Search Results

Search found 1507 results on 61 pages for 'spaces'.

Page 51/61 | < Previous Page | 47 48 49 50 51 52 53 54 55 56 57 58  | Next Page >

  • haml - if-else with different identations

    - by egarcia
    Hi everyone, I'm trying to render a calendar with rails and haml. The dates used come from a variable called @dates. It is a Date range that contains the first and last days to be presented on the calendar. The first day is always sunday and the last one is always monday. I'm planning to render a typical calendar, with one column per weekday (sunday is going to be the first day of the week) using an html table. So, I need to put a %tr followed by a %td on sundays, but the rest of the days I just need a %td. I'm having trouble modelling that on haml. This seems to require different levels of identation, and that's something it doesn't like. Here's my failed attempt: %table %tr %th= t('date.day_names')[0] # Sunday %th= t('date.day_names')[1] %th= t('date.day_names')[2] %th= t('date.day_names')[3] %th= t('date.day_names')[4] %th= t('date.day_names')[5] %th= t('date.day_names')[6] # Monday [email protected] do |date| - if(date.wday == 0) # if date is sunday %tr %td=date.to_s - else %td=date.to_s This doesn't work the way I want. The %tds for the non-sunday days appear outside of the %tr: <tr> <td>2010-04-24</td> </tr> <td>2010-04-25</td> <td>2010-04-26</td> <td>2010-04-27</td> <td>2010-04-28</td> <td>2010-04-29</td> <td>2010-04-30</td> I tried adding two more spaces to the else but then haml complained about improper identation. What's the best way to do this? Note: I'm not interested on rendering the calendar using unordered lists. Please don't suggest that.

    Read the article

  • POST variables to web server?

    - by OverTheRainbow
    Hello I've been trying several things from Google to POST data to a web server, but none of them work: I'm still stuck at how to convert the variables into the request, considering that the second variable is an SQL query so it has spaces. Does someone know the correct way to use a WebClient to POST data? I'd rather use WebClient because it requires less code than HttpWebRequest/HttpWebResponse. Here's what I tried so far: Private Sub Button1_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles Button1.Click Dim wc = New WebClient() 'convert data wc.Headers.Add("Content-Type", "application/x-www-form-urlencoded") Dim postData = String.Format("db={0}&query={1}", _ HttpUtility.UrlEncode("books.sqlite"), _ HttpUtility.UrlEncode("SELECT id,title FROM boooks")) 'Dim bytArguments As Byte() = Encoding.ASCII.GetBytes("db=books.sqlite|query=SELECT * FROM books") 'POST query Dim bytRetData As Byte() = wc.UploadData("http://localhost:9999/get", "POST", postData) RichTextBox1.Text = Encoding.ASCII.GetString(bytRetData) Exit Sub Dim client = New WebClient() Dim nv As New Collection nv.Add("db", "books.sqlite") nv.Add("query", "SELECT id,title FROM books") Dim address As New Uri("http://localhost:9999/get") 'Dim bytRetData As Byte() = client.UploadValues(address, "POST", nv) RichTextBox1.Text = Encoding.ASCII.GetString(bytRetData) Exit Sub 'Dim wc As New WebClient() 'convert data wc.Headers.Add("Content-Type", "application/x-www-form-urlencoded") Dim bytArguments As Byte() = Encoding.ASCII.GetBytes("db=books.sqlite|query=SELECT * FROM books") 'POST query 'Dim bytRetData As Byte() = wc.UploadData("http://localhost:9999/get", "POST", bytArguments) RichTextBox1.Text = Encoding.ASCII.GetString(bytRetData) Exit Sub End Sub Thank you.

