Search Results

Search found 1507 results on 61 pages for 'spaces'.

Page 52/61 | < Previous Page | 48 49 50 51 52 53 54 55 56 57 58 59  | Next Page >

  • Render multiple Form instances

    - by vorpyg
    I have a simple application where users are supposed to bet on outcome of a match. A match consists of two teams, a result and a stake. Matches with teams are created in the Django admin, and participants are to fill in result and stake. The form must be generated dynamically, based on the matches in the database. My idea is to have one (Django) Form instance for each match and pass these instances to the template. It works fine when I do it from django shell, but the instances aren't rendered when I load my view. The form looks like this: class SuggestionForm(forms.Form): def __init__(self, *args, **kwargs): try: match = kwargs.pop('match') except KeyError: pass super(SuggestionForm, self).__init__(*args, **kwargs) label = match self.fields['result'] = forms.ChoiceField(label=label, required=True, choices=CHOICES, widget=forms.RadioSelect()) self.fields['stake'] = forms.IntegerField(label='', required=True, max_value=50, min_value=10, initial=10) My (preliminary) view looks like this: def suggestion_form(request): matches = Match.objects.all() form_collection = {} for match in matches: f = SuggestionForm(request.POST or None, match=match) form_collection['match_%s' % match.id] = f return render_to_response('app/suggestion_form.html', { 'forms': form_collection, }, context_instance = RequestContext(request) ) My initial thought was that I could pass the form_collection to the template and the loop throught the collection like this, but id does not work: {% for form in forms %} {% for field in form %} {{ field }} {% endfor %} {% endfor %} (The output is actually the dict keys with added spaces in between each letter - I've no idea why…) It works if I only pass one Form instance to the template and only runs the inner loop. Suggestions are greatly appreciated.

    Read the article

  • C when to allocate and free memory - before function call, after function call...etc

    - by Keith P
    I am working with my first straight C project, and it has been a while since I worked on C++ for that matter. So the whole memory management is a bit fuzzy. I have a function that I created that will validate some input. In the simple sample below, it just ignores spaces: int validate_input(const char *input_line, char* out_value){ int ret_val = 0; /*false*/ int length = strlen(input_line); cout << "length = " << length << "\n"; out_value =(char*) malloc(sizeof(char) * length + 1); if (0 != length){ int number_found = 0; for (int x = 0; x < length; x++){ if (input_line[x] != ' '){ /*ignore space*/ /*get the character*/ out_value[number_found] = input_line[x]; number_found++; /*increment counter*/ } } out_value[number_found + 1] = '\0'; ret_val = 1; } return ret_val; } Instead of allocating memory inside the function for out_value, should I do it before I call the function and always expect the caller to allocate memory before passing into the function? As a rule of thumb, should any memory allocated inside of a function be always freed before the function returns?

    Read the article

  • Reading from txt ruins formatting

    - by Sorin Grecu
    I'm saving some values to a txt file and after that i want to be able to show it in a dialog.All good,done that but though the values in the txt file are formated nicely,like this : Aaaaaaaa 0.55 1 Bbbbb 1 2.2 CCCCCCCCC 3 0.22 When reading and setting them to a textview they get all messy like this : Aaaaaaaa 0.55 1 Bbbbb 1 2.2 CCCCCCCCC 3 0.22 My writting method : FileOutputStream f = new FileOutputStream(file); PrintWriter pw = new PrintWriter(f); for (int n = 0; n < allpret.size() - 1; n++) { if (cant[n] != Float.toString(0) && pret[n] != Float.toString(0)) { String myFormat = "%-20s %-5s %-5s%n"; pw.println(String.format(myFormat, prod[n], cant[n], pret[n])); My reading method : StringBuilder text = new StringBuilder(); try { BufferedReader br = new BufferedReader(new FileReader(file)); String line; while ((line = br.readLine()) != null) { text.append(line); text.append('\n'); } } catch (IOException e) { } Why does it ruin the amount of spaces and how can i fix this ? Thanks and have a good night !

