x.'publication type'}"/> <!-- error occurred while parsing custom action attribute: --> <c:out value="${x.publication%20type}"/> I know the real solution is to get the variable names formatted correctly (ie: without spaces) but I can't get the code updated for quite a while. Can this be done? Any help greatly appreciated.

    Read the article

  • Problem in DataBinding an Enum using dictionary approach to a combobox in WPF.

    - by Ashish Ashu
    I have a Dictionary which is binded to a combobox. I have used dictionary to provide spaces in enum. public enum Option {Enter_Value, Select_Value}; Dictionary<Option,string> Options; <ComboBox x:Name="optionComboBox" SelectionChanged="optionComboBox_SelectionChanged" SelectedValuePath="Key" DisplayMemberPath="Value" SelectedItem="{Binding Path = SelectedOption}" ItemsSource="{Binding Path = Options}" /> This works fine. My queries: 1. I am not able to set the initial value to a combo box. In above XAML snippet the line SelectedItem="{Binding Path = SelectedOption}" is not working. I have declared SelectOption in my viewmodel. This is of type string and I have intialized this string value in my view model as below: SelectedOption = Options[Options.Enter_Value].ToString(); 2. The combobox is binded to datadictionary which have two options first is "Enter_value" and second is "Select_value" which is actually Option enum. Based on the Option enum value I want to perform different action. For example if option is equal to option.Enter_value then Combo box becomes editable and user can enter the numeric value in it. if option is equal to option.Select_value value then the value comes from the database and the combo box becomes read only and shows the fetched value from the database. Please Help!!

    Read the article

  • MS SQL find and replace in TEXT field

    - by incubushead
    I have a database in MS SQL 2005 that was brought up from SQL 2000 and is still using TEXT type fields instead of varchar(max). I need to find and replace a string of characters in the text field but all of the examples of how to do this that I have found don't seem like they would work for me. It seems the UPDATETEXT command requires that the two parameters "insert_offset" and "delete_length" be set explicitly but the string i am searching for could show up in the text at any point or even at several points in the same cell. My understanding of these two parameters is that the string im searching for will always be in the same place, so that insert_offset is the number of spaces into the text that the UPDATETEXT command will start replacing text. Example: Need to find: &lt;u&gt; and Replace it with: <u> Text field example: *Everyone in the room was <b>&lt;u&gt;tired&lt;/u&gt;.</b><br>Then they woke <b>&lt;u&gt;up&lt;/u&gt;. Can anyone help me out with this? THANKS!

    Read the article

  • Why is my Scala function returning type Unit and not whatever is the last line?

    - by Andy
    I am trying to figure out the issue, and tried different styles that I have read on Scala, but none of them work. My code is: .... val str = "(and x y)"; def stringParse ( exp: String, pos: Int, expreshHolder: ArrayBuffer[String], follow: Int ) var b = pos; //position of where in the expression String I am currently in val temp = expreshHolder; //holder of expressions without parens var arrayCounter = follow; //just counts to make sure an empty spot in the array is there to put in the strings if(exp(b) == '(') { b = b + 1; while(exp(b) == ' '){b = b + 1} //point of this is to just skip any spaces between paren and start of expression type if(exp(b) == 'a') { temp(arrayCounter) = exp(b).toString; b = b+1; temp(arrayCounter)+exp(b).toString; b = b+1; temp(arrayCounter) + exp(b).toString; arrayCounter+=1} temp; } } val hold: ArrayBuffer[String] = stringParse(str, 0, new ArrayBuffer[String], 0); for(test <- hold) println(test); My error is: Driver.scala:35: error: type mismatch; found : Unit required: scala.collection.mutable.ArrayBuffer[String] ho = stringParse(str, 0, ho, 0); ^one error found When I add an equals sign after the arguments in the method declaration, like so: def stringParse ( exp: String, pos: Int, expreshHolder: ArrayBuffer[String], follow: Int ) ={....} It changes it to "Any". I am confused on how this works. Any ideas? Much appreciated.

    Read the article

  • Algorithm complexity question

    - by Itsik
    During a recent job interview, I was asked to give a solution to the following problem: Given a string s (without spaces) and a dictionary, return the words in the dictionary that compose the string. For example, s= peachpie, dic= {peach, pie}, result={peach, pie}. I will ask the the decision variation of this problem: if s can be composed of words in the dictionary return yes, otherwise return no. My solution to this was in backtracking (written in Java) public static boolean words(String s, Set<String> dictionary) { if ("".equals(s)) return true; for (int i=0; i <= s.length(); i++) { String pre = prefix(s,i); // returns s[0..i-1] String suf = suffix(s,i); // returns s[i..s.len] if (dictionary.contains(pre) && words(suf, dictionary)) return true; } return false; } public static void main(String[] args) { Set<String> dic = new HashSet<String>(); dic.add("peach"); dic.add("pie"); dic.add("1"); System.out.println(words("peachpie1", dic)); // true System.out.println(words("peachpie2", dic)); // false } What is the time complexity of this solution? I'm calling recursively in the for loop, but only for the prefix's that are in the dictionary. Any idea's?

    Read the article

  • drupal themes: how do I include several css files / js files on my theme's .info file?