    Read the article

  • Python alignment of assignments (style)

    - by ikaros45
    I really like following style standards, as those specified in PEP 8. I have a linter that checks it automatically, and definitely my code is much better because of that. There is just one point in PEP 8, the E251 & E221 don't feel very good. Coming from a JavaScript background, I used to align the variable assignments as following: var var1 = 1234; var2 = 54; longer_name = 'hi'; var lol = { 'that' : 65, 'those' : 87, 'other_thing' : true }; And in my humble opinion, this improves readability dramatically. Problem is, this is dis-recommended by PEP 8. With dictionaries, is not that bad because spaces are allowed after the colon: dictionary = { 'something': 98, 'some_other_thing': False } I can "live" with variable assignments without alignment, but what I don't like at all is not to be able to pass named arguments in a function call, like this: some_func(length= 40, weight= 900, lol= 'troll', useless_var= True, intelligence=None) So, what I end up doing is using a dictionary, as following: specs = { 'length': 40, 'weight': 900, 'lol': 'troll', 'useless_var': True, 'intelligence': None } some_func(**specs) or just simply some_func(**{'length': 40, 'weight': 900, 'lol': 'troll', 'useless_var': True, 'intelligence': None}) But I have the feeling this work around is just worse than ignoring the PEP 8 E251 / E221. What is the best practice?

    Read the article

  • div stacking/layout with css or javascript

    - by liz
    so i have 4 divs (i actually have many more but this will simplify the question). i want to display them in two columns. the 4 divs vary in height. the number of actual divs in the end will vary. so if i have this <div id="1" style="height: 200px" class="inline">some content here</div> <div id="2" style="height: 600px" class="inline">some content here</div> <div id="3" style="height: 300px" class="inline">some content here</div> <div id="4" style="height: 200px" class="inline">some content here</div> with styling thus .inline { display: inline-block; vertical-align: top; width: 48%;} so #1 would go left and then #2 would shove up beside it to the right, great, but the #3 will not slide up the 400px to fit nicely below #1. (of course)... it goes on the left side but at 600px from the top clearing the bottom of #2. etc... how would i get the divs to slide up into the empty spaces, is it possible with css? jquery maybe? i know i could write column divs to mark it up, but since the number of divs constantly change and the heights vary according to content. It would be nice to just get rid of the space since we dont really care about the order. any thoughts?

    Read the article

  • Sparse (Pseudo) Infinite Grid Data Structure for Web Game

    - by Ming
    I'm considering trying to make a game that takes place on an essentially infinite grid. The grid is very sparse. Certain small regions of relatively high density. Relatively few isolated nonempty cells. The amount of the grid in use is too large to implement naively but probably smallish by "big data" standards (I'm not trying to map the Internet or anything like that) This needs to be easy to persist. Here are the operations I may want to perform (reasonably efficiently) on this grid: Ask for some small rectangular region of cells and all their contents (a player's current neighborhood) Set individual cells or blit small regions (the player is making a move) Ask for the rough shape or outline/silhouette of some larger rectangular regions (a world map or region preview) Find some regions with approximately a given density (player spawning location) Approximate shortest path through gaps of at most some small constant empty spaces per hop (it's OK to be a bad approximation often, but not OK to keep heading the wrong direction searching) Approximate convex hull for a region Here's the catch: I want to do this in a web app. That is, I would prefer to use existing data storage (perhaps in the form of a relational database) and relatively little external dependency (preferably avoiding the need for a persistent process). Guys, what advice can you give me on actually implementing this? How would you do this if the web-app restrictions weren't in place? How would you modify that if they were? Thanks a lot, everyone!

    Read the article

  • Browser dependent problem rendering WMD with Showdown.js?

    - by CMPalmer
    This should be easy (at least no one else seems to be having a similar problem), but I can't see where it is breaking. I'm storing Markdown'ed text in a database that is entered on a page in my app. The text is entered using WMD and the live preview looks correct. On another page, I'm retrieving the markdown text and using Showdown.js to convert it back to HTML client-side for display. Let's say I have this text: The quick **brown** fox jumped over the *lazy* dogs. 1. one 1. two 4. three 17. four I'm using this snippet of Javascript in my jQuery document ready event to convert it: var sd = new Attacklab.showdown.converter(); $(".ClassOfThingsIWantConverted").each(function() { this.innerHTML = sd.makeHtml($(this).html()); } I suspect this is where my problem is, but it almost works. In FireFox, I get what I expected: The quick brown fox jumped over the lazy dogs. one two three four But in IE (7 and 6), I get this: The quick brown fox jumped over the lazy dogs. 1. one 1. two 4. three 17. four So apparently, IE is stripping the breaks in my markdown code and just converting them to spaces. When I do a view source of the original code (prior to the script running), the breaks are there inside the container DIV. What am I doing wrong? UPDATE It is caused by the IE innerHTML/innerText "quirk" and I should have mentioned before that this one on an ASP.Net page using data bound controls - there are obviously a lot of different workarounds otherwise.