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Indenting Paragraph With cout

    - by Eric
    Given a string of unknown length, how can you output it using cout so that the entire string displays as an indented block of text on the console? (so that even if the string wraps to a new line, the second line would have the same level of indentation) Example: cout << "This is a short string that isn't indented." << endl; cout << /* Indenting Magic */ << "This is a very long string that will wrap to the next line because it is a very long string that will wrap to the next line..." << endl; And the desired output: This is a short string that isn't indented. This is a very long string that will wrap to the next line because it is a very long string that will wrap to the next line... Edit: The homework assignment I'm working on is complete. The assignment has nothing to do with getting the output to format as in the above example, so I probably shouldn't have included the homework tag. This is just for my own enlightment. I know I could count through the characters in the string, see when I get to the end of a line, then spit out a newline and output -x- number of spaces each time. I'm interested to know if there is a simpler, idiomatic C++ way to accomplish the above.

    Read the article

  • MS SQL find and replace in TEXT field

    - by incubushead
    I have a database in MS SQL 2005 that was brought up from SQL 2000 and is still using TEXT type fields instead of varchar(max). I need to find and replace a string of characters in the text field but all of the examples of how to do this that I have found don't seem like they would work for me. It seems the UPDATETEXT command requires that the two parameters "insert_offset" and "delete_length" be set explicitly but the string i am searching for could show up in the text at any point or even at several points in the same cell. My understanding of these two parameters is that the string im searching for will always be in the same place, so that insert_offset is the number of spaces into the text that the UPDATETEXT command will start replacing text. Example: Need to find: &lt;u&gt; and Replace it with: <u> Text field example: *Everyone in the room was <b>&lt;u&gt;tired&lt;/u&gt;.</b><br>Then they woke <b>&lt;u&gt;up&lt;/u&gt;. Can anyone help me out with this? THANKS!

    Read the article

  • How do I tweak columns in a Flat File Destination in SSIS?

    - by theog
    I have an OLE DB Data source and a Flat File Destination in the Data Flow of my SSIS Project. The goal is simply to pump data into a text file, and it does that. Where I'm having problems is with the formatting. I need to be able to rtrim() a couple of columns to remove trailing spaces, and I have a couple more that need their leading zeros preserved. The current process is losing all the leading zeros. The rtrim() can be done by simple truncation and ignoring the truncation errors, but that's very inelegant and error prone. I'd like to find a better way, like actually doing the rtrim() function where needed. Exploring similar SSIS questions & answers on SO, the thing to do seems to be "Use a Script Task", but that's ususally just thrown out there with no details, and it's not at all an intuitive thing to set up. I don't see how to use scripting to do what I need. Do I use a Script Task on the Control Flow, or a Script Component in the Data Flow? Can I do rtrim() and pad strings where needed in a script? Anybody got an example of doing this or similar things? Many thanks in advance.

    Read the article

  • How to check for a null object reference when validating forms in MVC

    - by quakkels
    Hello SO, I'm experimenting with validating forms in the asp.net MVC framework. I'm focusing on server side validation for the time being. I've come across an error that I'm not sure how to rectify. System.NullReferenceException: Object reference not set to an instance of an object. The code that throws the error is: [AcceptVerbs(HttpVerbs.Post)] public ActionResult Create([Bind(Exclude="ID")] MembersCreate mc ) { mc.Modules = ModuleListDataContext.GetModuleList(); ViewData.Model = mc; //Validation using ModelState // // //line below errors when form field is empty // if ((string)mc.Member.Username.Trim() == "") ModelState.AddModelError("Member.Username", "Username is required."); if (!ModelState.IsValid) return View(); try { // TODO: Add insert logic here return RedirectToAction("Index","Home"); } catch { return View(); } } When I put spaces in the field it performs exactly as i want, but if I leave the field blank and press submit I get the error. What's the best way to avoid this error and still validate blank form fields? Thanks all -

