Search Results

Search found 14008 results on 561 pages for 'easy marks'.

Page 520/561 | < Previous Page | 516 517 518 519 520 521 522 523 524 525 526 527  | Next Page >

• c++ class member functions instatiated by traits

  - by Jive Dadson

  I am reluctant to say I can't figure this out, but I can't figure this out. I've googled and searched stackoverflow, and come up empty. The abstract, and possibly overly vague form of the question is, how can I use the traits-pattern to instantiate non-virtual member functions? The question came up while modernizing a set of multivariate function optimizers that I wrote more than 10 years ago. The optimizers all operate by selecting a straight-line path through the parameter space away from the current best point (the "update"), then finding a better point on that line (the "line search"), then testing for the "done" condition, and if not done, iterating. There are different methods for doing the update, the line-search, and conceivably for the done test, and other things. Mix and match. Different update formulae require different state-variable data. For example, the LMQN update requires a vector, and the BFGS update requires a matrix. If evaluating gradients is cheap, the line-search should do so. If not, it should use function evaluations only. Some methods require more accurate line-searches than others. Those are just some examples. The original version instantiates several of the combinations by means of virtual functions. Some traits are selected by setting mode bits that are tested at runtime. Yuck. It would be trivial to define the traits with #define's and the member functions with #ifdef's and macros. But that's so twenty years ago. It bugs me that I cannot figure out a whiz-bang modern way. If there were only one trait that varied, I could use the curiously recurring template pattern. But I see no way to extend that to arbitrary combinations of traits. I tried doing it using boost::enable_if, etc.. The specialized state info was easy. I managed to get the functions done, but only by resorting to non-friend external functions that have the this-pointer as a parameter. I never even figured out how to make the functions friends, much less member functions. The compiler (vc++ 2008) always complained that things didn't match. I would yell, "SFINAE, you moron!" but the moron is probably me. Perhaps tag-dispatch is the key. I haven't gotten very deeply into that. Surely it's possible, right? If so, what is best practice?

  Read the article

• how to remove empty tags in input xml

  - by SGB

  My java module gets a huge input xml from a mainframe. Unfortunately, the mainframe is unable to skip optional elements when it is not a leaf node, with the result that I get a LOT of empty tags in my input : So, <pre><code><SSN>111111111</SSN> <Employment> <Current> <Address> <line1/> <line2/> <line3/> <city/> <state/> <country/> </Address> <Phone> <phonenumber/> <countryCode/> </Phone> </Current> <Previous> <Address> <line1/> <line2/> <line3/> <city/> <state/> <country/> </Address> <Phone> <phonenumber/> <countryCode/> </Phone> </Previous> </Employment> <MaritalStatus>Single</MaritalStatus> </code></pre> should be <SSN>111111111</SSN> <MaritalStatus>Single</MaritalStatus> I use jaxb to unmarshall the input xml string that the mainframe sends it. Is there a clean/ easy way to remove all the empty group tags, or do I have to do this manuall in the code for each element. I have over 35 elements in my input xml, so I would love to it if jaxb itself had a way of doing this automatically? Thanks, SGB

  Read the article

• What makes great software?

  - by VirtuosiMedia

  From the perspective of an end user, what makes a software great rather than just good or functional? What are some fundamental principles that can shift the way a software is used and perceived? What are some of the little finishing touches that help put an application over the top? I'm in the later stages of developing a web app and I'm looking for ideas or concepts that I may have missed. If you have specific examples of software or apps that you absolutely love, please share the reasons or features that make it special. Keep in mind that I'm looking for examples that directly affect the end user, but not necessarily just UI suggestions. Here are some of the principles and little touches I'm trying to use: Keep the UI as simple as possible. Remove absolutely everything that isn't necessary. Use progressive disclosure when more information can be needed sometimes but isn't needed all the time. Provide inline help and useful error messages. Verbs on buttons wherever possible. Make anything that's clickable obvious. Fast, responsive UI. Accessibility (this is a work in progress). Reusable UI patterns. Once a user learns a skill, they will be able to use it in multiple places. Intelligent default settings. Auto-focusing forms when filling out the form is the primary action to be taken on the page. Clear metaphors (like tabs) and headings indicating location within the app. Automating repetitive tasks (with the ability to disable the automation). Use standardized or accepted metaphors for icons (like an "x" for delete). Larger text sizes for improved readability. High contrast so that each section is distinct. Making sure that it's obvious on every page what the user is supposed to do by establishing a clear information hierarchy and drawing the eye to the call to action. Most deletions can be undone. Discoverability - Make it easy to learn how to do new tasks. Group similar elements together.

  Read the article

• Creating multiple heads in remote repository

  - by Jab

  We are looking to move our team (~10 developers) from SVN to mercurial. We are trying to figure out how to manage our workflow. In particular, we are trying to see if creating remote heads is the right solution. We currently have a very large repository with multiple, related projects. They share a lot of code, but pieces of the project are deployed by different teams (3 teams) independent of other portions of the code-base. So each team is working on concurrent large features. The way we currently handles this in SVN are branches. Team1 has a branch for Feature1, same deal for the other teams. When Team1 finishes their change, it gets merged into the trunk and deployed out. The other teams follow suite when their project is complete, merging of course. So my initial thought are using Named Branches for these situations. Team1 makes a Feature1 branch off of the default branch in Hg. Now, here is the question. Should the team PUSH that branch, in it's current/half-state to the repository. This will create a second head in the core repo. My initial reaction was "NO!" as it seems like a bad idea. Handling multiple heads on our repository just sounds awful, but there are some advantages... First, the teams want to setup Continuous Integration to build this branch during their development cycle(months long). This will only work if the CI can pull this branch from the repo. This is something we do now with SVN, copy a CI build and change the branch. Easy. Second, it makes it easier for any team member to jump onto the branch and start working. Without pushing to the core repo, they would have to receive a push from a developer on that team with the changeset information. It is also possible to lose local commits to hardware failure. The chances increase a lot if it's a branch by a single developer who has followed the "don't push until finished" approach. And lastly is just for ease of use. The developers can easily just commit and push on their branch at any time without consequence(as they do today, in their SVN branches). Is there a better way to handle this scenario that I may be missing? I just want a veteran's opinion before moving forward with the strategy. For bug fixes we like the general workflow of mecurial, anonymous branches that only consist of 1-2 commits. The simplicity is great for those cases. By the way, I've read this , great article which seems to favor Named branches.