    Read the article

  • I'm having trouble spacing a menu control in an ASP.NET page. Is my solution the correct way to do t

    - by pkiyan
    Hey, I added a menu control to my page that is displayed vertically. I couldn't find a way to add spaces (I'd like about 5px.) between the menu items, so I just did something similar to this: <asp:Menu ID="Menu1" runat="server" BackColor="ActiveBorder"> <Items> <asp:MenuItem NavigateUrl="~/About.aspx" Text="One" /> </Items> </asp:Menu> <p></p> <asp:Menu ID="Menu2" runat="server" BackColor="ActiveBorder"> <Items> <asp:MenuItem NavigateUrl="~/Default.aspx" Text="Two" /> </Items> </asp:Menu> I just created multiple menu controls with a single menu item control in them, and placed a break between the menu controls. This seems very wrong to me, but I could not figure out another way. Also, this is a bit off subject, but is it okay to use empty paragraph tags as line breaks?(sometimes a br tag is too much) Thanks..

    Read the article

  • Indentation control while developing a small python like language

    - by sap
    Hello, I'm developing a small python like language using flex, byacc (for lexical and parsing) and C++, but i have a few questions regarding scope control. just as python it uses white spaces (or tabs) for indentation, not only that but i want to implement index breaking like for instance if you type "break 2" inside a while loop that's inside another while loop it would not only break from the last one but from the first loop as well (hence the number 2 after break) and so on. example: while 1 while 1 break 2 'hello world'!! #will never reach this. "!!" outputs with a newline end 'hello world again'!! #also will never reach this. again "!!" used for cout end #after break 2 it would jump right here but since I don't have an "anti" tab character to check when a scope ends (like C for example i would just use the '}' char) i was wondering if this method would the the best: I would define a global variable, like "int tabIndex" on my yacc file that i would access in my lex file using extern. then every time i find a tab character on my lex file i would increment that variable by 1. when parsing on my yacc file if i find a "break" keyword i would decrement by the amount typed after it from the tabIndex variable, and when i reach and EOF after compiling and i get a tabIndex != 0 i would output compilation error. now the problem is, whats the best way to see if the indentation got reduced, should i read \b (backspace) chars from lex and then reduce the tabIndex variable (when the user doesn't use break)? another method to achieve this? also just another small question, i want every executable to have its starting point on the function called start() should i hardcode this onto my yacc file? sorry for the long question any help is greatly appreciated. also if someone can provide an yacc file for python would be nice as a guideline (tried looking on Google and had no luck). thanks in advance.

    Read the article

  • converting numbers into alphabets.

    - by Nina
    Hi! i want to convert number into alphabets using javascript e.g. 01=n, 02=i 03=n,04=a and when someone enters the numbers:01020304 in the form he will get like this: nina. or whatever he enters it get replace with equivalent alphabets including spaces. i will be really thankful if you can provide full code including html form code as i am beginner. Thank you all for quick response. I have found this code in one site it converts alphabets into numbers, but code for converting numbers into alphabets isn't working. here is a code for converting alphabets into numbers: var i,j; var getc; var len; var num,alpha; num=new Array("01","02","03","04","05","06","07","08","09","10","11","12","13","14","15","16","17", "18","19","20","21","22","23","24","25","26","00","##","$$"); alpha=new Array("a","b","c","d","e","f","g","h","i","j","k","l","m","n","o","p","q","r","s","t","u"," v","w","x","y","z"," ",".",","); function encode() { len=document.f1.ta1.value.length; document.f1.ta2.value=""; for(i=0;i

    Read the article

  • P0ST variables to web server?