    Read the article

  • Rename files and directories using substitution and variables

    - by rednectar
    I have found several similar questions that have solutions, except they don't involve variables. I have a particular pattern in a tree of files and directories - the pattern is the word TEMPLATE. I want a script file to rename all of the files and directories by replacing the word TEMPLATE with some other name that is contained in the variable ${newName} If I knew that the value of ${newName} was say "Fred lives here", then the command find . -name '*TEMPLATE*' -exec bash -c 'mv "$0" "${0/TEMPLATE/Fred lives here}"' {} \; will do the job However, if my script is: newName="Fred lives here" find . -name '*TEMPLATE*' -exec bash -c 'mv "$0" "${0/TEMPLATE/${newName}}"' {} \; then the word TEMPLATE is replaced by null rather than "Fred lives here" I need the "" around $0 because there are spaces in the path name, so I can't do something like: find . -name '*TEMPLATE*' -exec bash -c 'mv "$0" "${0/TEMPLATE/"${newName}"}"' {} \; Can anyone help me get this script to work so that all files and directories that contain the word TEMPLATE have TEMPLATE replaced by whatever the value of ${newName} is eg, if newName="A different name" and a I had directory of /foo/bar/some TEMPLATE directory/with files then the directory would be renamed to /foo/bar/some A different name directory/with files and a file called some TEMPLATE file would be renamed to some A different name file

    Read the article

  • drupal themes: .info file: how do I add more than 1 css file / js file to my theme?

    - by egarcia
    I'm creating a new Drupal theme. Until now, I only needed to include a single css file and a single js file. So my theme.info file had something like this: stylesheets[all][] = css/style.css scripts[] = js/script.js Now I must include jquery and jquery-ui in order to use a calendar date. These come with 2 new javascript files, and 1 additonal css file that I must add to the site. The calendar input form is going to be used in all pages (on a side block) so it is ok for me to load the extra css/javascript on all pages. I think the easiest thing would be to reference them on the .info file itself. At first I tried to just put them there with separate spaces: stylesheets[all][] = css/style.css css/ui-lightness/jquery-ui-1.8.1.custom.css scripts[] = js/jquery-1.4.2.min.js js/jquery-ui-1.8.1.custom.min.js js/reservations.js I emptied drupal's cache and... none of them loaded. I then tried separating each file with a comma, and flushing the cache again. Same result. I've browsed some drupal pages, but could not find how to add several javascript/css files on one theme (they always seem to add just 1 of each). So, how do I include several css/javascript files on the .info file?

    Read the article

  • JavaScript Regex: Complicated input validation

    - by ScottSEA
    I'm trying to construct a regex to screen valid part and/or serial numbers in combination, with ranges. A valid part number is a two alpha, three digit pattern or /[A-z]{2}\d{3}/ i.e. aa123 or ZZ443 etc... A valid serial number is a five digit pattern, or /\d{5}/ 13245 or 31234 and so on. That part isn't the problem. I want combinations and ranges to be valid as well: 12345, ab123,ab234-ab245, 12346 - 12349 - the ultimate goal. Ranges and/or series of part and/or serial numbers in any combination. Note that spaces are optional when specifying a range or after a comma in a series. Note that a range of part numbers has the same two letter combination on both sides of the range (i.e. ab123 - ab239) I have been wrestling with this expression for two days now, and haven't come up with anything better than this: /^(?:[A-z]{2}\d{3}[, ]*)|(?:\d{5}[, ]*)|(?:([A-z]{2})\d{3} ?- ?\4\d{3}[, ]*)|(?:\d{5} ?- ?\d{5}[, ]*)$/ ... My Regex-Fu is weak.

    Read the article

  • drupal themes: how do I include several css files / js files on my theme's .info file?

    - by egarcia
    I'm creating a new Drupal theme. Until now, I only needed to include a single css file and a single js file. So my theme.info file had something like this: stylesheets[all][] = css/style.css scripts[] = js/script.js Now I must include jquery and jquery-ui in order to use a calendar date. These come with 2 new javascript files, and 1 additonal css file that I must add to the site. The calendar input form is going to be used in all pages (on a side block) so it is ok for me to load the extra css/javascript on all pages. I think the easiest thing would be to reference them on the .info file itself. At first I tried to just put them there with separate spaces: stylesheets[all][] = css/style.css css/ui-lightness/jquery-ui-1.8.1.custom.css scripts[] = js/script.js js/jquery-1.4.2.min.js js/jquery-ui-1.8.1.custom.min.js I emptied drupal's cache and... none of them loaded. I then tried separating each file with a comma, and flushing the cache again. Same result. I've browsed some drupal pages, but could not find how to add several javascript/css files on one theme (they always seem to add just 1 of each). So, how do I include several css/javascript files on the .info file?