  Read the article

• def constrainedMatchPair(firstMatch,secondMatch,length):

  - by smart

  matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

  Read the article

• What is the best practice to segment c#.net projects based on a single base project

  - by Anthony

  Honestly, I can't word my question any better without describing it. I have a base project (with all its glory, dlls, resources etc) which is a CMS. I need to use this project as a base for othe custom bake projects. This base project is to be maintained and updated among all custom bake projects. I use subversion (Collabnet and Tortise SVN) I have two questions: 1 - Can I use subversion to share the base project among other projects What I mean here is can I "Checkout" the base project into another "Checked Out" project and have both update and commit seperatley. So, to paint a picture, let's say I am working on a custom project and I modify the core/base prject in some way (which I know will suit the others) can I then commit those changes and upon doing so when I update the base project in the other "Checked out" resources will it pull the changes? In short, I would like not to have to manually deploy updated core files whenever I make changes into each seperate project. 2 - If I create a custom file (let's say an webcontrol or aspx page etc) can I have it compile seperatley from the base project Another tricky one to explain. When I publish my web application it creates DLLs based on the namespaces of projects attached to it. So I may have a number of DLLs including the "Website's" namespace DLL, which could simply be website. I want to be able to make a seperate, custom, control which does not compile into those DLLs as the custom files should not rely on those DLLS to run. Is it as simple to set a seperate namespace for those files like CustomFiles.ProjectName for example? Think of the whole idea as adding modules to the .NET project, I don't want the module's code in any of the core DLLs but I do need for module to be able to access the core dlls. (There is no need for the core project to access the module code as it should be one way only in theory, though I reckon it woould not be possible anyway without using JSON/SOAP or something like that, maybe I am wrong.) I want to create a pluggable environment much like that of Joomla/Wordpress as since PHP generally doesn't have to be compiled first I see this is the reason why all this is possible/easy. The idea is to allow pluggable themes, modules etc etc. (I haven't tried simply adding .NET themes after compile/publish but I am assuming this is possible anyway? OR does the compiler need to reference items in the files?)

  Read the article

• What database table structure should I use for versions, codebases, deployables?

  - by Zac Thompson

  I'm having doubts about my table structure, and I wonder if there is a better approach. I've got a little database for version control repositories (e.g. SVN), the packages (e.g. Linux RPMs) built therefrom, and the versions (e.g. 1.2.3-4) thereof. A given repository might produce no packages, or several, but if there are more than one for a given repository then a particular version for that repository will indicate a single "tag" of the codebase. A particular version "string" might be used to tag a version of the source code in more than one repository, but there may be no relationship between "1.0" for two different repos. So if packages P and Q both come from repo R, then P 1.0 and Q 1.0 are both built from the 1.0 tag of repo R. But if package X comes from repo Y, then X 1.0 has no relationship to P 1.0. In my (simplified) model, I have the following tables (the x_id columns are auto-incrementing surrogate keys; you can pretend I'm using a different primary key if you wish, it's not really important): repository - repository_id - repository_name (unique) ... version - version_id - version_string (unique for a particular repository) - repository_id ... package - package_id - package_name (unique) - repository_id ... This makes it easy for me to see, for example, what are valid versions of a given package: I can join with the version table using the repository_id. However, suppose I would like to add some information to this database, e.g., to indicate which package versions have been approved for release. I certainly need a new table: package_version - version_id - package_id - package_version_released ... Again, the nature of the keys that I use are not really important to my problem, and you can imagine that the data column is "promotion_level" or something if that helps. My doubts arise when I realize that there's really a very close relationship between the version_id and the package_id in my new table ... they must share the same repository_id. Only a small subset of package/version combinations are valid. So I should have some kind of constraint on those columns, enforcing that ... ... I don't know, it just feels off, somehow. Like I'm including somehow more information than I really need? I don't know how to explain my hesitance here. I can't figure out which (if any) normal form I'm violating, but I also can't find an example of a schema with this sort of structure ... not being a DBA by profession I'm not sure where to look. So I'm asking: am I just being overly sensitive?

  Read the article

• initializing a vector of custom class in c++

  - by Flamewires

  Hey basically Im trying to store a "solution" and create a vector of these. The problem I'm having is with initialization. Heres my class for reference class Solution { private: // boost::thread m_Thread; int itt_found; int dim; pfn_fitness f; double value; std::vector<double> x; public: Solution(size_t size, int funcNo) : itt_found(0), x(size, 0.0), value(0.0), dim(30), f(Eval_Functions[funcNo]) { for (int i = 1; i < (int) size; i++) { x[i] = ((double)rand()/((double)RAND_MAX))*maxs[funcNo]; } } Solution() : itt_found(0), x(31, 0.0), value(0.0), dim(30), f(Eval_Functions[1]) { for (int i = 1; i < 31; i++) { x[i] = ((double)rand()/((double)RAND_MAX))*maxs[1]; } } Solution operator= (Solution S) { x = S.GetX(); itt_found = S.GetIttFound(); dim = S.GetDim(); f = S.GetFunc(); value = S.GetValue(); return *this; } void start() { value = f (dim, x); } /* plus additional getter/setter methods*/ } Solution S(30, 1) or Solution(2, 5) work and initalizes everything, but I need X of these solution objects. std::vector<Solution> Parents(X) will create X solutions with the default constructor and i want to construct using the (int, int) constructor. Is there any easy(one liner?) way to do this? Or would i have to do something like: size_t numparents = 10; vector<Solution> Parents; Parents.reserve(numparents); for (int i = 0; i<(int)numparents; i++) { Solution S(31, 0); Parents.push_back(S); }