    - by OverTheRainbow
    Hello I've been trying several things from Google to POST data to a web server, but none of them work: I'm still stuck at how to convert the variables into the request, considering that the second variable is an SQL query so it has spaces. Does someone know the correct way to use a WebClient to POST data? I'd rather use WebClient because it requires less code than HttpWebRequest/HttpWebResponse. Here's what I tried so far: Private Sub Button1_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles Button1.Click Dim wc = New WebClient() 'convert data wc.Headers.Add("Content-Type", "application/x-www-form-urlencoded") Dim postData = String.Format("db={0}&query={1}", _ HttpUtility.UrlEncode("books.sqlite"), _ HttpUtility.UrlEncode("SELECT id,title FROM boooks")) 'Dim bytArguments As Byte() = Encoding.ASCII.GetBytes("db=books.sqlite|query=SELECT * FROM books") 'POST query Dim bytRetData As Byte() = wc.UploadData("http://localhost:9999/get", "POST", postData) RichTextBox1.Text = Encoding.ASCII.GetString(bytRetData) Exit Sub Dim client = New WebClient() Dim nv As New Collection nv.Add("db", "books.sqlite") nv.Add("query", "SELECT id,title FROM books") Dim address As New Uri("http://localhost:9999/get") 'Dim bytRetData As Byte() = client.UploadValues(address, "POST", nv) RichTextBox1.Text = Encoding.ASCII.GetString(bytRetData) Exit Sub 'Dim wc As New WebClient() 'convert data wc.Headers.Add("Content-Type", "application/x-www-form-urlencoded") Dim bytArguments As Byte() = Encoding.ASCII.GetBytes("db=books.sqlite|query=SELECT * FROM books") 'POST query 'Dim bytRetData As Byte() = wc.UploadData("http://localhost:9999/get", "POST", bytArguments) RichTextBox1.Text = Encoding.ASCII.GetString(bytRetData) Exit Sub End Sub Thank you.

    Read the article

  • copy entire row (without knowing field names)

    - by Todd Webb
    Using SQL Server 2008, I would like to duplicate one row of a table, without knowing the field names. My key issue: as the table grows and mutates over time, I would like this copy-script to keep working, without me having to write out 30+ ever-changing fields, ugh. Also at issue, of course, is IDENTITY fields cannot be copied. My code below does work, but I wonder if there's a more appropriate method than my thrown-together text string SQL statement? So thank you in advance. Here's my (yes, working) code - I welcome suggestions on improving it. Todd alter procedure spEventCopy @EventID int as begin -- VARS... declare @SQL varchar(8000) -- LIST ALL FIELDS (*EXCLUDE* IDENTITY FIELDS). -- USE [BRACKETS] FOR ANY SILLY FIELD-NAMES WITH SPACES, OR RESERVED WORDS... select @SQL = coalesce(@SQL + ', ', '') + '[' + column_name + ']' from INFORMATION_SCHEMA.COLUMNS where TABLE_NAME = 'EventsTable' and COLUMNPROPERTY(OBJECT_ID('EventsTable'), COLUMN_NAME, 'IsIdentity') = 0 -- FINISH SQL COPY STATEMENT... set @SQL = 'insert into EventsTable ' + ' select ' + @SQL + ' from EventsTable ' + ' where EventID = ' + ltrim(str(@EventID)) -- COPY ROW... exec(@SQL) -- REMEMBER NEW ID... set @EventID = @@IDENTITY -- (do other stuff here) -- DONE... -- JUST FOR KICKS, RETURN THE SQL STATEMENT SO I CAN REVIEW IT IF I WISH... select EventID = @EventID, SQL = @SQL end

    Read the article

  • Newb Question: scanf() in C

    - by riemannliness
    So I started learning C today, and as an exercise i was told to write a program that asks the user for numbers until they type a 0, then adds the even ones and the odd ones together. Here is is (don't laugh at my bad style): #include <stdio.h>; int main() { int esum = 0, osum = 0; int n, mod; puts("Please enter some numbers, 0 to terminate:"); scanf("%d", &n); while (n != 0) { mod = n % 2; switch(mod) { case 0: esum += n; break; case 1: osum += n; } scanf("%d", &n); } printf("The sum of evens:%d,\t The sum of odds:%d", esum, osum); return 0; } My question concerns the mechanics of the scanf() function. It seems that when you enter several numbers at once separated by spaces (eg. 1 22 34 2 8), the scanf() function somehow remembers each distinct numbers in the line, and steps through the while loop for each one respectively. Why/how does this happen? Example interaction within command prompt: - Please enter some numbers, 0 to terminate: 42 8 77 23 11 (enter) 0 (enter) - The sum of evens:50, The sum of odds:111 I'm running the program through the command prompt, it's compiled for win32 platforms with visual studio.