    Read the article

  • Algorithm complexity question

    - by Itsik
    During a recent job interview, I was asked to give a solution to the following problem: Given a string s (without spaces) and a dictionary, return the words in the dictionary that compose the string. For example, s= peachpie, dic= {peach, pie}, result={peach, pie}. I will ask the the decision variation of this problem: if s can be composed of words in the dictionary return yes, otherwise return no. My solution to this was in backtracking (written in Java) public static boolean words(String s, Set<String> dictionary) { if ("".equals(s)) return true; for (int i=0; i <= s.length(); i++) { String pre = prefix(s,i); // returns s[0..i-1] String suf = suffix(s,i); // returns s[i..s.len] if (dictionary.contains(pre) && words(suf, dictionary)) return true; } return false; } public static void main(String[] args) { Set<String> dic = new HashSet<String>(); dic.add("peach"); dic.add("pie"); dic.add("1"); System.out.println(words("peachpie1", dic)); // true System.out.println(words("peachpie2", dic)); // false } What is the time complexity of this solution? I'm calling recursively in the for loop, but only for the prefix's that are in the dictionary. Any idea's?

    Read the article

  • Why is my Scala function returning type Unit and not whatever is the last line?

    - by Andy
    I am trying to figure out the issue, and tried different styles that I have read on Scala, but none of them work. My code is: .... val str = "(and x y)"; def stringParse ( exp: String, pos: Int, expreshHolder: ArrayBuffer[String], follow: Int ) var b = pos; //position of where in the expression String I am currently in val temp = expreshHolder; //holder of expressions without parens var arrayCounter = follow; //just counts to make sure an empty spot in the array is there to put in the strings if(exp(b) == '(') { b = b + 1; while(exp(b) == ' '){b = b + 1} //point of this is to just skip any spaces between paren and start of expression type if(exp(b) == 'a') { temp(arrayCounter) = exp(b).toString; b = b+1; temp(arrayCounter)+exp(b).toString; b = b+1; temp(arrayCounter) + exp(b).toString; arrayCounter+=1} temp; } } val hold: ArrayBuffer[String] = stringParse(str, 0, new ArrayBuffer[String], 0); for(test <- hold) println(test); My error is: Driver.scala:35: error: type mismatch; found : Unit required: scala.collection.mutable.ArrayBuffer[String] ho = stringParse(str, 0, ho, 0); ^one error found When I add an equals sign after the arguments in the method declaration, like so: def stringParse ( exp: String, pos: Int, expreshHolder: ArrayBuffer[String], follow: Int ) ={....} It changes it to "Any". I am confused on how this works. Any ideas? Much appreciated.

    Read the article

  • How do I check to see if a scalar has a compiled regex in it with Perl?

    - by Robert P
    Let's say I have a subroutine/method that a user can call to test some data that (as an example) might look like this: sub test_output { my ($self, $test) = @_; my $output = $self->long_process_to_get_data(); if ($output =~ /\Q$test/) { $self->assert_something(); } else { $self->do_something_else(); } } Normally, $test is a string, which we're looking for anywhere in the output. This was an interface put together to make calling it very easy. However, we've found that sometimes, a straight string is problematic - for example, a large, possibly varying number of spaces...a pattern, if you will. Thus, I'd like to let them pass in a regex as an option. I could just do: $output =~ $test if I could assume that it's always a regex, but ah, but the backwards compatibility! If they pass in a string, it still needs to test it like a raw string. So in that case, I'll need to test to see if $test is a regex. Is there any good facility for detecting whether or not a scalar has a compiled regex in it?

    Read the article

  • Should developers *really* have private offices?

