Search Results

Search found 14008 results on 561 pages for 'easy marks'.

Page 519/561 | < Previous Page | 515 516 517 518 519 520 521 522 523 524 525 526  | Next Page >

  • B-trees, databases, sequential inputs, and speed.

    - by IanC
    I know from experience that b-trees have awful performance when data is added to them sequentially (regardless of the direction). However, when data is added randomly, best performance is obtained. This is easy to demonstrate with the likes of an RB-Tree. Sequential writes cause a maximum number of tree balances to be performed. I know very few databases use binary trees, but rather used n-order balanced trees. I logically assume they suffer a similar fate to binary trees when it comes to sequential inputs. This sparked my curiosity. If this is so, then one could deduce that writing sequential IDs (such as in IDENTITY(1,1)) would cause multiple re-balances of the tree to occur. I have seen many posts argue against GUIDs as "these will cause random writes". I never use GUIDs, but it struck me that this "bad" point was in fact a good point. So I decided to test it. Here is my code: SET ANSI_NULLS ON GO SET QUOTED_IDENTIFIER ON GO CREATE TABLE [dbo].[T1]( [ID] [int] NOT NULL CONSTRAINT [T1_1] PRIMARY KEY CLUSTERED ([ID] ASC) ) GO CREATE TABLE [dbo].[T2]( [ID] [uniqueidentifier] NOT NULL CONSTRAINT [T2_1] PRIMARY KEY CLUSTERED ([ID] ASC) ) GO declare @i int, @t1 datetime, @t2 datetime, @t3 datetime, @c char(300) set @t1 = GETDATE() set @i = 1 while @i < 2000 begin insert into T2 values (NEWID(), @c) set @i = @i + 1 end set @t2 = GETDATE() WAITFOR delay '0:0:10' set @t3 = GETDATE() set @i = 1 while @i < 2000 begin insert into T1 values (@i, @c) set @i = @i + 1 end select DATEDIFF(ms, @t1, @t2) AS [Int], DATEDIFF(ms, @t3, getdate()) AS [GUID] drop table T1 drop table T2 Note that I am not subtracting any time for the creation of the GUID nor for the considerably extra size of the row. The results on my machine were as follows: Int: 17,340 ms GUID: 6,746 ms This means that in this test, random inserts of 16 bytes was almost 3 times faster than sequential inserts of 4 bytes. Would anyone like to comment on this? Ps. I get that this isn't a question. It's an invite to discussion, and that is relevant to learning optimum programming.

    Read the article

  • Move options between multiple lists

    - by Martha
    We currently have a form with the standard multi-select functionality of "here are the available options, here are the selected options, here are some buttons to move stuff back and forth." However, the client now wants the ability to not just select certain items, but to also categorize them. For example, given a list of books, they want to not just select the ones they own, but also the ones they've read, the ones they would like to read, and the ones they've heard about. (All examples fictional.) Thankfully, a selected item can only be in one category at a time. I can find many examples of moving items between listboxes, but not a single one for moving items between multiple listboxes. To add to the complication, the form needs to have two sets of list+categories, e.g. a list of movies that need to be categorized in addition to the aforementioned books. EDIT: Having now actually sat down to try to code the non-javascripty bits, I need to revise my question, because I realized that multiple select lists won't really work from the "how do I inform the server about all this lovely new information" standpoint. So the html code is now a pseudo-listbox, i.e. an unordered list (ul) displayed in a box with a scrollbar, and each list item (<li>) has a set of five radio buttons (unselected/own/read/like/heard). My task is still roughly the same: how to take this one list and make it easy to categorize the items, in such a way that the user can tell at a glance what is in what category. (The pseudo-listbox has some of the same disadvantages as a multi-select listbox, namely it's hard to tell what's selected if the list is long enough to scroll.) The dream solution would be a drag-and-drop type thing, but at this point even buttons would be OK. Another modification (a good one) is that the client has revised the lists, so the longest is now "only" 62 items long (instead of the many hundreds they had before). The categories will still mostly contain zero, one, or two selected items, possibly a couple more if the user was overzealous. As far as OS and stuff, the site is in classic asp (quit snickering!), the server-side code is VBScript, and so far we've avoided the various Javascript libraries by the simple expedient of almost never using client-side scripting. This one form for this one client is currently the big exception. Give 'em an inch and they want a mile... Oh, and I have to add: I suck at Javascript, or really at any C-descendant language. Curly braces give me hives. I'd really, really like something I can just copy & paste into my page, maybe tweak some variable names, and never look at it again. A girl can dream, can't she? :) [existing code deleted because it's largely irrelevant.]

    Read the article

  • How to get the top keys from a hash by value

    - by Kirs Kringle
    I have a hash that I sorted by values greatest to least. How would I go about getting the top 5? There was a post on here that talked about getting only one value. What is the easiest way to get a key with the highest value from a hash in Perl? I understand that so would lets say getting those values add them to an array and delete the element in the hash and then do the process again? Seems like there should be an easier way to do this then that though. My hash is called %words. use strict; use warnings; use Tk; #Learn to install here: http://factscruncher.blogspot.com/2012/01/easy-way-to-install-tk- on-strawberry.html #Reading in the text file my $file0 = Tk::MainWindow->new->Tk::getOpenFile; open( my $filehandle0, '<', $file0 ) || die "Could not open $file0\n"; my @words; while ( my $line = <$filehandle0> ) { chomp $line; my @word = split( /\s+/, lc($line)); push( @words, @word ); } for (@words) { s/[\,|\.|\!|\?|\:|\;|\"]//g; } #Counting words that repeat; put in hash my %words_count; $words_count{$_}++ for @words; #Reading in the stopwords file my $file1 = "stoplist.txt"; open( my $filehandle1, '<', $file1 ) or die "Could not open $file1\n"; my @stopwords; while ( my $line = <$filehandle1> ) { chomp $line; my @linearray = split( " ", $line ); push( @stopwords, @linearray ); } for my $w ( my @stopwords ) { s/\b\Q$w\E\B//ig; } #Comparing the array to Hash and deleteing stopwords my %words = %words_count; for my $stopwords ( @stopwords ) { delete $words{ $stopwords }; } #Sorting Hash Table my @keys = sort { $words{$b} <=> $words{$a} or "\L$a" cmp "\L$b" } keys %words; #Starting Statistical Work my $value_count = 0; my $key_count = 0; #Printing Hash Table $key_count = keys %words; foreach my $key (@keys) { $value_count = $words{$key} + $value_count; printf "%-20s %6d\n", $key, $words{$key}; } my $value_average = $value_count / $key_count; #my @topwords; #foreach my $key (@keys){ #if($words{$key} > $value_average){ # @topwords = keys %words; # } #} print "\n", "The number of values: ", $value_count, "\n"; print "The number of elements: ", $key_count, "\n"; print "The Average: ", $value_average, "\n\n";

    Read the article

  • What are the weaknesses of this user authentication method?