    Read the article

  • How to obtain the panel within a treeview (WPF)

    - by sperling
    How can one obtain the panel that is used within a TreeView? I've read that by default TreeView uses a VirtualizingStackPanel for this. When I look at a TreeView template, all I see is <ItemsPresenter />, which seems to hide the details of what panel is used. Possible solutions: 1) On the treeview instance ("tv"), from code, do this: tv.ItemsPanel. The problem is, this does not return a panel, but an ItemsPanelTemplate ("gets or sets the template that defines the panel that controls the layout of the items"). 2) Make a TreeView template that explicitly replaces <ItemsPresenter /> with your own ItemsControl.ItemsPanel. I am providing a special template anyways, so this is fine in my scenario. Then give a part name to the panel that you place within that template, and from code you can obtain that part (i.e. the panel). The problem with this? see below. (I am using a control named VirtualTreeView which is derived from TreeView, as is seen below): , use following: -- [sorry folks about poor formatting here, this is my first post, I tried 4 spaces for code... doesn't seem to work?] [I stripped out all clutter here for visibility...] The problem with this is: this immediately overrides any TreeView layout mechanism. Actually, you just get a blank screen, even when you have TreeViewItems filling the tree. Well, the reason I want to get a hold of the panel is to take some part in the MeaureOverride, but without going into all of that, I certainly do not want to rewrite the book of how to layout a treeview. I.e., doing this the step #2 way seems to invalidate the point of even using a TreeView in the first place. Sorry if there is some confusion here, thanks for any help you can offer.

    Read the article

  • The mathematics of Schellings segregation model

    - by Bruce
    For those who don't know the model. You can read this pdf. I want to find what is the probability that 2 nodes are each others neighbors when the algorithm converges (i.e. when all nodes are happy). Here's the model in a gist. You have a grid (say 10x10). You have nodes of two kind (red and green) 45 each. So we have 10 empty spaces. We randomly place the nodes on the grid. Now we scan through this grid (Exact order does not matter according to Schelling). Each node wants a specific percentage of people of same kind in its Moore neighborhood (say b = 50% for each red and green). We calculate the happiness of each node (a = Number of neighbors of same kind/Number of neighbors of different kind). If a node is unhappy (a < b) it moves to an empty cell where it knows it will be happy. This movement can change the dynamics of old as well as new neighborhood. Algorithm converges when all nodes are happy. PS - I am looking for links for any mathematical analysis of the Schelling's model.

    Read the article

  • ANTLR : How to replace all characters defined as space with actual space

    - by Puneet Pawaia
    Hi All, My ANTLR code is as follow : LPARENTHESIS : ('('); RPARENTHESIS : (')'); fragment CHARACTER : ('a'..'z'|'0'..'9'|); fragment QUOTE : ('"'); fragment WILDCARD : ('*'); fragment SPACE : (' '|'\n'|'\r'|'\t'|'\u000C'|';'|':'|','); WILD_STRING : (CHARACTER)* ( ('?') (CHARACTER)* )+ ; PREFIX_STRING : (CHARACTER)+ ( ('*') )+ ; WS : (SPACE) { $channel=HIDDEN; }; PHRASE : (QUOTE)(LPARENTHESIS)?(WORD)(WILDCARD)?(RPARENTHESIS)?((SPACE)+(LPARENTHESIS)?(WORD)(WILDCARD)?(RPARENTHESIS)?)*(SPACE)+(QUOTE); WORD : (CHARACTER)+; What I would like to do is to replace all characters marked as space to be replaced with actual space character in the PHRASE. Also if possible, I would then like all continuous spaces to be represented by a single space. Any help would be most appreciated. For some reason, I am finding it hard to understand ANTLR. Any good tutorials out there ?