    - by Aron Rotteveel
    We will probably be moving within a year, so we have to make some decisions regarding office layout. At the moment, our company is basically one big office. When our developers can't bother to be disturbed at all, we all have our own headphones to mute the outside world. Still, it seems a lot of people feel that private offices are no doubt the way to go. From Joel's article Private Offices Redux: Not every programmer in the world wants to work in a private office. In fact quite a few would tell you unequivocally that they prefer the camaradarie and easy information sharing of an open space. Don't fall for it. They also want M&Ms for breakfast and a pony. Open space is fun but not productive. Even though I can understand the benefit on productivity, does having a private office really result in more net productivity? There seem to be plenty of companies that create wide open spaces and still maintain good productivity. Or so it seems. (I should mention many of them use cubicles, though) What is your opinion on this? What does your company do? Is there some middle ground in this? Some more related information on this matter: Private Offices Redux The new Fog Creek office A Field Guide to Developers Gmail recruitment page. Found this last one somewhat remarkable since the Gmail recruitment page promotes the "wide open space" idea.

    Read the article

  • How do I get rid of the space between <img> elements in a row in a html page?

    - by Aperture
    I'm displaying 3 <img> in a row like this: <div style="width: 950px"> <img src='/UploadedImages/86.jpg' alt='' style="width: 300px; margin: 0px; padding: 0px; border: 1px solid Black" /> <img src='/UploadedImages/85.jpg' alt='' style="width: 300px; margin: 0px; padding: 0px; border: 1px solid Black" /> <img src='/UploadedImages/84.gif' alt='' style="width: 300px; margin: 0px; padding: 0px; border: 1px solid Black" /> </div> As you can see I have thin black borders around the images. My problem is that there are white spaces about 5px wide between the borders of neighbouring images and I have set the margin to be 0px but it does not work. So what is happening here?

    Read the article

  • JSTL <c:out> where the element name contains a space character...

    - by Shane
    I have an array of values being made available, but unfortunately some of the variable names include a space. I cannot work out how to simply output these in the page. I know I'm not explaining this well (I'm the JSP designer, not the Java coder) so hopefully this example will illustrate what I'm trying to do: <c:out value="${x}"/> outputs to the page (artificially wrapped) as: {width=96.0, orderedheight=160.0, instructions=TEST ONLY. This is a test., productId=10132, publication type=ns, name=John} I can output the name by using <c:out value="${x.name}"/> no problems. The issue is when I try to get the "publication type"... because it has a space, I can't seem to get <c:out> to display it. I have tried: <!-- error parsing custom action attribute: --> <c:out value="${x.publication type}"/> <!-- error occurred while evaluating custom action attribute: --> <c:out value="${x.publication+type}"/> <!-- error occurred while parsing custom action attribute: --> <c:out value="${x.'publication type'}"/> <!-- error occurred while parsing custom action attribute: --> <c:out value="${x.publication%20type}"/> I know the real solution is to get the variable names formatted correctly (ie: without spaces) but I can't get the code updated for quite a while. Can this be done? Any help greatly appreciated.

    Read the article

  • cmd.exe Command Line Parsing of Environment Variables

    - by Artefacto
    I can't figure how to have cmd.exe not interpret something like %PATH% as an environment variable. Given this program: #include<stdio.h> #include<windows.h> int main(int argc, char *argv[]) { int i; printf("cmd line: %s\n", GetCommandLine()); for (i = 0; i < argc; i++) { printf("%d: %s\n", i, argv[i]); } return 0; } I have these different outputs according to the position of the arguments: >args "k\" o" "^%PATH^%" cmd line: args "k\" o" "%PATH%" 0: args 1: k" o 2: %PATH% >args "^%PATH^%" "k\" o" cmd line: args "^%PATH^%" "k\" o" 0: args 1: ^%PATH^% 2: k" o I guess it's because cmd.exe doesn't recognize the escaped \" and sees the escaped double quote as closing the first, leaving in the first case %PATH% unquoted. I say this, because if I don't quote the argument, it always works: >args ^%PATH^% "k\" o" cmd line: args %PATH% "k\" o" 0: args 1: %PATH% 2: k" o but then I can have no spaces...