  Read the article

• Upgrading Entity Framework 1.0 to 4.0 to include foreign keys

  - by duthiega

  Currently I've been working with Entity Framework 1.0 which is located under a service façade. Below is one of the save methods I've created to either update or insert the device in question. This currently works but, I can't help feel that its a bit of a hack having to set the referenced properties to null then re-attach them just to get an insert to work. The changedDevice already holds these values, so why do I need to assign them again. So, I thought I'll update the model to EF4. That way I can just directly access the foreign keys. However, on doing this I've found that there doesn't seem to be an easy way to add the foreign keys except by removing the entity from the diagram and re-adding it. I don't want to do this as I've already been through all the entity properties renaming them from the DB column names. Can anyone help? /// <summary> /// Saves the non network device. /// </summary> /// <param name="nonNetworkDeviceDto">The non network device dto.</param> public void SaveNonNetworkDevice(NonNetworkDeviceDto nonNetworkDeviceDto) { using (var context = new AssetNetworkEntities2()) { var changedDevice = TransformationHelper.ConvertNonNetworkDeviceDtoToEntity(nonNetworkDeviceDto); if (!nonNetworkDeviceDto.DeviceId.Equals(-1)) { var originalDevice = context.NonNetworkDevices.Include("Status").Include("NonNetworkType").FirstOrDefault( d => d.DeviceId.Equals(nonNetworkDeviceDto.DeviceId)); context.ApplyAllReferencedPropertyChanges(originalDevice, changedDevice); context.ApplyCurrentValues(originalDevice.EntityKey.EntitySetName, changedDevice); } else { var maxNetworkDevice = context.NonNetworkDevices.OrderBy("it.DeviceId DESC").First(); changedDevice.DeviceId = maxNetworkDevice.DeviceId + 1; var status = changedDevice.Status; var nonNetworkType = changedDevice.NonNetworkType; changedDevice.Status = null; changedDevice.NonNetworkType = null; context.AttachTo("DeviceStatuses", status); if (nonNetworkType != null) { context.AttachTo("NonNetworkTypes", nonNetworkType); } changedDevice.Status = status; changedDevice.NonNetworkType = nonNetworkType; context.AddToNonNetworkDevices(changedDevice); } context.SaveChanges(); } }

  Read the article

• Route Angular to New Controller after Login

  - by MizAkita

  I'm kind of stuck on how to route my angular app to a new controller after login. I have a simple app, that uses 'loginservice'... after logging in, it then routes to /home which has a different template from the index.html(login page). I want to use /home as the route that displays the partial views of my flightforms controllers. What is the best way to configure my routes so that after login, /home is the default and the routes are called into that particular templates view. Seems easy but I keep getting the /login page when i click on a link which is suppose to pass the partial view into the default.html template: var app= angular.module('myApp', ['ngRoute']); app.config(['$routeProvider', function($routeProvider) { $routeProvider.when('/login', { templateUrl: 'partials/login.html', controller: 'loginCtrl' }); $routeProvider.when('/home', { templateUrl: 'partials/default.html', controller: 'defaultCtrl' }); }]); flightforms.config(['$routeProvider', function($routeProvider){ //sub pages $routeProvider.when('/home', { templateUrl: 'partials/default.html', controller: 'defaultCtrl' }); $routeProvider.when('/status', { templateUrl: 'partials/subpages/home.html', controller: 'statusCtrl' }); $routeProvider.when('/observer-ao', { templateUrl: 'partials/subpages/aobsrv.html', controller: 'obsvaoCtrl' }); $routeProvider.when('/dispatch', { templateUrl: 'partials/subpages/disp.html', controller: 'dispatchCtrl' }); $routeProvider.when('/fieldmgr', { templateUrl: 'partials/subpages/fieldopmgr.html', controller: 'fieldmgrCtrl' }); $routeProvider.when('/obs-backoffice', { templateUrl: 'partials/subpages/obsbkoff.html', controller: 'obsbkoffCtrl' }); $routeProvider.when('/add-user', { templateUrl: 'partials/subpages/users.html', controller: 'userCtrl' }); $routeProvider.otherwise({ redirectTo: '/status' }); }]); app.run(function($rootScope, $location, loginService) { var routespermission=['/home']; //route that require login $rootScope.$on('$routeChangeStart', function(){ if( routespermission.indexOf($location.path()) !=-1) { var connected=loginService.islogged(); connected.then(function(msg) { if(!msg.data) $location.path('/login'); }); } }); }); and my controllers are simple. Here's a sample of what they look like: var flightformsControllers = angular.module('flightformsController', []); flightforms.controller('fieldmgrCtrl', ['$scope','$http','loginService', function($scope,loginService) { $scope.txt='You are logged in'; $scope.logout=function(){ loginService.logout(); } }]); Any ideas on how to get my partials to display in the /home default.html template would be appreciated.

  Read the article

• Issues in Ajax based applications

  - by Sinuhe

  I'm very interested in developing Ajax based applications. This is, loading almost all of the content of the application via XMLHttpRequest, instead of only some combos and widgets. But if I try to do this form scratch, soon I find some problems without an easy solution. I wonder if there is some framework (both client and server side) to deal with this issues. As far as I know, there isn't (but I've searched mainly in Java world). So I am seriously thinking of doing my own framework, at least for my projects. Therefore, in this question I ask for several things. First, the possible problems of an ajax based development. Then, I'm looking for some framework or utility in order to deal with them. Finally, if there is no framework available, what features must it have. Here are the issues I thought: 1 - JavaScript must be enabled. Security paranoia isn't the only problem: a lot of mobile devices couldn't use the application, too. 2 - Sometimes you need to update more than one DIV (e.g. main content, menu and breadcrumbs). 3 - Unknown response type: when you make an Ajax call, you set the callback function too, usually specifying if expected response is a javascript object or in which DIV put the result. But this fails when you get another type of response: for example when the session has expired and the user must log in again. 4 - Browser's refresh, back and forward buttons can be a real pain. User will expect different behaviors depending on the situation. 5 - When search engines indexes a site, only follow links. Thus, content load by Ajax won't "exist" for who doesn't know about it yet. 6 - Users can ask for open a link in a different window/tab. 7 - Address bar doesn't show the "real" page you are in. So, you can't copy the location and send it to a friend or bookmark the page. 8 - If you want to monetize the site, you can put some advertisings. As you don't refresh entire page and you want to change the ad after some time, you have to refresh only the DIV where the ad is. But this can violate the Terms and Conditions of your ad service. In fact, it can go against AdSense TOS. 9 - When you refresh an entire page, all JavaScript gets "cleaned". But in Ajax calls, all JavaScript objects will remain. 10 - You can't easily change your CSS properties.