    - by byronh
    I'm developing my own PHP framework. It seems all the security articles I have read use vastly different methods for user authentication than I do so I could use some help in finding security holes. Some information that might be useful before I start. I use mod_rewrite for my MVC url's. Passwords are sha1 and md5 encrypted with 24 character salt unique to each user. mysql_real_escape_string and/or variable typecasting on everything going in, and htmlspecialchars on everything coming out. Step-by step process: Top of every page: session_start(); session_regenerate_id(); If user logs in via login form, generate new random token to put in user's MySQL row. Hash is generated based on user's salt (from when they first registered) and the new token. Store the hash and plaintext username in session variables, and duplicate in cookies if 'Remember me' is checked. On every page, check for cookies. If cookies set, copy their values into session variables. Then compare $_SESSION['name'] and $_SESSION['hash'] against MySQL database. Destroy all cookies and session variables if they don't match so they have to log in again. If login is valid, some of the user's information from the MySQL database is stored in an array for easy access. So far, I've assumed that this array is clean so when limiting user access I refer to user.rank and deny access if it's below what's required for that page. I've tried to test all the common attacks like XSS and CSRF, but maybe I'm just not good enough at hacking my own site! My system seems way too simple for it to actually be secure (the security code is only 100 lines long). What am I missing? I've also spent alot of time searching for the vulnerabilities with mysql_real_escape string but I haven't found any information that is up-to-date (everything is from several years ago at least and has apparently been fixed). All I know is that the problem was something to do with encoding. If that problem still exists today, how can I avoid it? Any help will be much appreciated.

    Read the article

  • How can you prevent both jumpiness, and interrupting tweens with animated Flash buttons?

    - by Kevin Suttle
    This is something I've never been able to figure out. You've got a button offscreen you want to animate in. We'll call it 'btn.' You've got a hit area that serves as the proximity sensor to trigger btn's animation. We'll call it 'hitZone' (as to not cause confusion with the hitArea property of display objects). Both btn and hitZone are MovieClips. The listeners go something like this. import com.greensock.*; import com.greensock.easing.*; import flash.events.MouseEvent; var endPoint:Number = 31; hitZone.addEventListener(MouseEvent.ROLL_OVER, onHitZoneOver); hitZone.addEventListener(MouseEvent.ROLL_OUT, onHitZoneOut); hitZone.addEventListener(MouseEvent.CLICK, onHitZoneClick); btn.addEventListener(MouseEvent.ROLL_OVER, onBtnOver); btn.addEventListener(MouseEvent.ROLL_OUT, onBtnOut); btn.addEventListener(MouseEvent.CLICK, onBtnClick); btn.mouseChildren = false; function onHitZoneOver(e:MouseEvent):void { TweenLite.to(btn, 0.75, {x:endPoint, ease:Expo.easeOut}); trace("over hitZone"); } function onHitZoneOut(e:MouseEvent):void { TweenLite.to(btn, 0.75, {x:-1, ease:Expo.easeOut}); trace("out hitZone"); } function onBtnOver(e:MouseEvent):void { hitZone.mouseEnabled = false; hitZone.removeEventListener(MouseEvent.ROLL_OVER, onHitZoneOver); hitZone.removeEventListener(MouseEvent.ROLL_OUT, onHitZoneOut); trace("over BTN"); // This line is the only thing keeping the btn animation from being fired continuously // causing jumpiness. However, calling this allows the animation to be interrupted // at any point. TweenLite.killTweensOf(btn); } function onBtnOut(e:MouseEvent):void { hitZone.mouseEnabled = true; hitZone.addEventListener(MouseEvent.ROLL_OVER, onHitZoneOver); hitZone.addEventListener(MouseEvent.ROLL_OUT, onHitZoneOut); trace("out BTN"); } function onBtnClick(e:MouseEvent):void { trace("click BTN"); } function onHitZoneClick(e:MouseEvent):void { trace("click hitZone"); } The issue is when your mouse is over both the hitZone and btn. The button continuously jumps unless you call TweenLite.killAllTweensOf(). This fixes the jumpiness, but it introduces a new problem. Now, it's very easy to interrupt the animation of the btn at any point, stopping it before it's totally visible on the stage. I've seen similar posts, but even they suffer from the same issue. Perhaps it's a problem with how Flash detects edges, because I've never once seen a workaround for this.