    Read the article

  • Parse string to create a list of element

    - by Nick
    I have a string like this: "\r color=\"red\" name=\"Jon\" \t\n depth=\"8.26\" " And I want to parse this string and create a std::list of this object: class data { std::string name; std::string value; }; Where for example: name = color value = red What is the fastest way? I can use boost. EDIT: This is what i've tried: vector<string> tokens; split(tokens, str, is_any_of(" \t\f\v\n\r")); if(tokens.size() > 1) { list<data> attr; for_each(tokens.begin(), tokens.end(), [&attr](const string& token) { if(token.empty() || !contains(token, "=")) return; vector<string> tokens; split(tokens, token, is_any_of("=")); erase_all(tokens[1], "\""); attr.push_back(data(tokens[0], tokens[1])); } ); } But it does not work if there are spaces inside " ": like color="red 1".

    Read the article

  • Combine Search Bar and URL Bar into One (WebView)

    - by Jay Bush
    So I'm in the midst of updating my Web Browser app for iOS devices, from the ground up, and I'm trying to implement some more convenient features. One feature that seems to be really popular now, that I have been getting a lot of requests for, is the combination of a Google Search bar and a URL bar in one, like that of the Chrome application. Below is a screenshot of the Google Chrome app, and as you can see, they've made it so you can either enter in a search query like "apple ipad" and it will return a Google search page of 'Apple iPad', or you can enter in a URL "http://apple.com/ipad/" and it will load that URL. I have looked all over the internet, but all I could find were tutorials on how to Search Google with value of the UITextField. I have a feeling that the best way to do this is to probably make a 'check'. Like if the entered value contains 'http://' 'www.' '.com' or no spaces, then load it as a URL, if not then load it in a Google Search page, and then have the webview load up the Google Search page. If anybody could show me to the right direction, that would be great, or even supplying me with some code would be even greater. :) Thanks! If anyone needs part of the code, just ask.

    Read the article

  • Render multiple Form instances

    - by vorpyg
    I have a simple application where users are supposed to bet on outcome of a match. A match consists of two teams, a result and a stake. Matches with teams are created in the Django admin, and participants are to fill in result and stake. The form must be generated dynamically, based on the matches in the database. My idea is to have one (Django) Form instance for each match and pass these instances to the template. It works fine when I do it from django shell, but the instances aren't rendered when I load my view. The form looks like this: class SuggestionForm(forms.Form): def __init__(self, *args, **kwargs): try: match = kwargs.pop('match') except KeyError: pass super(SuggestionForm, self).__init__(*args, **kwargs) label = match self.fields['result'] = forms.ChoiceField(label=label, required=True, choices=CHOICES, widget=forms.RadioSelect()) self.fields['stake'] = forms.IntegerField(label='', required=True, max_value=50, min_value=10, initial=10) My (preliminary) view looks like this: def suggestion_form(request): matches = Match.objects.all() form_collection = {} for match in matches: f = SuggestionForm(request.POST or None, match=match) form_collection['match_%s' % match.id] = f return render_to_response('app/suggestion_form.html', { 'forms': form_collection, }, context_instance = RequestContext(request) ) My initial thought was that I could pass the form_collection to the template and the loop throught the collection like this, but id does not work: {% for form in forms %} {% for field in form %} {{ field }} {% endfor %} {% endfor %} (The output is actually the dict keys with added spaces in between each letter - I've no idea why…) It works if I only pass one Form instance to the template and only runs the inner loop. Suggestions are greatly appreciated.

    Read the article

  • Pull specific information from a long list with Perl

    - by melignus
    The file that I've got to work with here is the result of an LDAP extraction but I need to ultimately get the information formatted over to something that a spreadsheet can use. So, the data is as follows: DataDataDataDataDataDataDataDataDataDataDataDataDataDataDataData DataDataDataDataDataDataDataDataDataDataDataDataDataDataDataData displayName: John Doe name: ##userName DataDataDataDataDataDataDataDataDataDataDataDataDataDataDataData DataDataDataDataDataDataDataDataDataDataDataDataDataDataDataData displayName: Jane Doe name: ##userName DataDataDataDataDataDataDataDataDataDataDataDataDataDataDataData DataDataDataDataDataDataDataDataDataDataDataDataDataDataDataData displayName: Ted Doe name: ##userName The format that I need to export to is: firstName lastName userName firstName lastName userName firstName lastName userName Where the spaces are tabs so I can then impor that file into a database. I have experience doing this in VBScript but I'm trying to switch over to using Perl for as much server administration as possible. I'm not sure on the syntax for what I want which is basically while not endoffile{ detect "displayName: " & $firstName & " " & $lastName detect "name: ##" & $userName write $firstName tab $lastName tab $userName to file } Also if someone could point me to a resource specifically on the text parsing syntax that Perl uses, I'd be very grateful. Most of the resources that I've come across haven't been very helpful.