  Read the article

• CSS selectors : should I minimise my use of the class attribute in the HTML or optimise the speed

  - by Laurent Bourgault-Roy

  As I was working on a small website, I decided to use the PageSpeed extension to check if their was some improvement I could do to make the site load faster. However I was quite surprise when it told me that my use of CSS selector was "inefficient". I was always told that you should keep the usage of the class attribute in the HTML to a minimum, but if I understand correctly what PageSpeed tell me, it's much more efficient for the browser to match directly against a class name. It make sense to me, but it also mean that I need to put more CSS classes in my HTML. It also make my .css file a little harder to read. I usually tend to mark my CSS like this : #mainContent p.productDescription em.priceTag { ... } Which make it easy to read : I know this will affect the main content and that it affect something in a paragraph tag (so I wont start to put all sort of layout code in it) that describe a product and its something that need emphasis. However it seem I should rewrite it as .priceTag { ... } Which remove all context information about the style. And if I want to use differently formatted price tag (for example, one in a list on the sidebar and one in a paragraph), I need to use something like that .paragraphPriceTag { ... } .listPriceTag { ... } Which really annoy me since I seem to duplicate the semantic of the HTML in my classes. And that mean I can't put common style in an unqualified .priceTag { ... } and thus I need to replicate the style in both CSS rule, making it harder to make change. (Altough for that I could use multiple class selector, but IE6 dont support them) I believe making code harder to read for the sake of speed has never been really considered a very good practice . Except where it is critical, of course. This is why people use PHP/Ruby/C# etc. instead of C/assembly to code their site. It's easier to write and debug. So I was wondering if I should stick with few CSS classes and complex selector or if I should go the optimisation route and remove my fancy CSS selectors for the sake of speed? Does PageSpeed make over the top recommandation? On most modern computer, will it even make a difference?

  Read the article

• Having trouble doing an Update with a Linq to Sql object

  - by Pure.Krome

  Hi folks, i've got a simple linq to sql object. I grab it from the database and change a field then save. No rows have been updated. :( When I check the full Sql code that is sent over the wire, I notice that it does an update to the row, not via the primary key but on all the fields via the where clause. Is this normal? I would have thought that it would be easy to update the field(s) with the where clause linking on the Primary Key, instead of where'ing (is that a word :P) on each field. here's the code... using (MyDatabase db = new MyDatabase()) { var boardPost = (from bp in db.BoardPosts where bp.BoardPostId == boardPostId select bp).SingleOrDefault(); if (boardPost != null && boardPost.BoardPostId > 0) { boardPost.ListId = listId; // This changes the value from 0 to 'x' db.SubmitChanges(); } } and here's some sample sql.. exec sp_executesql N'UPDATE [dbo].[BoardPost] SET [ListId] = @p6 WHERE ([BoardPostId] = @p0) AND .... <snip the other fields>',N'@p0 int,@p1 int,@p2 nvarchar(9),@p3 nvarchar(10),@p4 int,@p5 datetime,@p6 int',@p0=1276,@p1=212787,@p2=N'ttreterte',@p3=N'ttreterte3',@p4=1,@p5='2009-09-25 12:32:12.7200000',@p6=72 Now, i know there's a datetime field in this update .. and when i checked the DB it's value was/is '2009-09-25 12:32:12.720' (less zero's, than above) .. so i'm not sure if that is messing up the where clause condition... but still! should it do a where clause on the PK's .. if anything .. for speed! Yes / no ? UPDATE After reading nitzmahone's reply, I then tried playing around with the optimistic concurrency on some values, and it still didn't work :( So then I started some new stuff ... with the optimistic concurrency happening, it includes a where clause on the field it's trying to update. When that happens, it doesn't work. so.. in the above sql, the where clause looks like this ... WHERE ([BoardPostId] = @p0) AND ([ListId] IS NULL) AND ... <rest snipped>) This doesn't sound right! the value in the DB is null, before i do the update. but when i add the ListId value to the where clause (or more to the point, when L2S add's it because of the optomistic concurrecy), it fails to find/match the row. wtf?

  Read the article

• What common routines do you put in your Program.cs for C#

  - by Rick

  I'm interested in any common routine/procedures/methods that you might use in you Program.cs when creating a .NET project. For instance I commonly use the following code in my desktop applications to allow easy upgrades, single instance execution and friendly and simple reporting of uncaught system application errors. using System; using System.Diagnostics; using System.Threading; using System.Windows.Forms; namespace NameoftheAssembly { internal static class Program { /// <summary> /// The main entry point for the application. Modified to check for another running instance on the same computer and to catch and report any errors not explicitly checked for. /// </summary> [STAThread] private static void Main() { //for upgrading and installing newer versions string[] arguments = Environment.GetCommandLineArgs(); if (arguments.GetUpperBound(0) > 0) { foreach (string argument in arguments) { if (argument.Split('=')[0].ToLower().Equals("/u")) { string guid = argument.Split('=')[1]; string path = Environment.GetFolderPath(Environment.SpecialFolder.System); var si = new ProcessStartInfo(path + "\\msiexec.exe", "/x" + guid); Process.Start(si); Application.Exit(); } } //end of upgrade } else { bool onlyInstance = false; var mutex = new Mutex(true, Application.ProductName, out onlyInstance); if (!onlyInstance) { MessageBox.Show("Another copy of this running"); return; } AppDomain.CurrentDomain.UnhandledException += CurrentDomain_UnhandledException; Application.ThreadException += ApplicationThreadException; Application.EnableVisualStyles(); Application.SetCompatibleTextRenderingDefault(false); Application.Run(new Form1()); } } private static void CurrentDomain_UnhandledException(object sender, UnhandledExceptionEventArgs e) { try { var ex = (Exception) e.ExceptionObject; MessageBox.Show("Whoops! Please contact the developers with the following" + " information:\n\n" + ex.Message + ex.StackTrace, " Fatal Error", MessageBoxButtons.OK, MessageBoxIcon.Stop); } catch (Exception) { //do nothing - Another Exception! Wow not a good thing. } finally { Application.Exit(); } } public static void ApplicationThreadException(object sender, ThreadExceptionEventArgs e) { try { MessageBox.Show("Whoops! Please contact the developers with the following" + " information:\n\n" + e.Exception.Message + e.Exception.StackTrace, " Error", MessageBoxButtons.OK, MessageBoxIcon.Stop); } catch (Exception) { //do nothing - Another Exception! Wow not a good thing. } } } } I find these routines to be very helpful. What methods have you found helpful in Program.cs?