    Read the article

  • UIScrollView Infinite Scrolling

    - by Ben Robinson
    I'm attempting to setup a scrollview with infinite (horizontal) scrolling. Scrolling forward is easy - I have implemented scrollViewDidScroll, and when the contentOffset gets near the end I make the scrollview contentsize bigger and add more data into the space (i'll have to deal with the crippling effect this will have later!) My problem is scrolling back - the plan is to see when I get near the beginning of the scroll view, then when I do make the contentsize bigger, move the existing content along, add the new data to the beginning and then - importantly adjust the contentOffset so the data under the view port stays the same. This works perfectly if I scroll slowly (or enable paging) but if I go fast (not even very fast!) it goes mad! Heres the code: - (void) scrollViewDidScroll:(UIScrollView *)scrollView { float pageNumber = scrollView.contentOffset.x / 320; float pageCount = scrollView.contentSize.width / 320; if (pageNumber > pageCount-4) { //Add 10 new pages to end mainScrollView.contentSize = CGSizeMake(mainScrollView.contentSize.width + 3200, mainScrollView.contentSize.height); //add new data here at (320*pageCount, 0); } //*** the problem is here - I use updatingScrollingContent to make sure its only called once (for accurate testing!) if (pageNumber < 4 && !updatingScrollingContent) { updatingScrollingContent = YES; mainScrollView.contentSize = CGSizeMake(mainScrollView.contentSize.width + 3200, mainScrollView.contentSize.height); mainScrollView.contentOffset = CGPointMake(mainScrollView.contentOffset.x + 3200, 0); for (UIView *view in [mainContainerView subviews]) { view.frame = CGRectMake(view.frame.origin.x+3200, view.frame.origin.y, view.frame.size.width, view.frame.size.height); } //add new data here at (0, 0); } //** MY CHECK! NSLog(@"%f", mainScrollView.contentOffset.x); } As the scrolling happens the log reads: 1286.500000 1285.500000 1284.500000 1283.500000 1282.500000 1281.500000 1280.500000 Then, when pageNumber<4 (we're getting near the beginning): 4479.500000 4479.500000 Great! - but the numbers should continue to go down in the 4,000s but the next log entries read: 1278.000000 1277.000000 1276.500000 1275.500000 etc.... Continiuing from where it left off! Just for the record, if scrolled slowly the log reads: 1294.500000 1290.000000 1284.500000 1280.500000 4476.000000 4476.000000 4473.000000 4470.000000 4467.500000 4464.000000 4460.500000 4457.500000 etc.... Any ideas???? Thanks Ben.

    Read the article

  • Python/Biomolecular Physics- Trying to code a simple stochastic simulation of a system exhibiting co

    - by user359597
    *edited 6/17/10 I'm trying to understand how to improve my code (make it more pythonic). Also, I'm interested in writing more intuitive 'conditionals' that would describe scenarios that are commonplace in biochemistry. The conditional criteria in the below program is explained in Answer #2, but I am not satisfied with it- it is correct, but isn't obvious and isn't easy to implement for more complicated conditional scenarios. Ideas welcome. Comments/criticisms welcome. First posting experience @ stackoverflow- please comment on etiquette if needed. The code generates a list of values that are the solution to the following exercise: "In a programming language of your choice, implement Gillespie’s First Reaction Algorithm to study the temporal behaviour of the reaction A---B in which the transition from A to B can only take place if another compound, C, is present, and where C dynamically interconverts with D, as modelled in the Petri-net below. Assume that there are 100 molecules of A, 1 of C, and no B or D present at the start of the reaction. Set kAB to 0.1 s-1 and both kCD and kDC to 1.0 s-1. Simulate the behaviour of the system over 100 s." def sim(): # Set the rate constants for all transitions kAB = 0.1 kCD = 1.0 kDC = 1.0 # Set up the initial state A = 100 B = 0 C = 1 D = 0 # Set the start and end times t = 0.0 tEnd = 100.0 print "Time\t", "Transition\t", "A\t", "B\t", "C\t", "D" # Compute the first interval transition, interval = transitionData(A, B, C, D, kAB, kCD, kDC) # Loop until the end time is exceded or no transition can fire any more while t <= tEnd and transition >= 0: print t, '\t', transition, '\t', A, '\t', B, '\t', C, '\t', D t += interval if transition == 0: A -= 1 B += 1 if transition == 1: C -= 1 D += 1 if transition == 2: C += 1 D -= 1 transition, interval = transitionData(A, B, C, D, kAB, kCD, kDC) def transitionData(A, B, C, D, kAB, kCD, kDC): """ Returns nTransition, the number of the firing transition (0: A->B, 1: C->D, 2: D->C), and interval, the interval between the time of the previous transition and that of the current one. """ RAB = kAB * A * C RCD = kCD * C RDC = kDC * D dt = [-1.0, -1.0, -1.0] if RAB > 0.0: dt[0] = -math.log(1.0 - random.random())/RAB if RCD > 0.0: dt[1] = -math.log(1.0 - random.random())/RCD if RDC > 0.0: dt[2] = -math.log(1.0 - random.random())/RDC interval = 1e36 transition = -1 for n in range(len(dt)): if dt[n] > 0.0 and dt[n] < interval: interval = dt[n] transition = n return transition, interval if __name__ == '__main__': sim()

    Read the article

  • Ideas for designing an automated content tagging system needed

    - by Benjamin Smith
    I am currently designing a website that amongst other is required to display and organise small amounts of text content (mainly quotes, article stubs, etc.). I currently have a database with 250,000+ items and need to come up with a method of tagging each item with relevant tags which will eventually allow for easy searching/browsing of the content for users. A very simplistic idea I have (and one that I believe is employed by some sites that I have been looking to for inspiration (http://www.brainyquote.com/quotes/topics.html)), is to simply search the database for certain words or phrases and use these words as tags for the content. This can easily be extended so that if for example a user wanted to show all items with a theme of love then I would just return a list of items with words and phrases relating to this theme. This would not be hard to implement but does not provide very good results. For example if I were to search for the month 'May' in the database with the aim of then classifying the items returned as realting to the topic of Spring then I would get back all occurrences of the word May, regardless of the semantic meaning. Another shortcoming of this method is that I believe it would be quite hard to automate the process to any large scale. What I really require is a library that can take an item, break it down and analyse the semantic meaning and also return a list of tags that would correctly classify the item. I know this is a lot to ask and I have a feeling I will end up reverting to the aforementioned method but I just thought I should ask if anyone knew of any pre-existing solution. I think that as the items in the database are short then it is probably quite a hard task to analyse any meaning from them however I may be mistaken. Another path to possibly go down would be to use something like amazon turk to outsource the task which may produce good results but would be expensive. Eventually I would like users to be able to (and want to!) tag content and to vote for the most relevant tags, possibly using a gameification mechanic as motivation however this is some way down the line. A temporary fix may be the best thing if this were the route I decided to go down as I could use the rough results I got as the starting point for a more in depth solution. If you've read this far, thanks for sticking with me, I know I'm spitballing but any input would be really helpful. Thanks.

    Read the article

  • Learn C# now or finish up with Java and then learn C#?