    Read the article

  • Saving a single entity instead of the entire context - revisited

    - by nite
    I’m looking for a way to have fine grained control over what is saved using Entity Framework, rather than the whole ObjectContext.SaveChanges(). My scenario is pretty straight forward, and I’m quite amazed not catered for in EF – pretty basic in NHibernate and all other data access paradigms I’ve seen. I’m generating a bunch of data (in a WPF UI) and allowing the user to fine tune what is proposed and choose what is actually committed to the database. For the proposed entities I’m: getting a bunch of reference entities (eg languages) via my objectcontext, creating the proposed entities and assigning these reference entities to them (as navigation properties), so by virtue of their relationship to the reference entities they’re implicitly added to the objectconext Trying to create & save individual entites based on the proposed entities. I figure this should be really simple & trivial but everything I’ve tried I’ve hit a brick wall, either I set up another objectcontext & add just the entity I need (it then tries to add the whole graph and fails as it’s on another objectcontext). I’ve tried MergeOptions = NoTracking on my reference entities to try to get the Attach/AddObject not to navigate through these to create a graph, no avail. I've removed the navigation properties from the reference entities. I've tried AcceptAllChanges, that works but pretty useless in practice as I do still want to track & save other entities. In a simple test, I can create 2 of my proposed entities, AddObject the one I want to save and then Detach the one I dont then call SaveChanges, this works but again not great in practice. Following are a few links to some of the nifty ideas which in the end don’t help in the end but illustrate the complexity of EF for something so simple. I’m really looking for a SaveSingle/SaveAtomic method, and think it’s a pretty reasonable & basic ask for any DAL, letalone a cutting edge ORM. http://stackoverflow.com/questions/1301460/saving-a-single-entity-instead-of-the-entire-context www.codeproject.com/KB/architecture/attachobjectgraph.aspx?fid=1534536&df=90&mpp=25&noise=3&sort=Position&view=Quick&select=3071122&fr=1 bernhardelbl.spaces.live.com/blog/cns!DB54AE2C5D84DB78!238.entry

    Read the article

  • SVG text parameter changing on conversion to image uri : random dy on tspan element

    - by Kitex
    Sorry that I could not compile jsfiddle because it's jsf application hosted locally and code is dependent on data from jsf application. Although I have arrange part of it and part if it as snippet here. Now Everything's correct in Firefox. Suddenly when I open it in chrome something happened. The text on raphael paper suddenly gets scattered in the paper. It's not where it's meant to be. This happens when I convert svg to image and again generate svg. Everything works fine in Firefox. There is chagne id dy of tspan dy=3.09499999 dy=432.0949999999999 Why is there this change in dy although x and y are same? SVG Correct: The fiddle is here. SVG Incorrect: The fiddle is here. function printMap(){ var svg = $('#map').html().replace(/>\s+/g, ">").replace(/\s+</g, "<"); // strips off all spaces between tags canvg('cvs', svg, { ignoreMouse: true, ignoreAnimation: true }); var canvas = document.getElementById('cvs'); var img = canvas.toDataURL("image/png"); $("#resImg").attr("src",img); $("#resImg").css("display",'block'); //$("resImg").css("display",'none'); $("#map").css("display",'none'); // location.href = img; } Before: Text are above the object: After: Texts are scattered:

    Read the article

  • Python/Django Concatenate a string depending on whether that string exists

    - by Douglas Meehan
    I'm creating a property on a Django model called "address". I want address to consist of the concatenation of a number of fields I have on my model. The problem is that not all instances of this model will have values for all of these fields. So, I want to concatenate only those fields that have values. What is the best/most Pythonic way to do this? Here are the relevant fields from the model: house = models.IntegerField('House Number', null=True, blank=True) suf = models.CharField('House Number Suffix', max_length=1, null=True, blank=True) unit = models.CharField('Address Unit', max_length=7, null=True, blank=True) stex = models.IntegerField('Address Extention', null=True, blank=True) stdir = models.CharField('Street Direction', max_length=254, null=True, blank=True) stnam = models.CharField('Street Name', max_length=30, null=True, blank=True) stdes = models.CharField('Street Designation', max_length=3, null=True, blank=True) stdessuf = models.CharField('Street Designation Suffix',max_length=1, null=True, blank=True) I could just do something like this: def _get_address(self): return "%s %s %s %s %s %s %s %s" % (self.house, self.suf, self.unit, self.stex, self.stdir, self.stname, self.stdes, self.stdessuf) but then there would be extra blank spaces in the result. I could do a series of if statements and concatenate within each, but that seems ugly. What's the best way to handle this situation? Thanks.