  Read the article

• Javascript self contained sandbox events and client side stack

  - by amnon

  I'm in the process of moving a JSF heavy web application to a REST and mainly JS module application . I've watched "scalable javascript application architecture" by Nicholas Zakas on yui theater (excellent video) and implemented much of the talk with good success but i have some questions : I found the lecture a little confusing in regards to the relationship between modules and sandboxes , on one had to my understanding modules should not be effected by something happening outside of their sandbox and this is why they publish events via the sandbox (and not via the core as they do access the core for hiding base libary) but each module in the application gets a new sandbox ? , shouldn't the sandbox limit events to the modoules using it ? or should events be published cross page ? e.g. : if i have two editable tables but i want to contain each one in a different sandbox and it's events effect only the modules inside that sandbox something like messabe box per table which is a different module/widget how can i do that with sandbox per module , ofcourse i can prefix the events with the moduleid but that creates coupling that i want to avoid ... and i don't want to package modules toghter as one module per combination as i already have 6-7 modules ? while i can hide the base library for small things like id selector etc.. i would still like to use the base library for module dependencies and resource loading and use something like yui loader or dojo.require so in fact i'm hiding the base library but the modules themself are defined and loaded by the base library ... seems a little strange to me libraries don't return simple js objects but usualy wrap them e.g. : u can do something like $$('.classname').each(.. which cleans the code alot , it makes no sense to wrap the base and then in the module create a dependency for the base library by executing .each but not using those features makes a lot of code written which can be left out ... and implemnting that functionality is very bug prone does anyonen have any experience with building a front side stack of this order ? how easy is it to change a base library and/or have modules from different libraries , using yui datatable but doing form validation with dojo ... ? some what of a combination of 2+4 if u choose to do something like i said and load dojo form validation widgets for inputs via yui loader would that mean dojocore is a module and the form module is dependant on it ? Thanks .

  Read the article

• Little CSS problem with Auto height and nested div's

  - by GeekDrop.com

  So I'm finally learning my way around CSS more and have run into a small problem. I have a container div, with a few divs inside of it, one of them is a bit if text (which can be a random height) and an image that will have a MAX height of 200px. I am using a dotted/colored background behind them that needs to auto expand to the height of whichever is the tallest, either the text or the image. Right now when i use height:auto on the container div it works perfect for the random height text: Example Screenshot But it's only adjusting according to the text's height; if the image is taller than the text, the image overflows the bottom of the background dotted/colored box. Example Screenshot The CSS I'm using currently is this: h1 div#like_detailed { margin: 0; font-size: 1.1em; width: 700px; } #details-image img { border: none; clear: left; float: right; margin: -45px 0 0 0; max-height: 200px; padding: 0 7px 0 10px; } #deets-container { background-color: #FEF; border: #190AE7 1px dotted; height: auto; margin-top: 0; margin-bottom: 30px; padding-top: 10px; padding-right: 10px; padding-left: 10px; padding-bottom: 0; } And the HTML for it is this: <div id="deets-container" class="rounded"> <!-- Button --> <div class="likebtnframe">(some code)</div> <!-- Button --> <div class="tweetbtnframe">(some code)</div> <!-- Button --> <ul id="share"> <li><a name="share">(some code)</a></li> </ul> <!-- Submitted By --> <div class="submitter_detailed"><span class="submitter-color smalltext">(some code)</span> (some code)</div> <!-- Image --> <div id="**details-image**">(some code)</div> <!-- Like / Quote --> <h1 id="**like_detailed**">(some code)</h1> </div> I have a feeling this is pretty easy but I'm running out of time to sort it out on my own. Anyone?

  Read the article

• Casting objects in C# (ASP.Net MVC)

  - by Mortanis

  I'm coming from a background in ColdFusion, and finally moving onto something modern, so please bear with me. I'm running into a problem casting objects. I have two database tables that I'm using as Models - Residential and Commercial. Both of them share the majority of their fields, though each has a few unique fields. I've created another class as a container that contains the sum of all property fields. Query the Residential and Commercial, stuff it into my container, cunningly called Property. This works fine. However, I'm having problems aliasing the fields from Residential/Commercial onto Property. It's quite easy to create a method for each property: fillPropertyByResidential(Residential source) and fillPropertyByCommercial(Commercial source), and alias the variables. That also works fine, but quite obviously will copy a bunch of code - all those fields that are shared between the two main Models. So, I'd like a generic fillPropertyBySource() that takes the object, and detects if it's Residential or Commercial, fills the particular fields of each respective type, then do all the fields in common. Except, I gather in C# that variables created inside an If are only in the scope of the if, so I'm not sure how to do this. public property fillPropertyBySource(object source) { property prop = new property(); if (source is Residential) { Residential o = (Residential)source; //Fill Residential only fields } else if (source is Commercial) { Commercial o = (Commercial)source; //Fill Commercial only fields } //Fill fields shared by both prop.price = (int)o.price; prop.bathrooms = (float)o.bathrooms; return prop; } "o" being a Commercial or Residential only exists within the scope of the if. How do I detect the original type of the source object and take action? Bear with me - the shift from ColdFusion into a modern language is pretty..... difficult. More so since I'm used to procedural code and MVC is a massive paradigm shift. Edit: I should include the error: The name 'o' does not exist in the current context For the aliases of price and bathrooms in the shared area.