    - by Sahat
    Ok here is my situation. I've studied Java in my college for 2 semesters. But you know they teach you jack in there, just the basics. We skipped half of our textbook and even then our professors don't teach from section to section of each chapter. I don't blame them. It's hard as it is for new students to understand even the basic concepts of programming. Now this is a community college we are talking about and not Stanford, MIT or Berkeley. So like I said I've done 2 semester of Java. I really like our textbook because it has some challenging projects to do at the end of each chapter. This textbook is pretty clear and i have no problem understanding it (although 2-D and 3-D Arrays have given me some trouble). I have tried reading a few C# books such as Pro C# 2008 and .NET 3.5 and C# 4.0 in a Nutshell. I found these books to be dry and overloaded with information that put me to sleep (No offense to the authors of those 2 wonderful, according to amazon ratings, books). Would you suggest I finish my Java textbook, brush up my knowledge of Arrays, Polymorphism, and etc that are universal to most programming languages. And then switch to C#, plus the syntax is very similar so it should be easy to switch. Or should I just start learning C# right now from the very beginning? If it's the latter then could you recommend some free online resources that will keep me engaged and at the same time teach me everything I need to know about C#. Someone has recommended me to learn .NET first, but I found it to be not the brightest idea. .NET is just a big monster full of libraries. How am I going to apply it if I don't even know the C# or VB!? Anyway back to my question: Master Java and switch to C# or just go with C#? DISCLAIMER: I don't want to start .NET vs J2EE or C# vs Java flame war. I am going with C#. I've decided that I want to work in a Microsoft shop in the future. .NET is what I want to learn. Thanks! Will be waiting for the answers.

    Read the article

  • Summarising (permanently) data in a SQL table

    - by Cylindric
    Geetings, Stackers. I have a huge number of data-points in a SQL table, and I want to summarise them in a way reminiscent of RRD. Assuming a table such as ID | ENTITY_ID | SCORE_DATE | SCORE | SOME_OTHER_DATA ----+-----------+------------+-------+----------------- 1 | A00000001 | 01/01/2010 | 100 | some data 2 | A00000002 | 01/01/2010 | 105 | more data 3 | A00000003 | 01/01/2010 | 104 | various text ... | ......... | .......... | ..... | ... ... | A00009999 | 01/01/2010 | 101 | ... | A00000001 | 02/01/2010 | 104 | ... | A00000002 | 02/01/2010 | 119 | ... | A00000003 | 02/01/2010 | 119 | ... | ......... | .......... | ..... | ... | A00009999 | 02/01/2010 | 101 | arbitrary data ... | ......... | .......... | ..... | ... ... | A00000001 | 01/02/2010 | 104 | ... | A00000002 | 01/02/2010 | 119 | ... | A00000003 | 01/01/2010 | 119 | I want to end up with one record per entity, per month: ID | ENTITY_ID | SCORE_DATE | SCORE | ----+-----------+------------+-------+ ... | A00000001 | 01/01/2010 | 100 | ... | A00000002 | 01/01/2010 | 105 | ... | A00000003 | 01/01/2010 | 104 | ... | A00000001 | 01/02/2010 | 100 | ... | A00000002 | 01/02/2010 | 105 | ... | A00000003 | 01/02/2010 | 104 | (I Don't care about the SOME_OTHER_DATA - I'll pick something - either the first or last record probably.) What's an easy way of doing this on a regular basis, so that anything in the last calendar month is summarised in this way? At the moment my plan is kind of: For each EntityID For each month Find average score for all records in given month Update first record with results of previous step Delete all records that aren't the first I can't think of a neat way of doing it though, that doesn't involve lots of updates and iteration. This can either be done in a SQL Stored Procedure, or it can be incorporated into the .Net app that's generating this data, so the solution doesn't really need to be "one big SQL script", but can be :) (SQL-2005)

    Read the article

  • Get UITableView to scroll to the selected UITextField and Avoid Being Hidden by Keyboard

    - by Lauren Quantrell
    I have a UITextField in a table view on a UIViewController (not a UITableViewController). If the table view is on a UITableViewController, the table will automatically scroll to the textField being edited to prevent it from being hidden by the keyboard. But on a UIViewController it does not. I have tried for a couple of days reading through multiple ways to try to accomplish this and I cannot get it to work. The closest thing that actually scrolls is: -(void) textFieldDidBeginEditing:(UITextField *)textField { // SUPPOSEDLY Scroll to the current text field CGRect textFieldRect = [textField frame]; [self.wordsTableView scrollRectToVisible:textFieldRect animated:YES]; } However this only scrolls the table to the topmost row. What seems like an easy task has been a couple of days of frustration. I am using the following to construct the tableView cells: - (UITableViewCell *)tableView:(UITableView *)aTableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { NSString *identifier = [NSString stringWithFormat: @"%d:%d", [indexPath indexAtPosition: 0], [indexPath indexAtPosition:1]]; UITableViewCell *cell = [aTableView dequeueReusableCellWithIdentifier:identifier]; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithStyle:UITableViewCellStyleDefault reuseIdentifier:identifier] autorelease]; cell.accessoryType = UITableViewCellAccessoryNone; UITextField *theTextField = [[UITextField alloc] initWithFrame:CGRectMake(180, 10, 130, 25)]; theTextField.adjustsFontSizeToFitWidth = YES; theTextField.textColor = [UIColor redColor]; theTextField.text = [textFieldArray objectAtIndex:indexPath.row]; theTextField.keyboardType = UIKeyboardTypeDefault; theTextField.returnKeyType = UIReturnKeyDone; theTextField.font = [UIFont boldSystemFontOfSize:14]; theTextField.backgroundColor = [UIColor whiteColor]; theTextField.autocorrectionType = UITextAutocorrectionTypeNo; theTextField.autocapitalizationType = UITextAutocapitalizationTypeNone; theTextField.clearsOnBeginEditing = NO; theTextField.textAlignment = UITextAlignmentLeft; //theTextField.tag = 0; theTextField.tag=indexPath.row; theTextField.delegate = self; theTextField.clearButtonMode = UITextFieldViewModeWhileEditing; [theTextField setEnabled: YES]; [cell addSubview:theTextField]; [theTextField release]; } return cell; } I suspect I can get the tableView to scroll properly if I can somehow pass the indexPath.row in the textFieldDidBeginEditing method? Any help is appreciated.