    - by egarcia
    I'm creating a new Drupal theme. Until now, I only needed to include a single css file and a single js file. So my theme.info file had something like this: stylesheets[all][] = css/style.css scripts[] = js/script.js Now I must include jquery and jquery-ui in order to use a calendar date. These come with 2 new javascript files, and 1 additonal css file that I must add to the site. The calendar input form is going to be used in all pages (on a side block) so it is ok for me to load the extra css/javascript on all pages. I think the easiest thing would be to reference them on the .info file itself. At first I tried to just put them there with separate spaces: stylesheets[all][] = css/style.css css/ui-lightness/jquery-ui-1.8.1.custom.css scripts[] = js/script.js js/jquery-1.4.2.min.js js/jquery-ui-1.8.1.custom.min.js I emptied drupal's cache and... none of them loaded. I then tried separating each file with a comma, and flushing the cache again. Same result. I've browsed some drupal pages, but could not find how to add several javascript/css files on one theme (they always seem to add just 1 of each). So, how do I include several css/javascript files on the .info file?

    Read the article

  • StreamReader returning another char

    - by Fernando
    I'm trying to read the content of a file with a StreamReader, that receives a FileStream. The file has some spaces inside (char 32) and the StreamReader is reading them as 0 (char 48). The screenshot shows the FileStream buffer and the StreamReader buffer. Both have the value 32, but when I call Read(), it returns 48. Am I missing something here? By the way, the code is running under .NET Compact Framework. The code that reads the data: public void Read() { using (StreamReader reader = new StreamReader(InputStream, Encoding.ASCII)) { foreach (var property in DataObject.EnumerateProperties()) { OffsetInfo offset = property.GetTextOffset(); reader.BaseStream.Position = offset.Start - 1; StringBuilder builder = new StringBuilder(offset.Size); int count = 0; while (reader.Peek() >= 0 && count < offset.Size) { char c = (char)reader.Read(); if ((int)c != 32 && c != '\r' && c != '\n') { builder.Append(c); count++; } else { reader.BaseStream.Position++; } } property.SetValue(DataObject, Convert.ChangeType(builder.ToString(), property.PropertyType, CultureInfo.CurrentCulture), null ); } } }

    Read the article

  • c# finding matching words in table column using Linq2Sql

    - by David Liddle
    I am trying to use Linq2Sql to return all rows that contain values from a list of strings. The linq2sql class object has a string property that contains words separated by spaces. public class MyObject { public string MyProperty { get; set; } } Example MyProperty values are: MyObject1.MyProperty = "text1 text2 text3 text4" MyObject2.MyProperty = "text2" For example, using a string collection, I pass the below list var list = new List<>() { "text2", "text4" } This would return both items in my example above as they both contain "text2" value. I attempted the following using the below code however, because of my extension method the Linq2Sql cannot be evaluated. public static IQueryable<MyObject> WithProperty(this IQueryable<MyProperty> qry, IList<string> p) { return from t in qry where t.MyProperty.Contains(p, ' ') select t; } I also wrote an extension method public static bool Contains(this string str, IList<string> list, char seperator) { if (String.IsNullOrEmpty(str) || list == null) return false; var splitStr = str.Split(new char[] { seperator }, StringSplitOptions.RemoveEmptyEntries); foreach (string s in splitStr) foreach (string l in list) if (String.Compare(s, l, true) == 0) return true; return false; } Any help or ideas on how I could achieve this?

    Read the article

  • Saving a single entity instead of the entire context - revisited

    - by nite
    I’m looking for a way to have fine grained control over what is saved using Entity Framework, rather than the whole ObjectContext.SaveChanges(). My scenario is pretty straight forward, and I’m quite amazed not catered for in EF – pretty basic in NHibernate and all other data access paradigms I’ve seen. I’m generating a bunch of data (in a WPF UI) and allowing the user to fine tune what is proposed and choose what is actually committed to the database. For the proposed entities I’m: getting a bunch of reference entities (eg languages) via my objectcontext, creating the proposed entities and assigning these reference entities to them (as navigation properties), so by virtue of their relationship to the reference entities they’re implicitly added to the objectconext Trying to create & save individual entites based on the proposed entities. I figure this should be really simple & trivial but everything I’ve tried I’ve hit a brick wall, either I set up another objectcontext & add just the entity I need (it then tries to add the whole graph and fails as it’s on another objectcontext). I’ve tried MergeOptions = NoTracking on my reference entities to try to get the Attach/AddObject not to navigate through these to create a graph, no avail. I've removed the navigation properties from the reference entities. I've tried AcceptAllChanges, that works but pretty useless in practice as I do still want to track & save other entities. In a simple test, I can create 2 of my proposed entities, AddObject the one I want to save and then Detach the one I dont then call SaveChanges, this works but again not great in practice. Following are a few links to some of the nifty ideas which in the end don’t help in the end but illustrate the complexity of EF for something so simple. I’m really looking for a SaveSingle/SaveAtomic method, and think it’s a pretty reasonable & basic ask for any DAL, letalone a cutting edge ORM. http://stackoverflow.com/questions/1301460/saving-a-single-entity-instead-of-the-entire-context www.codeproject.com/KB/architecture/attachobjectgraph.aspx?fid=1534536&df=90&mpp=25&noise=3&sort=Position&view=Quick&select=3071122&fr=1 bernhardelbl.spaces.live.com/blog/cns!DB54AE2C5D84DB78!238.entry

    Read the article

< Previous Page | 48 49 50 51 52 53 54 55 56 57 58 59  | Next Page >