  Read the article

• Check to see if CallResponder is processing

  - by Travesty3

  I'm using Flash Builder 4.6. As a simple example, say I have the following application: <?xml version="1.0" encoding="utf-8"?> <s:Application xmlns:fx="http://ns.adobe.com/mxml/2009" xmlns:s="library://ns.adobe.com/flex/spark" xmlns:sdk="services.sdk.*"> <fx:Script> <![CDATA[ private function btnGetValue_clickHandler():void { getValueResult.token = sdk.getValue(); } private function getValueResultHandler():void { // ... } ]]> </fx:Script> <fx:Declarations> <sdk:SDK id="sdk" fault="{Alert.show(event.fault.faultString +'\n\n'+ event.fault.faultDetail, 'SDK ERROR');}" showBusyCursor="false"/> <s:CallResponder id="getValueResult" result="getValueResultHandler()"/> </fx:Declarations> <s:Button id="btnGetValue" click="btnGetValue_clickHandler()" label="Get Value" /> </s:Application> So when you click on the button, it calls a PHP file and when it gets a result, it calls getValueResultHandler(). Easy enough. But what if the response from the PHP file takes a second or two and the user clicks the button rapidly? Then the result handler function may not get called every time, since the call responder gets a new token before it received the last response. Is there a standard way of resolving this issue? I came up with the following workaround, and it works fine, but it seems like this issue would be common enough to have a more built-in solution. My workaround is: var getValueResultProcessing:Boolean = false; private function btnGetValue_clickHandler():void { var interval:uint = setInterval(function():void { if (!getValueResultProcessing) { getValueResultProcessing = true; getValueResult.token = sdk.getValue(); clearInterval(interval); } }, 100); getValueResult.token = sdk.getValue(); } private function getValueResultHandler():void { getValueResultProcessing = false; // ... } Any better way of resolving this issue?

  Read the article

• convert portion of code into a function php

  - by user765368

  This is probably very easy to do but for some reason I can't seem to figure this out. Let's say I have code like this: $elements = array('a', 'b', 'c', 'd'); $myValues = array( 'values' => array( 'a' => array( 'xx' => 3, 'yy' => '' ), 'b' => array( 'xx' => '', 'yy' => '' ), 'c' => array( 'xx' => 8.4, 'yy' => '' ), 'd' => array( 'xx' => 18.4, 'yy' => '' ) ) ); foreach($elements as $elem) { if($myValues['values'][$elem]['xx'] != '') { if($myValues['values'][$elem]['xx'] < 6) { $myValues['values'][$elem]['yy'] = 'less than 6'; } elseif($myValues['values'][$elem]['xx'] >= 6 && $myValues['values'][$elem]['xx'] < 15) { $myValues['values'][$elem]['yy'] = 'between 6 and 16'; } else { $myValues['values'][$elem]['yy'] = 'greater than 15'; } testFunc($myValues['values'][$elem]['xx']); // This is how I would call my function once I replace the code above } } As you can see here what I'm trying to do is to change the value of $myValues['values'][$elem]['yy'] based on some conditions. What I want to do is to replace the if elseif else section of codes by a function that performs the same action. I tried something like: function testFunc($xx) { if($xx < 6) { $yy = 'less than 6'; } elseif($xx >= 6 && $xx < 15) { $yy = 'between 6 and 16'; } else { $yy = 'greater than 15'; } return $yy; } But obviously this won't work because I'm not changing the value of $myValues['values'][$elem]['yy'] inside my function. NOTE I really want to pass ONLY the value of $myValues['values'][$elem]['xx'] inside my function and return the changed value of $myValues['values'][$elem]['yy']. Can anybody help me with this? Thanks in advance

  Read the article

• User has many computers, computers have many attributes in different tables, best way to JOIN?

  - by krismeld

  I have a table for users: USERS: ID | NAME | ---------------- 1 | JOHN | 2 | STEVE | a table for computers: COMPUTERS: ID | USER_ID | ------------------ 13 | 1 | 14 | 1 | a table for processors: PROCESSORS: ID | NAME | --------------------------- 27 | PROCESSOR TYPE 1 | 28 | PROCESSOR TYPE 2 | and a table for harddrives: HARDDRIVES: ID | NAME | ---------------------------| 35 | HARDDRIVE TYPE 25 | 36 | HARDDRIVE TYPE 90 | Each computer can have many attributes from the different attributes tables (processors, harddrives etc), so I have intersection tables like this, to link the attributes to the computers: COMPUTER_PROCESSORS: C_ID | P_ID | --------------| 13 | 27 | 13 | 28 | 14 | 27 | COMPUTER_HARDDRIVES: C_ID | H_ID | --------------| 13 | 35 | So user JOHN, with id 1 owns computer 13 and 14. Computer 13 has processor 27 and 28, and computer 13 has harddrive 35. Computer 14 has processor 27 and no harddrive. Given a user's id, I would like to retrieve a list of that user's computers with each computers attributes. I have figured out a query that gives me a somewhat of a result: SELECT computers.id, processors.id AS p_id, processors.name AS p_name, harddrives.id AS h_id, harddrives.name AS h_name, FROM computers JOIN computer_processors ON (computer_processors.c_id = computers.id) JOIN processors ON (processors.id = computer_processors.p_id) JOIN computer_harddrives ON (computer_harddrives.c_id = computers.id) JOIN harddrives ON (harddrives.id = computer_harddrives.h_id) WHERE computers.user_id = 1 Result: ID | P_ID | P_NAME | H_ID | H_NAME | ----------------------------------------------------------- 13 | 27 | PROCESSOR TYPE 1 | 35 | HARDDRIVE TYPE 25 | 13 | 28 | PROCESSOR TYPE 2 | 35 | HARDDRIVE TYPE 25 | But this has several problems... Computer 14 doesnt show up, because it has no harddrive. Can I somehow make an OUTER JOIN to make sure that all computers show up, even if there a some attributes they don't have? Computer 13 shows up twice, with the same harddrive listet for both. When more attributes are added to a computer (like 3 blocks of ram), the number of rows returned for that computer gets pretty big, and it makes it had to sort the result out in application code. Can I somehow make a query, that groups the two returned rows together? Or a query that returns NULL in the h_name column in the second row, so that all values returned are unique? EDIT: What I would like to return is something like this: ID | P_ID | P_NAME | H_ID | H_NAME | ----------------------------------------------------------- 13 | 27 | PROCESSOR TYPE 1 | 35 | HARDDRIVE TYPE 25 | 13 | 28 | PROCESSOR TYPE 2 | 35 | NULL | 14 | 27 | PROCESSOR TYPE 1 | NULL | NULL | Or whatever result that make it easy to turn it into an array like this [13] => [P_NAME] => [0] => PROCESSOR TYPE 1 [1] => PROCESSOR TYPE 2 [H_NAME] => [0] => HARDDRIVE TYPE 25 [14] => [P_NAME] => [0] => PROCESSOR TYPE 1