    Read the article

  • Poor man's "lexer" for C#

    - by Paul Hollingsworth
    I'm trying to write a very simple parser in C#. I need a lexer -- something that lets me associate regular expressions with tokens, so it reads in regexs and gives me back symbols. It seems like I ought to be able to use Regex to do the actual heavy lifting, but I can't see an easy way to do it. For one thing, Regex only seems to work on strings, not streams (why is that!?!?). Basically, I want an implementation of the following interface: interface ILexer : IDisposable { /// <summary> /// Return true if there are more tokens to read /// </summary> bool HasMoreTokens { get; } /// <summary> /// The actual contents that matched the token /// </summary> string TokenContents { get; } /// <summary> /// The particular token in "tokenDefinitions" that was matched (e.g. "STRING", "NUMBER", "OPEN PARENS", "CLOSE PARENS" /// </summary> object Token { get; } /// <summary> /// Move to the next token /// </summary> void Next(); } interface ILexerFactory { /// <summary> /// Create a Lexer for converting a stream of characters into tokens /// </summary> /// <param name="reader">TextReader that supplies the underlying stream</param> /// <param name="tokenDefinitions">A dictionary from regular expressions to their "token identifers"</param> /// <returns>The lexer</returns> ILexer CreateLexer(TextReader reader, IDictionary<string, object> tokenDefinitions); } So, pluz send the codz... No, seriously, I am about to start writing an implementation of the above interface yet I find it hard to believe that there isn't some simple way of doing this in .NET (2.0) already. So, any suggestions for a simple way to do the above? (Also, I don't want any "code generators". Performance is not important for this thing and I don't want to introduce any complexity into the build process.)

    Read the article

  • Route Angular to New Controller after Login

    - by MizAkita
    I'm kind of stuck on how to route my angular app to a new controller after login. I have a simple app, that uses 'loginservice'... after logging in, it then routes to /home which has a different template from the index.html(login page). I want to use /home as the route that displays the partial views of my flightforms controllers. What is the best way to configure my routes so that after login, /home is the default and the routes are called into that particular templates view. Seems easy but I keep getting the /login page when i click on a link which is suppose to pass the partial view into the default.html template: var app= angular.module('myApp', ['ngRoute']); app.config(['$routeProvider', function($routeProvider) { $routeProvider.when('/login', { templateUrl: 'partials/login.html', controller: 'loginCtrl' }); $routeProvider.when('/home', { templateUrl: 'partials/default.html', controller: 'defaultCtrl' }); }]); flightforms.config(['$routeProvider', function($routeProvider){ //sub pages $routeProvider.when('/home', { templateUrl: 'partials/default.html', controller: 'defaultCtrl' }); $routeProvider.when('/status', { templateUrl: 'partials/subpages/home.html', controller: 'statusCtrl' }); $routeProvider.when('/observer-ao', { templateUrl: 'partials/subpages/aobsrv.html', controller: 'obsvaoCtrl' }); $routeProvider.when('/dispatch', { templateUrl: 'partials/subpages/disp.html', controller: 'dispatchCtrl' }); $routeProvider.when('/fieldmgr', { templateUrl: 'partials/subpages/fieldopmgr.html', controller: 'fieldmgrCtrl' }); $routeProvider.when('/obs-backoffice', { templateUrl: 'partials/subpages/obsbkoff.html', controller: 'obsbkoffCtrl' }); $routeProvider.when('/add-user', { templateUrl: 'partials/subpages/users.html', controller: 'userCtrl' }); $routeProvider.otherwise({ redirectTo: '/status' }); }]); app.run(function($rootScope, $location, loginService) { var routespermission=['/home']; //route that require login $rootScope.$on('$routeChangeStart', function(){ if( routespermission.indexOf($location.path()) !=-1) { var connected=loginService.islogged(); connected.then(function(msg) { if(!msg.data) $location.path('/login'); }); } }); }); and my controllers are simple. Here's a sample of what they look like: var flightformsControllers = angular.module('flightformsController', []); flightforms.controller('fieldmgrCtrl', ['$scope','$http','loginService', function($scope,loginService) { $scope.txt='You are logged in'; $scope.logout=function(){ loginService.logout(); } }]); Any ideas on how to get my partials to display in the /home default.html template would be appreciated.

    Read the article

  • When to call glEnable(GL_FRAMEBUFFER_SRGB)?

    - by Steven Lu
    I have a rendering system where I draw to an FBO with a multisampled renderbuffer, then blit it to another FBO with a texture in order to resolve the samples in order to read off the texture to perform post-processing shading while drawing to the backbuffer (FBO index 0). Now I'd like to get some correct sRGB output... The problem is the behavior of the program is rather inconsistent between when I run it on OS X and Windows and this also changes depending on the machine: On Windows with the Intel HD 3000 it will not apply the sRGB nonlinearity but on my other machine with a Nvidia GTX 670 it does. On the Intel HD 3000 in OS X it will also apply it. So this probably means that I'm not setting my GL_FRAMEBUFFER_SRGB enable state at the right points in the program. However I can't seem to find any tutorials that actually tell me when I ought to enable it, they only ever mention that it's dead easy and comes at no performance cost. I am currently not loading in any textures so I haven't had a need to deal with linearizing their colors yet. To force the program to not simply spit back out the linear color values, what I have tried is simply comment out my glDisable(GL_FRAMEBUFFER_SRGB) line, which effectively means this setting is enabled for the entire pipeline, and I actually redundantly force it back on every frame. I don't know if this is correct or not. It certainly does apply a nonlinearization to the colors but I can't tell if this is getting applied twice (which would be bad). It could apply the gamma as I render to my first FBO. It could do it when I blit the first FBO to the second FBO. Why not? I've gone so far as to take screen shots of my final frame and compare raw pixel color values to the colors I set them to in the program: I set the input color to RGB(1,2,3) and the output is RGB(13,22,28). That seems like quite a lot of color compression at the low end and leads me to question if the gamma is getting applied multiple times. I have just now gone through the sRGB equation and I can verify that the conversion seems to be only applied once as linear 1/255, 2/255, and 3/255 do indeed map to sRGB 13/255, 22/255, and 28/255 using the equation 1.055*C^(1/2.4)+0.055. Given that the expansion is so large for these low color values it really should be obvious if the sRGB color transform is getting applied more than once. So, I still haven't determined what the right thing to do is. does glEnable(GL_FRAMEBUFFER_SRGB) only apply to the final framebuffer values, in which case I can just set this during my GL init routine and forget about it hereafter?