    Read the article

  • Return lines in input code causing gaps/whitespace between elements in output?

    - by Jenny Zhang
    I am trying to put images next to each other on a webpage. Here is my HTML: <img class="pt" src="Yellow Tulip.jpg" title="Yellow Tulip" alt="Yellow Tulip" /> <img class="pt" src="Pink Tulip.jpg" title="Pink Tulip" alt="Pink Tulip" /> <img class="pt" src="Purple Tulip.jpg" title="Purple Tulip" alt="Purple Tulip" /> However, on my webpage, this shows a gap between each image. I've noticed that once I remove the return line that makes the elements separate and readable and instead just put all the elements on one line, the gaps go away. <img class="pt" src="Yellow Tulip.jpg" title="Yellow Tulip" alt="Yellow Tulip" /><img class="pt" src="Pink Tulip.jpg" title="Pink Tulip" alt="Pink Tulip" /><img class="pt" src="Purple Tulip.jpg" title="Purple Tulip" alt="Purple Tulip" /> Is there anyway I can achieve the output of the latter but still have the code/input look like the former? I really like the readability that the return lines (enter spaces) bring to the code, but I don't want the whitespace it creates on the actual page. If someone could explain why this is and/or how to fix it, I'd be really grateful! :)

    Read the article

  • StreamReader returning another char

    - by Fernando
    I'm trying to read the content of a file with a StreamReader, that receives a FileStream. The file has some spaces inside (char 32) and the StreamReader is reading them as 0 (char 48). The screenshot shows the FileStream buffer and the StreamReader buffer. Both have the value 32, but when I call Read(), it returns 48. Am I missing something here? By the way, the code is running under .NET Compact Framework. The code that reads the data: public void Read() { using (StreamReader reader = new StreamReader(InputStream, Encoding.ASCII)) { foreach (var property in DataObject.EnumerateProperties()) { OffsetInfo offset = property.GetTextOffset(); reader.BaseStream.Position = offset.Start - 1; StringBuilder builder = new StringBuilder(offset.Size); int count = 0; while (reader.Peek() >= 0 && count < offset.Size) { char c = (char)reader.Read(); if ((int)c != 32 && c != '\r' && c != '\n') { builder.Append(c); count++; } else { reader.BaseStream.Position++; } } property.SetValue(DataObject, Convert.ChangeType(builder.ToString(), property.PropertyType, CultureInfo.CurrentCulture), null ); } } }

    Read the article

  • Resize iframe to show first element works except in IE 7

    - by Rob Fenwick
    I have two iframes on my home page, the script below is in the head of the page that is being displayed in the iframe, there are several divisions on the page in a container div with an id of 'content', I want to size the iframe on the home page so that just the first div is initially seen and to scroll to see the rest. It is working in all browsers that I have tried except IE 7, I don't care too much about earlier browsers. IE 7 is acting like the page being shown is blank and sizing the iframe to 0 height, can someone tell me why IE 7 is having a problem with it, and failing that how can I get IE 7 to ignore the script? function resizeIframe() { //get the firstChild of a container div with the id 'content' var div01 = document.getElementById("content").firstChild; //find the first element ignoring white spaces and returns while(div01.nodeType!=1){ div01 = div01.nextSibling; } // get the height of first element var boxHeight = div01.clientHeight; //set the height of iframe the id of the iframe is 'news' parent.document.getElementById('news').height = boxHeight; } I have the function called in the body tag. If someone could help me I'd very much appreciate it. The page that it is on is at wsuu.org The version with the script is not up but you can get an idea of what I'm trying to do. Rob

    Read the article

< Previous Page | 48 49 50 51 52 53 54 55 56 57 58 59  | Next Page >