  Read the article

• Counting point size based on chart area during zooming/unzoomin

  - by Gacek

  Hi folks. I heave a quite simple task. I know (I suppose) it should be easy, but from the reasons I cannot understand, I try to solve it since 2 days and I don't know where I'm making the mistake. So, the problem is as follows: - we have a chart with some points - The chart starts with some known area and points have known size - we would like to "emulate" the zooming effect. So when we zoom to some part of the chart, the size of points is getting proportionally bigger. In other words, the smaller part of the chart we select, the bigger the point should get. So, we have something like that. We know this two parameters: initialArea; // Initial area - area of the whole chart, counted as width*height initialSize; // initial size of the points Now lets assume we are handling some kind of OnZoom event. We selected some part of the chart and would like to count the current size of the points float CountSizeOnZoom() { float currentArea = CountArea(...); // the area is counted for us. float currentSize = initialSize * initialArea / currentArea; return currentSize; } And it works. But the rate of change is too fast. In other words, the points are getting really big too soon. So I would like the currentSize to be invertly proportional to currentArea, but with some scaling coefficient. So I created the second function: float CountSizeOnZoom() { float currentArea = CountArea(...); % the area is counted for us. // Lets assume we want the size of points to change ten times slower, than area of the chart changed. float currentSize = initialSize + 0.1f* initialSize * ((initialArea / currentArea) -1); return currentSize; } Lets do some calculations in mind. if currentArea is smaller than initialArea, initialArea/currentArea > 1 and then we add "something" small and postive to initialSize. Checked, it works. Lets check what happens if we would un-zoom. currentArea will be equal to initialArea, so we would have 0 at the right side (1-1), so new size should be equal to initialSize. Right? Yeah. So lets check it... and it doesn't work. My question is: where is the mistake? Or maybe you have any ideas how to count this scaled size depending on current area in some other way?

  Read the article

• Which is the "best" data access framework/approach for C# and .NET?

  - by Frans

  (EDIT: I made it a community wiki as it is more suited to a collaborative format.) There are a plethora of ways to access SQL Server and other databases from .NET. All have their pros and cons and it will never be a simple question of which is "best" - the answer will always be "it depends". However, I am looking for a comparison at a high level of the different approaches and frameworks in the context of different levels of systems. For example, I would imagine that for a quick-and-dirty Web 2.0 application the answer would be very different from an in-house Enterprise-level CRUD application. I am aware that there are numerous questions on Stack Overflow dealing with subsets of this question, but I think it would be useful to try to build a summary comparison. I will endeavour to update the question with corrections and clarifications as we go. So far, this is my understanding at a high level - but I am sure it is wrong... I am primarily focusing on the Microsoft approaches to keep this focused. ADO.NET Entity Framework Database agnostic Good because it allows swapping backends in and out Bad because it can hit performance and database vendors are not too happy about it Seems to be MS's preferred route for the future Complicated to learn (though, see 267357) It is accessed through LINQ to Entities so provides ORM, thus allowing abstraction in your code LINQ to SQL Uncertain future (see Is LINQ to SQL truly dead?) Easy to learn (?) Only works with MS SQL Server See also Pros and cons of LINQ "Standard" ADO.NET No ORM No abstraction so you are back to "roll your own" and play with dynamically generated SQL Direct access, allows potentially better performance This ties in to the age-old debate of whether to focus on objects or relational data, to which the answer of course is "it depends on where the bulk of the work is" and since that is an unanswerable question hopefully we don't have to go in to that too much. IMHO, if your application is primarily manipulating large amounts of data, it does not make sense to abstract it too much into objects in the front-end code, you are better off using stored procedures and dynamic SQL to do as much of the work as possible on the back-end. Whereas, if you primarily have user interaction which causes database interaction at the level of tens or hundreds of rows then ORM makes complete sense. So, I guess my argument for good old-fashioned ADO.NET would be in the case where you manipulate and modify large datasets, in which case you will benefit from the direct access to the backend. Another case, of course, is where you have to access a legacy database that is already guarded by stored procedures. ASP.NET Data Source Controls Are these something altogether different or just a layer over standard ADO.NET? - Would you really use these if you had a DAL or if you implemented LINQ or Entities? NHibernate Seems to be a very powerful and powerful ORM? Open source Some other relevant links; NHibernate or LINQ to SQL Entity Framework vs LINQ to SQL