    Read the article

  • c++ class member functions instatiated by traits

    - by Jive Dadson
    I am reluctant to say I can't figure this out, but I can't figure this out. I've googled and searched stackoverflow, and come up empty. The abstract, and possibly overly vague form of the question is, how can I use the traits-pattern to instantiate non-virtual member functions? The question came up while modernizing a set of multivariate function optimizers that I wrote more than 10 years ago. The optimizers all operate by selecting a straight-line path through the parameter space away from the current best point (the "update"), then finding a better point on that line (the "line search"), then testing for the "done" condition, and if not done, iterating. There are different methods for doing the update, the line-search, and conceivably for the done test, and other things. Mix and match. Different update formulae require different state-variable data. For example, the LMQN update requires a vector, and the BFGS update requires a matrix. If evaluating gradients is cheap, the line-search should do so. If not, it should use function evaluations only. Some methods require more accurate line-searches than others. Those are just some examples. The original version instantiates several of the combinations by means of virtual functions. Some traits are selected by setting mode bits that are tested at runtime. Yuck. It would be trivial to define the traits with #define's and the member functions with #ifdef's and macros. But that's so twenty years ago. It bugs me that I cannot figure out a whiz-bang modern way. If there were only one trait that varied, I could use the curiously recurring template pattern. But I see no way to extend that to arbitrary combinations of traits. I tried doing it using boost::enable_if, etc.. The specialized state info was easy. I managed to get the functions done, but only by resorting to non-friend external functions that have the this-pointer as a parameter. I never even figured out how to make the functions friends, much less member functions. The compiler (vc++ 2008) always complained that things didn't match. I would yell, "SFINAE, you moron!" but the moron is probably me. Perhaps tag-dispatch is the key. I haven't gotten very deeply into that. Surely it's possible, right? If so, what is best practice?

    Read the article

  • How To Load Images into Custom UITableViewCell?

    - by Clifton Burt
    This problem is simple, but crucial and urgent. Here's what needs to be done: load 66px x 66px images into the table cells in the MainViewController table. each TableCell has a unique image. But how? Would we use cell.image?... cell.image = [UIImage imageNamed:@"image.png"]; If so, where? Is an if/else statement required? Help? Here's the project code, hosted on Google Code, for easy and quick reference... http://www.google.com/codesearch/p?hl=en#Fcn2OtVUXnY/trunk/apple-sample-code/NavBar/NavBar/MyCustomCell.m&q=MyCustomCell%20lang:objectivec To load each cell's labels, MainViewController uses an NSDictionary and NSLocalizedString like so... //cell one menuList addObject:[NSDictionary dictionaryWithObjectsAndKeys: NSLocalizedString(@"PageOneTitle", @""), kTitleKey, NSLocalizedString(@"PageOneExplain", @""), kExplainKey, nil]]; //cell two menuList addObject:[NSDictionary dictionaryWithObjectsAndKeys: NSLocalizedString(@"PageOneTitle", @""), kTitleKey, NSLocalizedString(@"PageOneExplain", @""), kExplainKey, nil]]; ... // this is where MainViewController loads the cell content - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { MyCustomCell *cell = (MyCustomCell*)[tableView dequeueReusableCellWithIdentifier:kCellIdentifier]; if (cell == nil) { cell = [[[MyCustomCell alloc] initWithFrame:CGRectZero reuseIdentifier:kCellIdentifier] autorelease]; } ... // MyCustomCell.m adds the subviews - (id)initWithFrame:(CGRect)aRect reuseIdentifier:(NSString *)identifier { self = [super initWithFrame:aRect reuseIdentifier:identifier]; if (self) { // you can do this here specifically or at the table level for all cells self.accessoryType = UITableViewCellAccessoryDisclosureIndicator; // Create label views to contain the various pieces of text that make up the cell. // Add these as subviews. nameLabel = [[UILabel alloc] initWithFrame:CGRectZero]; // layoutSubViews will decide the final frame nameLabel.backgroundColor = [UIColor clearColor]; nameLabel.opaque = NO; nameLabel.textColor = [UIColor blackColor]; nameLabel.highlightedTextColor = [UIColor whiteColor]; nameLabel.font = [UIFont boldSystemFontOfSize:18]; [self.contentView addSubview:nameLabel]; explainLabel = [[UILabel alloc] initWithFrame:CGRectZero]; // layoutSubViews will decide the final frame explainLabel.backgroundColor = [UIColor clearColor]; explainLabel.opaque = NO; explainLabel.textColor = [UIColor grayColor]; explainLabel.highlightedTextColor = [UIColor whiteColor]; explainLabel.font = [UIFont systemFontOfSize:14]; [self.contentView addSubview:explainLabel]; //added to mark where the thumbnail image should go imageView = [[UIView alloc] initWithFrame:CGRectMake(0, 0, 66, 66)]; [self.contentView addSubview:imageView]; } return self; } HELP?

    Read the article

  • passing pipe to threads

    - by alaamh
    I see it's easy to open pipe between two process using fork, but how we can passing open pipe to threads. Assume we need to pass out of PROGRAM A to PROGRAM B "may by more than one thread", PROGRAM B send his output to PROGRAM C #include <stdio.h> #include <stdlib.h> #include <pthread.h> struct targ_s { int fd_reader; }; void *thread1(void *arg) { struct targ_s *targ = (struct targ_s*) arg; int status, fd[2]; pid_t pid; pipe(fd); pid = fork(); if (pid == 0) { dup2(STDIN_FILENO, targ->fd_reader); close(fd[0]); dup2(fd[1], STDOUT_FILENO); close(fd[1]); execvp ("PROGRAM B", NULL); exit(1); } else { close(fd[1]); dup2(fd[0], STDIN_FILENO); close(fd[0]); execl("PROGRAM C", NULL); wait(&status); return NULL; } } int main(void) { FILE *fpipe; char *command = "PROGRAM A"; char buffer[1024]; if (!(fpipe = (FILE*) popen(command, "r"))) { perror("Problems with pipe"); exit(1); } char* outfile = "out.dat"; FILE* f = fopen (outfile, "wb"); int fd = fileno( f ); struct targ_s targ; targ.fd_reader = fd; pthread_t thid; if (pthread_create(&thid, NULL, thread1, &targ) != 0) { perror("pthread_create() error"); exit(1); } int len; while (read(fpipe, buffer, sizeof (buffer)) != 0) { len = strlen(buffer); write(fd, buffer, len); } pclose(fpipe); return (0); }