    Read the article

  • Exporting WPF DataGrid to a text file in a nice looking format. Text file must be easy to read.

    - by Andrew
    Hi, Is there a simple way to export a WPF DataGrid to a text file and a .csv file? I've done some searching and can't see that there is a simple DataGrid method to do so. I have got something working (barely) by making use of the ItemsSource of the DataGrid. In my case, this is an array of structs. I do something with StreamWriters and StringBuilders (details available) and basically have: StringBuilder destination = new StringBuilder(); destination.Append(row.CreationDate); destination.Append(seperator); // seperator is '\t' or ',' for csv file destination.Append(row.ProcId); destination.Append(seperator); destination.Append(row.PartNumber); destination.Append(seperator); I do this for each struct in the array (in a loop). This works fine. The problem is that it's not easy to read the text file. The data can be of different lengths within the same column. I'd like to see something like: 2007-03-03 234238423823 823829923 2007-03-03 66 99 And of course, I get something like: 2007-03-03 234238423823 823829923 2007-03-03 66 99 It's not surprising giving that I'm using Tab delimiters, but I hope to do better. It certainly is easy to read in the DataGrid! I could of course have some logic to pad short values with spaces, but that seems quite messy. I thought there might be a better way. I also have a feeling that this is a common problem and one that has probably been solved before (hopefully within the .NET classes themselves). Thanks.

    Read the article

  • A feeling that I'm not that good developer

    - by Karim
    Hi, Im having a strange feeling, but let me first introduce myself as a software developer. I started to program when I was still a kid, I had about 10 or 11 years. I really enjoy my work and never get bored from it. It's amazing how somebody could be paid for what he really likes to do and would be doing it anyway even for free. WHen I first started to program, I was feeling proud of what I was doing, each application I built was for me a success and after 2-3 year I had a feeling that I'm a coding guru. It was a nice feeling ;-) But the more I was in the field, the more types of software I started to develop I was starting to have a feeling that I'm completely wrong in that I'm guru. I felt that I'm not even a mediocre developer. Each new field I start to work on is giving me this feeling. Like when I once developed a device driver for a client, I saw how much I need to learn about device drivers. When I developed a video filter for an application, I saw how much do I still need to learn about DirectShow, Color Spaces, and all the theory behind that. The worst thing was when I started to learn algorithms. It was several years ago. I knew then the basic structures and algorithms like the sorting, some types of trees, some hashtables, strings etc.. and when I really wanted to learn a group of structures I learned about 5-6 new types and saw that in fact even this small group has several hundred subtypes of structures. It's depressing how little time people have in their lives to learn all this stuff. I'm now a software developer with about 10 years of experience and I still feel that I'm not a proficient developer when I think about things that others do in the industry. Is this normal what I'm experiencing or is it a sign of a destructive excessive ambition? Thanks in advance for any comments.