  Read the article

• Not allowing characters after Space. Mysql Insert With PHP

  - by Jake

  Ok so I think this is easy but I dont know (I'm a novice to PHP and MySQL). I have a select that is getting data from a table in the database. I am simply taking whatever options the user selects and putting it into a separate table with a php mysql insert statement. But I am having a problem. When I hit submit, everything is submitted properly except for any select options that have spaces don't submit after the first space. For example if the option was COMPUTER REPAIR, all that would get sent is COMPUTER. I will post code if needed, and any help would be greatly appreciated. Thanks! Ok here is my select code: <?php include("./config.php"); $query="SELECT id,name FROM category_names ORDER BY name"; $result = mysql_query ($query); echo"<div style='overflow:auto;width:100%'><label>Categories (Pick three that describe your business)</label><br/><select name='select1'><option value='0'>Please Select A Category</option>"; // printing the list box select command while($catinfo=mysql_fetch_array($result)){//Array or records stored in $nt echo "<option>$catinfo[name]</option><br/> "; } echo"</select></div>"; ?> And here is my insert code ( Just to let you know its got everything not just the select!) ?php require("./config.php"); $companyname = mysql_real_escape_string(addslashes(trim($_REQUEST['name']))); $phone = mysql_real_escape_string(addslashes($_REQUEST['phone'])); $zipcode = mysql_real_escape_string(addslashes($_REQUEST['zipcode'])); $city = mysql_real_escape_string(addslashes($_REQUEST['city'])); $description = mysql_real_escape_string(addslashes($_REQUEST['description'])); $website = mysql_real_escape_string(addslashes($_REQUEST['website'])); $address = mysql_real_escape_string(addslashes($_REQUEST['address'])); $other = mysql_real_escape_string(addslashes($_REQUEST['other'])); $payment = mysql_real_escape_string(addslashes($_REQUEST['payment'])); $products = mysql_real_escape_string(addslashes($_REQUEST['products'])); $email = mysql_real_escape_string(addslashes($_REQUEST['email'])); $select1 = mysql_real_escape_string(addslashes($_REQUEST['select1'])); $select2 = mysql_real_escape_string(addslashes($_REQUEST['select2'])); $select3 = mysql_real_escape_string(addslashes($_REQUEST['select3'])); $save=$_POST['save']; if(!empty($save)){ $sql="INSERT INTO gj (name, phone, city, zipcode, description, dateadded, website, address1, other2, payment_options, Products, email,cat1,cat2,cat3) VALUES ('$companyname','$phone','$city','$zipcode','$description',curdate(),'$website','$address','$other','$payment','$products','$email','$select1','$select2','$select3')"; if (!mysql_query($sql,$link)) { die('Error: ' . mysql_error()); } echo "<br/><h2><font color='green' style='font-size:15px'>1 business added</font></h2>"; mysql_close($link); } ?>

  Read the article

• Where do you put your unit test?

  - by soulmerge

  I have found several conventions to housekeeping unit tests in a project and I'm not sure which approach would be suitable for our next PHP project. I am trying to find the best convention to encourage easy development and accessibility of the tests when reviewing the source code. I would be very interested in your experience/opinion regarding each: One folder for productive code, another for unit tests: This separates unit tests from the logic files of the project. This separation of concerns is as much a nuisance as it is an advantage: Someone looking into the source code of the project will - so I suppose - either browse the implementation or the unit tests (or more commonly: the implementation only). The advantage of unit tests being another viewpoint to your classes is lost - those two viewpoints are just too far apart IMO. Annotated test methods: Any modern unit testing framework I know allows developers to create dedicated test methods, annotating them (@test) and embedding them in the project code. The big drawback I see here is that the project files get cluttered. Even if these methods are separated using a comment header (like UNIT TESTS below this line) it just bloats the class unnecessarily. Test files within the same folders as the implementation files: Our file naming convention dictates that PHP files containing classes (one class per file) should end with .class.php. I could imagine that putting unit tests regarding a class file into another one ending on .test.php would render the tests much more present to other developers without tainting the class. Although it bloats the project folders, instead of the implementation files, this is my favorite so far, but I have my doubts: I would think others have come up with this already, and discarded this option for some reason (i.e. I have not seen a java project with the files Foo.java and FooTest.java within the same folder.) Maybe it's because java developers make heavier use of IDEs that allow them easier access to the tests, whereas in PHP no big editors have emerged (like eclipse for java) - many devs I know use vim/emacs or similar editors with little support for PHP development per se. What is your experience with any of these unit test placements? Do you have another convention I haven't listed here? Or am I just overrating unit test accessibility to reviewers?

  Read the article

• What the best approach to iterate and "store" files over a directory in C (Linux) ?

  - by Andrei Ciobanu

  I have written a function that checks if to files are duplicates or not. This function signature is: int check_dup_memmap(char *f1_name, char *f2_name) It returns: (-1) - If something went wrong; (0) - If the two files are similar; (+1) - If the two files are different; The next step is to write a function that iterates through all the files in a certain directory,apply the previous function, and gives a report on every existing duplicates. Initially I've thought to write a function that generates a file with all the filenames in a certain directory and then, read that file again and gain and compare every two files. Here is that version of the function, that gets all the filenames in a certain directory. void *build_dir_tree(char *dirname, FILE *f) { DIR *cdir = NULL; struct dirent *ent = NULL; struct stat buf; if(f == NULL){ fprintf(stderr, "NULL file submitted. [build_dir_tree].\n"); exit(-1); } if(dirname == NULL){ fprintf(stderr, "NULL dirname submitted. [build_dir_tree].\n"); exit(-1); } if((cdir = opendir(dirname)) == NULL){ char emsg[MFILE_LEN]; sprintf(emsg, "Cannot open dir: %s [build_dir_tree]\t",dirname); perror(emsg); } chdir(dirname); while ((ent = readdir(cdir)) != NULL) { lstat(ent->d_name, &buf); if (S_ISDIR(buf.st_mode)) { if (strcmp(".", ent->d_name) == 0 || strcmp("..", ent->d_name) == 0) { continue; } build_dir_tree(ent->d_name, f); } else{ fprintf(f, "/%s/%s\n",util_get_cwd(),ent->d_name); } } chdir(".."); closedir(cdir); } Still I consider this approach a little inefficient, as I have to parse the file again and again. In your opinion what are other approaches should I follow: Write a datastructure and hold the files instead of writing them in the file ? I think for a directory with a lot of files, the memory will become very fragmented. Hold all the filenames in auto-expanding array, so that I can easy access every file by their index, because they will in a contiguous memory location. Map this file in memory using mmap() ? But mmap may fail, as the file gets to big. Any opinions on this. I want to choose the most efficient path, and access as few resources as possible. This is the requirement of the program... EDIT: Is there a way to get the numbers of files in a certain directory, without iterating through it ?

  Read the article

< Previous Page | 516 517 518 519 520 521 522 523 524 525 526 527  | Next Page >