    Read the article

  • Google Code + SVN or GitHub + Git

    - by Nazgulled
    Let me start by telling you that I never used anything besides SVN and I'm also a Windows user. I have a couple of simple projects that are open-source, others are on there way when I'm happy enough to release their source code but either way, I was thinking of using Google Code and SVN to share the source code of my projects instead of providing a link to the source on my website. This as always been a pain cause I had to update the binaries and the code every time I released a new version. This would also help me out to have a backup of my code some where instead of just my local machine (I used to have a local Subversion server running). What I want from a service like this is very simple... I just want a place to store my source code that people can download if they want, allows me to control revisions and provide a simple and easy issue system so people can submit bugs and stuff like that. I guess both of them have this. But I don't want to host any binaries in their websites, I want this to be hosted on my website so I can control download statistics with my own scripts, I also don't have the need for wiki pages as I prefer to have all the documentation in my own website. Does anyone of this services provide a way to "disable" features like wiki and downloads and don't show them at all for my project(s)? Now, I'm sure there are lots of pros and cons about using Google Code with SVN and GitHub with Git (of course) but here's what it's important for me on each one and why I like them: Google Code: As with any Google page, the complexity is almost non-existent Everyone (or almost) as a Google account and this is nice if people want to report problems using the issues system GitHub: May (or may not) be a little more complex (not a problem for me though) than Google's pages but... ...has a much prettier interface than Google's service It needs people to be registered on GitHub to post about issues I like the fact that with Git, you have your own revisions locally (can I use TortoiseGit for this or?) Basically that's it, not much I know... What other, most common, pros and cons can you tell me about each site/software? Keep in mind that my projects are simple, I'm probably the only one who will ever develop these projects on these repositories (or maybe not, for now I will)

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Getresponse not working after authentication

    - by Hazler
    For starters, here's my code: // Create a request using a URL that can receive a post. WebRequest request = WebRequest.Create("http://mydomain.com/cms/csharptest.php"); request.Credentials = new NetworkCredential("myUser", "myPass"); // Set the Method property of the request to POST. request.Method = "POST"; // Create POST data and convert it to a byte array. string postData = "name=PersonName&age=25"; byte[] byteArray = Encoding.UTF8.GetBytes(postData); // Set the ContentType property of the WebRequest. request.ContentType = "application/x-www-form-urlencoded"; // Set the ContentLength property of the WebRequest. request.ContentLength = byteArray.Length; // Get the request stream. Stream dataStream = request.GetRequestStream(); // Write the data to the request stream. dataStream.Write(byteArray, 0, byteArray.Length); // Close the Stream object. dataStream.Close(); // Get the response. HttpWebResponse response = (HttpWebResponse)request.GetResponse(); // Display the status. Console.WriteLine((response).StatusDescription); // Get the stream containing content returned by the server. dataStream = response.GetResponseStream(); // Open the stream using a StreamReader for easy access. StreamReader reader = new StreamReader(dataStream); // Read the content. string responseFromServer = reader.ReadToEnd(); // Display the content. Console.WriteLine(responseFromServer); // Clean up the streams. reader.Close(); dataStream.Close(); response.Close(); The directory cms/ requires authentication, but if I try running this same code somewhere, where authentication isn't needed, it works fine. The error (System.Net.WebException: The remote server returned an error: (403) Forbidden) occurs at HttpWebResponse response = (HttpWebResponse)request.GetResponse(); I have managed in reading data after authenticating, but not if I also send POST data. What's wrong with this?

    Read the article

  • What makes great software?

    - by VirtuosiMedia
    From the perspective of an end user, what makes a software great rather than just good or functional? What are some fundamental principles that can shift the way a software is used and perceived? What are some of the little finishing touches that help put an application over the top? I'm in the later stages of developing a web app and I'm looking for ideas or concepts that I may have missed. If you have specific examples of software or apps that you absolutely love, please share the reasons or features that make it special. Keep in mind that I'm looking for examples that directly affect the end user, but not necessarily just UI suggestions. Here are some of the principles and little touches I'm trying to use: Keep the UI as simple as possible. Remove absolutely everything that isn't necessary. Use progressive disclosure when more information can be needed sometimes but isn't needed all the time. Provide inline help and useful error messages. Verbs on buttons wherever possible. Make anything that's clickable obvious. Fast, responsive UI. Accessibility (this is a work in progress). Reusable UI patterns. Once a user learns a skill, they will be able to use it in multiple places. Intelligent default settings. Auto-focusing forms when filling out the form is the primary action to be taken on the page. Clear metaphors (like tabs) and headings indicating location within the app. Automating repetitive tasks (with the ability to disable the automation). Use standardized or accepted metaphors for icons (like an "x" for delete). Larger text sizes for improved readability. High contrast so that each section is distinct. Making sure that it's obvious on every page what the user is supposed to do by establishing a clear information hierarchy and drawing the eye to the call to action. Most deletions can be undone. Discoverability - Make it easy to learn how to do new tasks. Group similar elements together.

    Read the article

  • How can I send multiple types of objects across Protobuf?

    - by cyclotis04
    I'm implementing a client-server application, and am looking into various ways to serialize and transmit data. I began working with Xml Serializers, which worked rather well, but generate data slowly, and make large objects, especially when they need to be sent over the net. So I started looking into Protobuf, and protobuf-net. My problem lies in the fact that protobuf doesn't sent type information with it. With Xml Serializers, I was able to build a wrapper which would send and receive any various (serializable) object over the same stream, since object serialized into Xml contain the type name of the object. ObjectSocket socket = new ObjectSocket(); socket.AddTypeHandler(typeof(string)); // Tells the socket the types socket.AddTypeHandler(typeof(int)); // of objects we will want socket.AddTypeHandler(typeof(bool)); // to send and receive. socket.AddTypeHandler(typeof(Person)); // When it gets data, it looks for socket.AddTypeHandler(typeof(Address)); // these types in the Xml, then uses // the appropriate serializer. socket.Connect(_host, _port); socket.Send(new Person() { ... }); socket.Send(new Address() { ... }); ... Object o = socket.Read(); Type oType = o.GetType(); if (oType == typeof(Person)) HandlePerson(o as Person); else if (oType == typeof(Address)) HandleAddress(o as Address); ... I've considered a few solutions to this, including creating a master "state" type class, which is the only type of object sent over my socket. This moves away from the functionality I've worked out with Xml Serializers, though, so I'd like to avoid that direction. The second option would be to wrap protobuf objects in some type of wrapper, which defines the type of object. (This wrapper would also include information such as packet ID, and destination.) It seems silly to use protobuf-net to serialize an object, then stick that stream between Xml tags, but I've considered it. Is there an easy way to get this functionality out of protobuf or protobuf-net? I've come up with a third solution, and posted it below, but if you have a better one, please post it too!