    Read the article

  • string maniupulations, oops, how do I replace parts of a string

    - by Joe Gibson
    I am very new to python. Could someone explain how I can manipulate a string like this? This function receives three inputs: complete_fmla: has a string with digits and symbols but has no hyphens ('-') nor spaces. partial_fmla: has a combination of hyphens and possibly some digits or symbols, where the digits and symbols that are in it (other than hyphens) are in the same position as in the complete_formula. symbol: one character The output that should be returned is: If the symbol is not in the complete formula, or if the symbol is already in the partial formula, the function should return the same formula as the input partial_formula. If the symbol is in the complete_formula and not in the partial formula, the function should return the partial_formula with the symbol substituting the hyphens in the positions where the symbol is, in all the occurrences of symbol in the complete_formula. For example: generate_next_fmla (‘abcdeeaa’, ‘- - - - - - - - ’, ‘d’) should return ‘- - - d - - - -’ generate_next_fmla (‘abcdeeaa’, ‘- - - d - - - - ’, ‘e’) should return ‘- - - d e e - -’ generate_next_fmla (‘abcdeeaa’, ‘- - - d e e - - ’, ‘a’) should return ‘a - - d e e a a’ Basically, I'm working with the definition: def generate_next_fmla (complete_fmla, partial_fmla, symbol): Do I turn them into lists? and then append? Also, should I find out the index number for the symbol in the complete_fmla so that I know where to append it in the string with hyphens??

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Excess errors on model from somewhere

    - by gmile
    I have a User model, and use an acts_as_authentic (from authlogic) on it. My User model have 3 validations on username and looks as following: User < ActiveRecord::Base acts_as_authentic validates_presence_of :username validates_length_of :username, :within => 4..40 validates_uniqueness_of :username end I'm writing a test to see my validations in action. Somehow, I get 2 errors instead of one when validating a uniqueness of a name. To see excess error, I do the following test: describe User do before(:each) do @user = Factory.build(:user) end it "should have a username longer then 3 symbols" do @user2 = Factory(:user) @user.username = @user2.username @user.save puts @user.errors.inspect end end I got 2 errors on username: @errors={"username"=>["has already been taken", "has already been taken"]}. Somehow the validation passes two times. I think authlogic causes that, but I don't have a clue on how to avoid that. Another case of problem is when I set username to nil. Somehow I get four validation errors instead of three: @errors={"username"=>["is too short (minimum is 3 characters)", "should use only letters, numbers, spaces, and .-_@ please.", "can't be blank", "is too short (minimum is 4 characters)"]} I think authlogic is one that causes this strange behaviour. But I can't even imagine on how to solve that. Any ideas?

    Read the article

  • using ini file in vb6, problem with path to file

    - by DrPut
    I have read many articles about how to use an INI file within my VB6 project. I don't have a problem with the methods, my problem is how to make the EXE file find the INI file. I don't want to hard code the path in the program. I simply want the EXE to expect the INI file to be present in the same folder the EXE is executed from. When I run the program from inside VB6 IDE, the INI is found and processed. When I compile the program and run the EXE, nothing is found. My code looks like: gServer = sGetINI(sINIFile, "TOOLBOM", "ServerName", "?") where TOOLBOM is the [Section] and "ServerName" is the key for the value. I obtained the following code for the API: Rem API DECLARATIONS Declare Function GetPrivateProfileString Lib "kernel32" Alias _ "GetPrivateProfileStringA" (ByVal lpApplicationName _ As String, ByVal lpKeyName As Any, ByVal lpDefault _ As String, ByVal lpReturnedString As String, ByVal _ nSize As Long, ByVal lpFileName As String) As Long Declare Function WritePrivateProfileString Lib "kernel32" Alias _ "WritePrivateProfileStringA" (ByVal lpApplicationName _ As String, ByVal lpKeyName As Any, ByVal lpString As Any, _ ByVal lpFileName As String) As Long Public Function sGetINI(sINIFile As String, sSection As String, sKey _ As String, sDefault As String) As String Dim sTemp As String * 256 Dim nLength As Integer sTemp = Space$(256) nLength = GetPrivateProfileString(sSection, sKey, sDefault, sTemp, _ 255, sINIFile) sGetINI = Left$(sTemp, nLength) End Function Public Sub writeINI(sINIFile As String, sSection As String, sKey _ As String, sValue As String) Dim n As Integer Dim sTemp As String sTemp = sValue Rem Replace any CR/LF characters with spaces For n = 1 To Len(sValue) If Mid$(sValue, n, 1) = vbCr Or Mid$(sValue, n, 1) = vbLf _ Then Mid$(sValue, n) = " " Next n n = WritePrivateProfileString(sSection, sKey, sTemp, sINIFile) End Sub

    Read the article

< Previous Page | 47 48 49 50 51 52 53 54 55 56 57 58  | Next Page >