    Read the article

  • Do You Really Know Your Programming Languages?

    - by Kristopher Johnson
    I am often amazed at how little some of my colleagues know or care about their craft. Something that constantly frustrates me is that people don't want to learn any more than they need to about the programming languages they use every day. Many programmers seem content to learn some pidgin sub-dialect, and stick with that. If they see a keyword or construct that they aren't familiar with, they'll complain that the code is "tricky." What would you think of a civil engineer who shied away from calculus because it had "all those tricky math symbols?" I'm not suggesting that we all need to become "language lawyers." But if you make your living as a programmer, and claim to be a competent user of language X, then I think at a minimum you should know the following: Do you know the keywords of the language and what they do? What are the valid syntactic forms? How are memory, files, and other operating system resources managed? Where is the official language specification and library reference for the language? The last one is the one that really gets me. Many programmers seem to have no idea that there is a "specification" or "standard" for any particular language. I still talk to people who think that Microsoft invented C++, and that if a program doesn't compile under VC6, it's not a valid C++ program. Programmers these days have it easy when it comes to obtaining specs. Newer languages like C#, Java, Python, Ruby, etc. all have their documentation available for free from the vendors' web sites. Older languages and platforms often have standards controlled by standards bodies that demand payment for specs, but even that shouldn't be a deterrent: the C++ standard is available from ISO for $30 (and why am I the only person I know who has a copy?). Programming is hard enough even when you do know the language. If you don't, I don't see how you have a chance. What do the rest of you think? Am I right, or should we all be content with the typical level of programming language expertise? Update: Several great comments here. Thanks. A couple of people hit on something that I didn't think about: What really irks me is not the lack of knowledge, but the lack of curiosity and willingness to learn. It seems some people don't have any time to hone their craft, but they have plenty of time to write lots of bad code. And I don't expect people to be able to recite a list of keywords or EBNF expressions, but I do expect that when they see some code, they should have some inkling of what it does. Few people have complete knowledge of every dark corner of their language or platform, but everyone should at least know enough that when they see something unfamiliar, they will know how to get whatever additional information they need to understand it.

    Read the article

  • C++ addition overload ambiguity

    - by Nate
    I am coming up against a vexing conundrum in my code base. I can't quite tell why my code generates this error, but (for example) std::string does not. class String { public: String(const char*str); friend String operator+ ( const String& lval, const char *rval ); friend String operator+ ( const char *lval, const String& rval ); String operator+ ( const String& rval ); }; The implementation of these is easy enough to imagine on your own. My driver program contains the following: String result, lval("left side "), rval("of string"); char lv[] = "right side ", rv[] = "of string"; result = lv + rval; printf(result); result = (lval + rv); printf(result); Which generates the following error in gcc 4.1.2: driver.cpp:25: error: ISO C++ says that these are ambiguous, even though the worst conversion for the first is better than the worst conversion for the second: String.h:22: note: candidate 1: String operator+(const String&, const char*) String.h:24: note: candidate 2: String String::operator+(const String&) So far so good, right? Sadly, my String(const char *str) constructor is so handy to have as an implicit constructor, that using the explicit keyword to solve this would just cause a different pile of problems. Moreover... std::string doesn't have to resort to this, and I can't figure out why. For example, in basic_string.h, they are declared as follows: template<typename _CharT, typename _Traits, typename _Alloc> basic_string<_CharT, _Traits, _Alloc> operator+(const basic_string<_CharT, _Traits, _Alloc>& __lhs, const basic_string<_CharT, _Traits, _Alloc>& __rhs) template<typename _CharT, typename _Traits, typename _Alloc> basic_string<_CharT,_Traits,_Alloc> operator+(const _CharT* __lhs, const basic_string<_CharT,_Traits,_Alloc>& __rhs); and so on. The basic_string constructor is not declared explicit. How does this not cause the same error I'm getting, and how can I achieve the same behavior??

    Read the article

  • How to use Mozilla ActiveX Control without registry

    - by Andrew McKinlay
    I've been using the IE Browser component that is part of Windows. But I'm running into problems with security settings. For example, users get security warnings on pages with Javascript. So I'm looking at using the Mozilla ActiveX control instead. It's especially nice because it has a compatible interface. It works well if I let it install the control in the registry. But my users don't always have administrator rights to install things in the registry. So I'm trying to figure out how to use the control without registry changes. I'm using DllGetClassObject to get the class factory (IID_ICLASSFACTORY) and then CoRegisterClassObject to register it. All the API calls appear to succeed. And when I create an AtlAxWin window with the CLSID, it also appears to work. But when I try to call Navigate on the AtlAxGetControl it doesn't work - the interface doesn't have Navigate. I would show the code but it's in an obscure language (Suneido) so it wouldn't mean much. An example in C or C++ would be easy for me to translate. Or an example in another dynamic language like Python or Ruby might be helpful. Obviously I'm doing something wrong. Maybe I'm passing the wrong thing to CoRegisterClassObject? The MSDN documentation isn't very clear on what to pass and I haven't found any good examples. Or if there is another approach, I'm ok with that too. Note: I'm using the AtlAxWin window class so I'm not directly creating the control and can't use this approach. Another option is registry free com with a manifest. But again, I couldn't find a good example, especially since I'm not using Visual Studio. I tried to use the MT manifest tool, but couldn't figure it out. I don't think I can use DLL redirection since that doesn't get around the registry issue AFAIK. Another possibility is using WebKit but it seems even harder to use.

    Read the article

< Previous Page | 515 516 517 518 519 520 521 522 523 524 525 526  | Next Page >